Kasp molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, detection method and application

By designing KASP molecular marker primer combinations and fluorescent probe technology, the problem of rapid and accurate detection of wilt resistance in bitter gourd was solved, breeding efficiency was improved, and it is suitable for high-throughput detection platforms.

CN120350154BActive Publication Date: 2026-02-13TROPICAL CORP STRAIN RESOURCE INST CHINESE ACAD OF TROPICAL AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510495116.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-21
Publication Date
2026-02-13
Estimated Expiration
2045-04-21

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately detect resistance to Fusarium wilt in bitter gourd, affecting breeding efficiency and breeding quality.

Method used

We designed and developed a KASP molecular marker primer combo, including specific upstream and downstream primers, combined with fluorescent probes for genotyping, to detect SNP sites associated with bitter gourd wilt disease, and developed a kit suitable for high-throughput molecular detection platforms.

Benefits of technology

It enables rapid and accurate identification of bitter gourd wilt resistance, improves breeding efficiency and level, reduces costs, and is suitable for high-throughput detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350154B_ABST
    Figure CN120350154B_ABST
Patent Text Reader

Abstract

The application provides a KASP molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, a detection method and application, and belongs to the technical field of molecular markers. The KASP-1559 molecular marker primer combination is designed according to the SNP site at position 22791559 on the 3rd chromosome of the bitter gourd, and is shown in SEQ ID NO. 1-3; the KASP-5409 molecular marker primer combination is designed according to the SNP site at position 22885409 on the 3rd chromosome of the bitter gourd, and is shown in SEQ ID NO. 4-6. The molecular marker primer combination can be used for rapidly identifying the resistance of the bitter gourd to fusarium wilt, has the advantages of accuracy, rapidness, low cost, short identification period, simple operation and the like, can assist new variety breeding of the bitter gourd, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, in particular to a KASP molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, a detection method and application. BACKGROUND

[0002] Bitter gourd fusarium wilt is a soil-borne disease caused by Fusarium oxysporum f.sp.momordicae, which can invade the vascular system of the plant, causing blockage of the conduit and hindering nutrient absorption, and eventually leading to the death of the whole plant. The pathogen can survive in the soil for a long time and has strong pathogenicity, which seriously affects the yield of bitter gourd and can reduce the yield by more than 30%. For a long time, breeding and planting of disease-resistant varieties have played an important role in the prevention and control of bitter gourd fusarium wilt. The development of molecular markers for detecting bitter gourd fusarium wilt resistance has important application value in screening bitter gourd germplasm resources resistant to fusarium wilt and rapidly identifying plants resistant to fusarium wilt in the breeding process.

[0003] KASP (Kompetitive Allele-Specific PCR) can achieve genotyping by specific recognition of gene sites by fluorescent probes, and can be used to detect SNP sites and InDel sites. Compared with SSR, RFLP, InDel and other molecular markers, KASP markers have the characteristics of rapid detection, low cost, easy to scale application, etc. KASP markers do not need to be typed according to the size of DNA fragments, and can get rid of the relatively cumbersome steps of traditional gel electrophoresis detection method, and overcome the disadvantage of low throughput, and are suitable for high-throughput molecular detection platform. Therefore, identifying functional SNP sites related to bitter gourd fusarium wilt resistance and developing KASP molecular markers for bitter gourd fusarium wilt resistance suitable for high-throughput molecular detection platform have important application value for improving the breeding efficiency and breeding level of bitter gourd in China. SUMMARY

[0004] Therefore, the present application provides a KASP molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, a detection method and application, which can be used to identify or assist in identifying bitter gourd fusarium wilt resistance, and provides excellent gene resources and selection tools for molecular breeding of bitter gourd resistant to fusarium wilt, and improves the breeding efficiency.

[0005] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:

[0006] The application provides a molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, comprising two specific upstream primers and a downstream primer, wherein the sequence of the first upstream primer KASP-1559F is shown in SEQ ID NO. 1, the sequence of the second upstream primer KASP-1559H is shown in SEQ ID NO. 2, and the sequence of the downstream primer KASP-1559R is shown in SEQ ID NO. 3 (KASP-1559 molecular marker primer combination).

[0007] The application also provides a molecular marker primer combination for detecting bitter gourd fusarium wilt resistance, comprising two specific upstream primers and a downstream primer, wherein the sequence of the first upstream primer KASP-5409F is shown in SEQ ID NO. 4, the sequence of the second upstream primer KASP-5409H is shown in SEQ ID NO. 5, and the sequence of the downstream primer KASP-5409R is shown in SEQ ID NO. 6 (KASP-5409 molecular marker primer combination).

[0008] Preferably, the 5' end of the first upstream primer is connected with a FAM fluorescent group tag sequence, and the 5' end of the second upstream primer is connected with a HEX fluorescent group tag sequence.

[0009] The application also provides a kit for detecting a KASP molecular marker related to bitter gourd fusarium wilt resistance, comprising the molecular marker primer combination.

[0010] The application also provides a method for identifying bitter gourd fusarium wilt resistance, comprising the following steps:

[0011] S1. extracting genomic DNA of a bitter gourd sample to be tested;

[0012] S2. using the genomic DNA of the bitter gourd sample to be tested as a template, performing PCR amplification on the template by using the molecular marker primer combination to obtain a PCR product;

[0013] S3. performing genotyping on the PCR product:

[0014] If the KASP-1559 molecular marker primer combination is used for amplification, if the genotype is G:G and G:C, it is determined as a resistant type; and if the genotype is C:C, it is determined as a susceptible type;

[0015] If the KASP-5409 molecular marker primer combination is used for amplification, if the genotype is C:C and T:C, it is determined as a resistant type; and if the genotype is T:T, it is determined as a susceptible type.

[0016] Preferably, the PCR amplification reaction system is as follows: 5 μL of 2×MasterMix for ASPCR, 2 μL of bitter gourd genomic DNA to be tested, 0.1 μL of the first upstream primer, 0.1 μL of the second upstream primer, 0.3 μL of the downstream primer, and 2.5 μL of ddH2O.

[0017] Preferably, the PCR amplification reaction program is as follows: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 40 s, 10 cycles, with a decrease of 0.6℃ per cycle; 95℃ for 20 s, 55℃ for 40 s, 25 cycles; 30℃ for 30 s.

[0018] The present invention also provides the application of the aforementioned molecular marker primer combination in at least one of the following:

[0019] (1) Application in identifying or assisting in the identification of resistance to Fusarium wilt in bitter gourd;

[0020] (2) Application in the preparation of a kit for identifying resistance to Fusarium wilt in bitter gourd;

[0021] (3) Application in molecular marker-assisted breeding of bitter gourd.

[0022] The present invention also provides the use of the kit in at least one of the following:

[0023] (1) Application in identifying or assisting in the identification of resistance to Fusarium wilt in bitter gourd;

[0024] (2) Application in molecular marker-assisted breeding of bitter gourd.

[0025] By adopting the above technical solutions, the present invention has the following beneficial effects: The present invention designs KASP-1559 molecular marker primer combinations targeting the SNP site at position 22791559 on chromosome 3 of bitter melon, as shown in SEQ ID NO. 1-3; and KASP-5409 molecular marker primer combinations targeting the SNP site at position 22885409 on chromosome 3 of bitter melon, as shown in SEQ ID NO. 4-6. The molecular marker primer combinations of the present invention can rapidly identify the resistance of bitter melon to Fusarium wilt, and have the advantages of accuracy, speed, low cost, short identification cycle, and simple operation. They can assist in the breeding of new bitter melon varieties and have broad application prospects. Attached Figure Description

[0026] Figure 1 The figure shows the results of detecting alleles related to resistance to Fusarium wilt in the F2 expanded population using the KASP-1559 molecular marker.

[0027] Figure 2 The image shows the results of detecting alleles related to resistance to Fusarium wilt in the F2 expanded population using the KASP-5409 molecular marker. DETAILED DESCRIPTION

[0028] The technical solutions provided by the present application are described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0029] Example 1. Primer design

[0030] The experimental materials used in the molecular marker development work were a high-generation inbred line susceptible material Mc131 and a high-generation inbred line resistant material Mc176 (Mc131 is a local variety from Vietnam, and Mc176 is a local variety from Nepal, both introduced in 2017). F1 generation was obtained by crossing Mc131 as the female parent and Mc176 as the male parent, F2 generation was obtained by selfing F1 generation, and high-resistant Fusarium wilt single plants and high-susceptible Fusarium wilt single plants were selected from the F2 generation by Fusarium wilt resistance identification.

[0031] 1. Preparation of Fusarium oxysporum f. sp. momordicae liquid

[0032] Fusarium oxysporum f. sp. momordicae "4501" was transferred to a potato dextrose agar culture medium plate, and the plate was placed in a 28℃ constant temperature incubator for 7-12d. After the Fusarium oxysporum f. sp. momordicae grew on the plate, a sterile puncher was used to take a 1cm diameter fungus cake, which was transferred to a high-temperature sterilized potato dextrose broth liquid culture medium. The liquid culture medium was placed in a 26℃, 120r·min -1 Shaking incubator for 7d. After the shaking incubation was completed, the mycelium was filtered using double-layer sterilized medical gauze, 10μL of Fusarium oxysporum f. sp. momordicae mother liquor was taken, the spore number was recorded under a microscope using a blood cell counting plate, and the mother liquor concentration was calculated. The mother liquor was diluted with sterile water to prepare a 1×10 6 cfu·mL -1 concentration of spore suspension, which was used for later cucumber seedling inoculation.

[0033] 2. Fusarium oxysporum f. sp. momordicae inoculation and resistance grading

[0034] The precise identification and evaluation system of bitter gourd fusarium wilt established by the research group was used for fusarium wilt inoculation and disease identification (Ling Y et al. Physiological research and identification and evaluation system construction of bitter gourd fusarium wilt resistance. 2024). The four-generation bitter gourd seeds were soaked in warm water for 8 h, then wrapped with double-layer sterile wet gauze, and placed in a 28℃ light incubator for germination. After the seeds germinated, they were sown in 7cm x 7cm x 8cm small pots filled with sterilized substrate soil. One germinated bitter gourd seed was sown in each pot. When the bitter gourd seedlings reached the two-leaf-one-heart stage, they were inoculated with fusarium oxysporum using the root irrigation method. A disposable syringe was used to inject the bacterial solution into the soil at the base of the bitter gourd stem. The bacterial solution inoculation amount for each bitter gourd seedling was 20mL. The four-generation bitter gourd after inoculation was cultured in a stable environment (temperature 28±1℃, day and night light duration 16h / 8h, relative humidity 80-85%) in a plant culture room.

[0035] The number of diseased plants and disease conditions of each generation population were investigated 25 days after inoculation, and the disease index was calculated. The disease index formula is DI = Σ (number of diseased plants x representative value of this level) / (total number of plants x highest representative) x 100. According to the disease index, the disease resistance phenotype of each generation population was determined. High resistance (HR): DI < 10; resistant (R): 10≤DI<30; medium resistance (MR): 30≤DI<50; susceptible (S): 50≤DI<70; highly susceptible (HS): DI≥70. The disease classification standard is shown in Table 1.

[0036] Table 1 Disease classification table of bitter gourd fusarium wilt

[0037] Disease rating Symptoms 0 No disease 1 Hypotrophy of cotyledons or slight hypotrophy of cotyledons and true leaves 2 Hypotrophy of 1 true leaf or more severe hypotrophy of cotyledons (< 60%) 3 Hypotrophy of cotyledons and part of true leaves (> 60%) 4 Whole plant hypotrophy (> 60%), heart leaf survival 5 Whole plant death

[0038] 3. Sample collection and DNA extraction

[0039] After the resistance identification work was completed, high-resistant and high-susceptible single plants from the F2 generation separation population were selected to form a resistant pool and a susceptible pool as test material samples. Leaf samples were collected and frozen in 2mL centrifuge tubes using liquid nitrogen and stored in a -80℃ freezer. Before the test, the cotyledons were ground into powder using a leaf grinder, and DNA was extracted using the CTAB method. The specific process is as follows:

[0040] (1) Set the oven to 65℃ in advance, and soak the small steel balls in ethanol.

[0041] (2) Preheat the CTAB extraction solution in the oven at 65℃.

[0042] (3) Add small steel balls to the centrifuge tube containing the cotyledon sample, and use the grinder to grind at a frequency of 45Hz for 30s.

[0043] (4) Check if the centrifuge tube is broken, add 750 μL of CTAB extraction solution, shake vigorously, mix, and heat in a 65°C oven for 1 h, and invert and mix every 15 min.

[0044] (5) Cool the centrifuge tube to room temperature, add 750 μL of chloroform: isopropyl alcohol mixture (24:1 by volume) in a fume hood, mix slowly for 3 min, stand for 5 min, and centrifuge at 12000 r for 10 min.

[0045] (6) Use a pipette to take about 550 μL of supernatant in a new centrifuge tube, add 750 μL of chloroform and isopropyl alcohol (24:1 by volume) again, stand for 5 min, and centrifuge at 12000 r for 10 min.

[0046] (7) Use a pipette to take 450 μL of supernatant in a 1.5 mL centrifuge tube, add twice the volume of pre-cooled isopropyl alcohol, and gently invert and mix.

[0047] (8) Place the centrifuge tube in a -20°C refrigerator for 1 h, and centrifuge at 10000 r for 3 min, and discard the supernatant.

[0048] (9) Add 600 μL of 70% ethanol for washing, stand for 10-20 min, and centrifuge at 10000 r for 2 min.

[0049] (10) Repeat step (9).

[0050] (11) Open the centrifuge tube cover and place it in a fume hood overnight to evaporate.

[0051] (12) Add 50 μL of ddH2O to dissolve the DNA.

[0052] (13) Use a microspectrophotometer to detect the DNA concentration and quality, and then store the DNA in a -20°C refrigerator.

[0053] 4. SNP site selection

[0054] The SNP site at position 22791559 on the 3rd chromosome of the Momordica charantia genome was selected for further analysis, and the SNP site was designed. The SNP site has a base mutation of C / G, and the corresponding genotypes include G:G, G:C and C:C. Among them, G:G and G:C genotypes show resistant genotypes, and C:C genotype shows susceptible genotypes. In addition, the SNP site at position 22885409 on the 3rd chromosome of the Momordica charantia genome was also selected for design. The SNP site has a base mutation of T / C, and the corresponding genotypes include T:T, T:C and C:C. Among them, C:C and T:C genotypes show resistant genotypes, and T:T genotype shows susceptible genotypes.

[0055] 4. Develop KASP markers for SNP sites and design primer sets for detecting the markers

[0056] Develop KASP markers for molecular marker-assisted selection breeding.

[0057] The KASP primer of the SNP site at position 22791559 on the 3rd chromosome of the Momordica charantia genome is composed of two upstream primers KASP-1559F, KASP-1559H and one downstream primer KASP-5409.

[0058] KASP-1559F: 5'- ATGTTTATAGTTAT GGGATGTTGGTTCTTC-3' (SEQ ID NO. 1); GAAGGTGACCAAGTTCATGCT

[0059] KASP-1559H: 5'- TGTTTATAGTTAT GGGATGTTGGTTCTTG-3' (SEQ ID NO. 2); GAAGGTCGGAGTCAACGGATT

[0060] KASP-1559R: 5'- CTCCATCTTTCTCACTCTCTGCAAGA-3' (SEQ ID NO. 3).

[0061] KASP-1559F is a primer with a FAM fluorescent label sequence (underlined base) at the 5' end, and the downstream primer KASP-1559R amplifies the fragment of the SNP site with C. The fluorescence signal of the FAM group can be read by the enzyme marker or fluorescence quantitative instrument;

[0062] ​​KASP-1559H is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and KASP-1559R amplifies the fragment of the SNP site as G, and the fluorescence signal of the HEX group can be read by the enzyme marker or the fluorescence quantitative PCR instrument.

[0063] The amplification sequence of the molecular marker primer set is shown in SEQ ID NO. 7 and SEQ ID NO. 8:

[0064]

[0065] The KASP primer of the SNP site at position 22885409 on chromosome 3 of the Momordica charantia genome is composed of two upstream primers KASP-5409F, KASP-5409H and one downstream primer KASP-5409R.

[0066] KASP-5409F: GAAGGTGACCAAGTTCATGCT ACCACCGATCTTTTTA GCCTCTT (SEQ ID NO. 4);

[0067] KASP-5409H: GAAGGTCGGAGTCAACGGATT ACCACCGATCTTTT TAGCCTCTC (SEQ ID NO. 5);

[0068] KASP-5409R: TGATCCTGATGCCACAGACTGC (SEQ ID NO. 6).

[0069] KASP-5409F is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end, and the downstream primer KASP-5409R amplifies the fragment of the SNP site as T, and the fluorescence signal of the FAM group can be read by the enzyme marker or the fluorescence quantitative instrument;

[0070] KASP-5409H is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end, and KASP-5409R amplifies the fragment of the SNP site as C, and the fluorescence signal of the HEX group can be read by the enzyme marker or the fluorescence quantitative PCR instrument.

[0071] The amplification sequence of the molecular marker primer set is shown in SEQ ID NO. 9 and SEQ ID NO. 10:

[0072]

[0073] Example 2. Establishment of Momordica charantia resistance detection method for fusarium wilt

[0074] The F2 generation expanded population obtained by selfing after crossing Mc176 as the father and Mc131 as the mother was used for molecular marker verification.

[0075] 585 F2 large population were sowed, and cotyledon samples were taken to extract the genomic DNA of the tested Momordica charantia by the CTAB method. The Fusarium oxysporum f. sp. momordicae was inoculated at the two-leaf-one-heart stage, and the phenotype was identified 25 days after inoculation to obtain the phenotype data of the F2 large population.

[0076] After the DNA of the expanded population was extracted, the DNA concentration was detected by ultramicro spectrophotometer, and the sample DNA was diluted to 50 ng·μL -1 using ddH2O. KASP-1559 primer pair and KASP-5409 primer pair were used for amplification, and the total volume of KASP reaction was 10 μL. The reaction system is shown in Table 2.

[0077] Table 2 KASP reaction system

[0078]

[0079]

[0080] The KASP reaction PCR program was as follows: 95℃ 10 min; 95℃ 20 s, 61℃ 40 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ 20 s, 55℃ 40 s, 25 cycles; 30℃ 30 s.

[0081] After amplification, fluorescence scanning was performed to read the fluorescence value for genotyping. The FAM excitation wavelength was 485 nm, and the emission wavelength was 520 nm. The HEX excitation wavelength was 535 nm, and the emission wavelength was 556 nm. The system reference fluorescence ROX excitation wavelength was 575 nm, and the emission wavelength was 610 nm.

[0082] When the KASP-1559 primer set was used for amplification, if only the fluorescence signal of the HEX group was shown, the genotype of the SNP site of the tested Momordica charantia was GG (i.e., the SNP site was homozygous for G in the genome); if only the fluorescence signal of the FAM group was shown, the genotype of the SNP site of the tested Momordica charantia was CC (i.e., the SNP site was homozygous for C in the genome); if both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group were shown, the genotype of the SNP site of the tested Momordica charantia was G:C (i.e., the SNP site was heterozygous for G and C in the genome).

[0083] When the KASP-5409 primer group is used for amplification, if only the fluorescence signal of the HEX group is shown, the genotype of the SNP site of the tested Momordica charantia is CC (i.e. the SNP site in the genome is homozygous for C); if only the fluorescence signal of the FAM group is shown, the genotype of the SNP site of the tested Momordica charantia is TT (i.e. the SNP site in the genome is homozygous for T); if both the fluorescence signal of the FAM group and the fluorescence signal of the HEX group are shown, the genotype of the SNP site of the tested Momordica charantia is T:C (i.e. the SNP site in the genome is heterozygous for T and C).

[0084] The single plants of grade 0 in the large population that are consistent with the genotyping of the disease-resistant parent Mc176 are classified as effective disease-resistant single plants, and the genotype is assigned as A. The single plants of grade 5 that are consistent with the genotyping of the disease-susceptible parent Mc131 are classified as effective disease-susceptible single plants, and the genotype is assigned as B. All heterozygotes of disease-resistant grades are classified as effective single plants, and the genotype is assigned as H. The undefined or no signal is replaced with “-” (Table 3).

[0085] Table 3 Genotyping results of F2 large population

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] Table 4 Coincidence rate of 2 KASP markers in F2 large population

[0098] KASP marker Concordance (%) 0 and 5 rating concordance (%) KASP-1559 67.67 86.18 KASP-5409 66.96 85.82

[0099] The coincidence rate is calculated in all single strains in the F2 (585) large population, and since the fusarium wilt is a quantitative trait, the fusarium wilt resistance performance presents continuity, so the genotypes combined with the extreme performance (0 level and 5 level) of the fusarium wilt resistance are analyzed and the molecular marker coincidence rate is calculated.

[0100] The results show that the coincidence rates of the two KASP molecular markers are both greater than 65%, and the highest coincidence rate is chr3-22791559; the coincidence rates of the two KASP molecular markers in the single strains with the disease resistance level of 0 and 5 are both greater than 80%, wherein the coincidence rate of KASP-1559 is 86.18%, and the coincidence rate of KASP-5409 is 85.82%, which indicates that the KASP molecular marker primer provided by the present application can quickly and accurately identify the resistance of Momordica charantia to fusarium wilt.

[0101] From the above examples, it can be seen that the present application provides a KASP molecular marker primer combination for detecting the fusarium wilt resistance of Momordica charantia, a detection method and application. The KASP molecular marker primer provided by the present application can quickly and accurately identify the resistance of Momordica charantia to fusarium wilt.

[0102] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A molecular marker primer combination for detecting resistance to Fusarium wilt in bitter gourd, characterized in that, It includes two specific upstream and downstream primers. The sequence of the first upstream primer KASP-1559F is shown in SEQ ID NO. 1, the sequence of the second upstream primer KASP-1559H is shown in SEQ ID NO. 2, and the sequence of the downstream primer KASP-1559R is shown in SEQ ID NO.

3.

2. A molecular marker primer combination for detecting resistance to Fusarium wilt in bitter gourd, characterized in that, It includes two specific upstream and downstream primers. The sequence of the first upstream primer KASP-5409F is shown in SEQ ID NO. 4, the sequence of the second upstream primer KASP-5409H is shown in SEQ ID NO. 5, and the sequence of the downstream primer KASP-5409R is shown in SEQ ID NO.

6.

3. The molecular marker primer combination according to claim 1 or 2, characterized in that, 5' of the first upstream primer The first upstream primer has a 5' end connected to a FAM fluorescent tag sequence, and the second upstream primer has a 5' end connected to a HEX fluorescent tag sequence.

4. A kit for detecting resistance to Fusarium wilt in bitter gourd, characterized in that, Includes the molecular marker primer combination as described in any one of claims 1 to 3.

5. A method for identifying resistance to Fusarium wilt in bitter gourd, characterized in that, Includes the following steps: S1. Extract genomic DNA from the bitter melon sample to be tested; S2. Using the genomic DNA of the bitter gourd sample to be tested as a template, perform PCR amplification using the molecular marker primer combination described in claim 1 or 2 to obtain PCR products; S3. Genotyping of PCR products: If the molecular marker primer combination described in claim 1 is used for amplification, the genotypes G:G and G:C are determined to be resistant; the genotype C:C is determined to be susceptible. If the molecular marker primer combination described in claim 2 is used for amplification, the genotypes are C:C and T:C, and are determined to be disease-resistant; the genotype is T:T, and is determined to be disease-susceptible.

6. The identification method according to claim 5, characterized in that, The PCR amplification reaction system was as follows: 5 μL of 2×Master Mix for ASPCR, 2 μL of bitter gourd genomic DNA to be tested, 0.1 μL of the first upstream primer, 0.1 μL of the second upstream primer, 0.3 μL of the downstream primer, and 2.5 μL of ddH2O.

7. The use of the molecular marker primer combination according to claim 1 or 2 in at least one of the following: (1) in the identification or auxiliary identification of resistance to Fusarium wilt in bitter gourd; (2) in the preparation of a kit for identifying resistance to Fusarium wilt in bitter gourd; (3) in molecular marker-assisted breeding of Fusarium wilt-resistant bitter gourd.

8. The kit according to claim 4 is used in at least one of the following: (1) in the identification or assistance identification of resistance to Fusarium wilt in bitter gourd; (2) in molecular marker-assisted breeding of Fusarium wilt-resistant bitter gourd.

Citation Information

Patent Citations

  • TaqMan probe and real-time fluorescent primers for detecting Fusarium oxysporum f.sp.cubense race4 (FOC4) and application thereof

    CN103789417A

  • Method for identifying authenticity of bitter gourd varieties and special SSR primer combination thereof

    CN111235301A