SNP (Single Nucleotide Polymorphism) site associated with active major gene of wheat polyphenol oxidase

Through genome-wide association analysis and the application of Whaas77577 molecular marker of SNP site, the problem of main-effect gene localization of wheat polyphenol oxidase activity was solved, and early screening and breeding efficiency of low-PPO-active wheat materials were achieved.

CN120350158APending Publication Date: 2025-07-22XINXIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510642962.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-19
Publication Date
2025-07-22

AI Technical Summary

Technical Problem

The prior art is difficult to effectively locate and control the main-effect genes related to wheat polyphenol oxidase (PPO) activity, resulting in the discoloration of the dough products over time and the nutritional value of proteins, and it is difficult to breed.

Method used

Using a genome-wide association analysis method, combined with wheat 660K SNP chip, the Whaas77577 molecular marker of the main effect gene qPPO3A.1, which is closely linked to wheat PPO activity, was excavated, and a PCR primer set was designed for fluorescence quantitative PCR detection to screen out wheat materials with low PPO activity.

Benefits of technology

It realizes early screening of wheat materials under multiple environmental conditions, improves wheat breeding efficiency, shortens breeding time, and provides a scientific basis for high-quality wheat materials.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120350158A_ABST
    Figure CN120350158A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of wheat molecular breeding, and particularly relates to an SNP site associated with a wheat polyphenol oxidase active major gene. The SNP site has a polymorphic site of A / G allele mutation at the 36th basic group. In the application, the inventor tries to excavate and obtain key genetic loci and genes which can stably exist under multiple environment conditions and control the PPO activity of wheat on the basis of analyzing PPO activity characters of 207 representative wheat materials planted in different years by utilizing a whole genome association analysis method and combining a wheat 660K SNP chip; and the Whaas77577 molecular marker which is closely linked with the major gene qPPO3A.1 related to the PPO activity of the wheat is obtained. Based on the molecular marker, excellent allele variation type identification can be performed on breeding early generation materials, so that a scientific basis can be provided for wheat breeding progeny material selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of wheat molecular breeding, and specifically relates to a SNP locus associated with the major gene for polyphenol oxidase activity in wheat. Background Art

[0002] As a processed product of wheat flour, the color and its stability of noodles are directly related to polyphenol oxidase (PPO) in the flour. Research shows that PPO in wheat grains mainly exists in the bran layer, and high PPO activity is the main reason for the color change of foods such as noodles over time. Therefore, the content and activity of PPO in flour products not only directly affect the apparent color of flour products, but also have a direct impact on the quality characteristics and the nutritional value of proteins. Therefore, breeding wheat varieties with low PPO activity has become an important breeding goal.

[0003] Existing research shows that the PPO activity in wheat grains is a complex quantitative trait regulated by multiple genes. It is reported that most PPO genes in wheat are located on the second homologous chromosome group of the wheat genome. There are different allelic variation types of PPO genes in wheat and its related species. PPO genes in different families have spatio-temporal specific expression characteristics. Currently, QTL mapping and GWAS are widely used to identify candidate genes for wheat PPO activity. Most research results show that the major QTL loci affecting PPO activity are distributed on chromosomes 2A, 2B, and 2D, and there are also some minor QTL loci on chromosomes 1D, 3D, 4A, 4B, 4D, 6A, 7A, 7B, and 7D. Therefore, systematic research on these genes related to PPO activity is of great technical significance for breeding wheat varieties with low PPO activity. Summary of the Invention

[0004] Using the method of genome-wide association analysis, the purpose of this application is to provide a SNP locus (named: qPPO3A.1 ) tightly linked to the major QTL gene related to polyphenol oxidase activity on wheat chromosome 3AS (named: Whaas77577 molecular marker), thus laying a certain foundation for wheat variety improvement and new variety breeding.

[0005] The technical solutions adopted in this application are described in detail as follows.

[0006] A SNP locus associated with the major gene for polyphenol oxidase activity in wheat, the major gene for polyphenol oxidase (PPO) activity in wheat is located on wheat chromosome 3AS, named: qPPO3A.1 ; the SNP locus is related to the major gene for wheat PPO activity qPPO3A.1Closely linked (referring to the 'Chinese Spring' genomic sequence information, this SNP locus is located at nucleotide position 290,793,753 bp on chromosome 3AS), and can be used for the detection and determination of wheat PPO activity; its nucleotide sequence is: GGTACTAGACAAAATCTTGAATCATGGAACTTGGT[A / G]CTACTCCTTGTTCGGTAGTCGTCCGACTTGGCGTC; There is a polymorphic locus with an A / G allelic gene mutation at the 36th base of the said SNP locus. Correspondingly, there are AA homozygous genotypes and GG homozygous genotypes; That is: When the 36th base is A, Whaas77577 _ AA The nucleotide sequence of the homozygous genotype is as shown in SEQ ID No.1, specifically as follows: GGTACTAGACAAAATCTTGAATCATGGAACTTGGTACTACTCCTTGTTCGGTAGTCGTCCGACTTGGCGTC; When the 36th base is G, Whaas77577 _ GG The nucleotide sequence of the homozygous genotype is as shown in SEQ ID No.2, specifically as follows: GGTACTAGACAAAATCTTGAATCATGGAACTTGGTGCTACTCCTTGTTCGGTAGTCGTCCGACTTGGCGTC.

[0007] The said SNP locus is applied in wheat molecular breeding or the detection of wheat flour PPO activity. Whaas77577_GG The PPO activity in wheat materials with the [genotype] is significantly lower than that in Whaas77577_AA wheat materials with the [genotype].

[0008] For the PCR primer set for detecting the SNP locus associated with the major gene of wheat polyphenol oxidase activity, the said PCR primer set is designed based on KASP technology, and the specific design is as follows: Primer F1: 5’-GAAGGTGACCAAGTTCATGCTAGACAAAATCTTGAATCATGGAACTTGGTG-3’; Primer F2: 5’-GAAGGTCGGAGTCAACGGATTAGACAAAATCTTGAATCATGGAACTTGGTA-3’; Primer R: 5’-CTGTTGCCGTTGACGCCAAGTCGGA-3’。

[0009] Among them: the " GAAGGTGACCAAGTTCATGCT " in the F1 primer part and the " GAAGGTCGGAGTCAACGGATT " in the F2 primer part are FAM and HEX fluorescent labels respectively.

[0010] The said PCR primer set is applied in wheat molecular breeding or the detection of PPO activity in wheat flour. After fluorescence quantitative PCR amplification, based on the genotyping detection results: Blue fluorescence indicates that the wheat material contains Whaas77577_GG genotype, and its nucleotide sequence is as shown in SEQ ID No.1; Green fluorescence indicates that the wheat material contains Whaas77577_AA genotype, and its nucleotide sequence is as shown in SEQ ID No.2; Red fluorescence indicates that the wheat material contains Whaas77577_AG heterozygous type; Whaas77577 The PPO activity in wheat materials with _GG genotype is significantly lower than that in Whaas77577 _AA and Whaas77577 _AG genotype wheat materials.

[0011] The wheat variety breeding method using the said primer set selects wheat materials containing Whaas77577_GG genotype as low-PPO-activity breeding parent materials, and selects wheat materials containing Whaas77577_AA genotype as high-PPO-activity breeding parent materials.

[0012] The wheat PPO activity determination method using the said primer set includes the following steps: (1) Extract genomic DNA For the wheat material to be tested, extract its genomic DNA; (2) PCR amplification Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the said KASP marker primer set; (3) Detection and determination Blue fluorescence indicates that the wheat material contains Whaas77577_GG genotype, and its nucleotide sequence is as shown in SEQ ID No.1; Green fluorescence indicates that the wheat material contains Whaas77577_AA genotype, and its nucleotide sequence is as shown in SEQ ID No.2; Red fluorescence indicates that the wheat material contains Whaas77577_AG heterozygous type; Whaas77577 The PPO activity in wheat materials with _GG genotype is significantly lower than that inWhaas77577 _Wheat materials with AA genotype.

[0013] PPO activity is a quantitative trait controlled by multiple genes. One of the difficulties in its research is to locate specific major effect genes and to clarify whether there are different genotypes and the specific degree of influence of different genotypes on wheat grains and wheat flour. Therefore, the research is difficult. In this application, the inventors used the whole genome association analysis method, combined with the wheat 660K SNP chip, and analyzed the PPO activity traits of 207 representative wheat materials planted in different years. They tried to explore the key genetic sites and genes that can stably exist under multiple environmental conditions to control wheat PPO activity, and finally developed a major effect gene related to wheat PPO activity. qPPO3A.1 Tightly linked Whaas77577 Molecular markers. Based on this molecular marker, the excellent allele variation type of early breeding generation materials can be identified, which can provide a scientific basis for the selection of wheat breeding offspring materials, thereby improving the efficiency of high-quality wheat breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Manhattan plot of genome-wide association analysis based on the best linear unbiased estimate BLUE value calculated for PPO activity of wheat materials under different environments; wherein: the red dotted line is the threshold line of -log10P=7.35; the red box and black arrows point to the significant markers identified by the present invention Whaas77577 , the marker is located on wheat chromosome 3AS; Figure 2 for Whaas77577 KASP marker genotyping map; blue fluorescence indicates that the wheat material contains Whaas77577 _ GG Genotype, green fluorescence indicates that the wheat material contains Whaas77577 _ AA Genotype, red fluorescence indicates that the wheat material contains Whaas77577 _ AG Heterozygous type, gray indicates blank control (NTC) without genomic DNA added; Figure 3 for Whaas77577 The comparative analysis diagram of PPO activity in wheat materials with different allele types under different environments is marked, among which the difference in PPO activity in wheat grains between different genotypes reaches a significant level. DETAILED DESCRIPTION

[0015] The present application is further explained below in conjunction with the embodiments. Before further explanation, it needs to be explained that the relevant wheat varieties (materials) involved in this application are all common and commonly used materials in existing wheat breeding or research, and can be obtained from public channels such as the market or relevant germplasm banks. As a professional agricultural science research institution, the applicant has built a relevant germplasm resource bank, and the inventor, as a professional researcher, has also collected and preserved relevant germplasm materials for a long time. Therefore, the acquisition and use of relevant germplasm materials meet the requirements of current relevant administrative regulations.

[0016] Example 1 In the early stage of the experiment, the inventors measured and analyzed the PPO activity of wheat grains in related populations planted and harvested in different years and locations in Henan Province (part of the results have been published: Genomics, In-depth genetic analysis reveals conditioning of polyphenol oxidase activity in wheat grains by cis Regulation of TaPPO2A-1 expression level).

[0017] The previous inventors used the wheat 660K chip to analyze the genotype data of related wheat materials and the wheat PPO activity and best linear unbiased estimate (BLUP) measured in different environments, and used Tassel 5.0 software using the "Q+K" mixed linear model to conduct a whole-genome association analysis to explore potential excellent sites and genes that are significantly correlated with wheat polyphenol oxidase activity.

[0018] In the further analysis, the threshold for detecting effect sites was set to -log10(p)=7.35, and the SNP sites detected in different environments were taken as significant sites. Figure 1 ) is used to indicate that after association analysis, a marker site significantly associated with PPO activity was detected on the genome. A significantly associated Whaas77577 Markers, indicated by black arrows and red dots, explained 15.18–25.71% of the phenotypic variation.

[0019] The nucleotide sequence of the marker is: GGTACTAGACAAAATCTTGAATCATGGAACTTGGT[A / G]CTACTCCTTGTTCGGTAGTCGTCCGACTTGGCGTC. The 36th base in the sequence is a G36-A36 allele mutation, which causes a nucleotide polymorphism in the sequence.

[0020] That is, there is a polymorphic site with an A / G allelic gene mutation at the 36th base of this sequence; according to the Chinese Spring reference genome sequence information, this SNP site is located at nucleotide 290,793,753 bp on chromosome 3AS; Example 2 For the convenience of qPPO3A.1 analyzing and applying the key gene loci within the target interval, based on the characteristics of its SNP sites and the requirements of KASP technology, the inventor further developed the corresponding primer sets and conducted further detection and evaluation, and the specific situation is briefly introduced as follows.

[0021] (I) Primer design Combined with the SNP site sequence information in Example 1, as well as considering factors such as annealing temperature design (60 °C) and genotyping PCR detection, the primer sets for PCR amplification were specifically designed as follows: Primer F1: 5’-GAAGGTGACCAAGTTCATGCTAGACAAAATCTTGAATCATGGAACTTGGTG-3’; Primer F2: 5’-GAAGGTCGGAGTCAACGGATTAGACAAAATCTTGAATCATGGAACTTGGTA-3’; Primer R: 5’-CTGTTGCCGTTGACGCCAAGTCGGA-3’.

[0022] Among them, the “ GAAGGTGACCAAGTTCATGCT ” in the F1 primer part and the “ GAAGGTCGGAGTCAACGGATT ” in the F2 primer part are FAM and HEX fluorescent labels respectively.

[0023] (II) Genomic DNA extraction Using the CTAB method, taking the leaf material of wheat seedlings collected in the previous stage as the experimental sample, extracting its genomic DNA, and diluting it to 50 ng / μL as the template for subsequent PCR amplification for standby.

[0024] (III) PCR reaction Mix the 3 primers (F1, F2, and R, with a concentration of 10 μmol / L each) in step (I) with water in a volume ratio of 12:12:30:46 and mix evenly as: Primer Mix; Using the DNA extracted in step (II) as the template, perform PCR control with the above primer mixture “Primer Mix”, and the 5 μl amplification system is designed as follows: KASP Master Mix, 2.5 μL; Primer Mix, 0.7 μL; MgCl2, 0.04 μL; DNA template, 1 μL; ddH2O, 0.76 μL; The PCR amplification program is as follows: 95 °C for 15 min; 95 °C for 20 s, 65 °C - 55 °C for 1 min, 10 cycles (decreasing 1 °C per cycle); 95 °C for 20 s, 57 °C for 1 min, 35 cycles; 37 °C for 1 min; After the reaction, use CFX Connect TM (Bio - Rad CFX Connect Real - Time Fluorescent Quantitative PCR, product of Bio - Rad Life Sciences Co., Ltd.) fluorescent quantitative PCR detection system for allele typing determination, where: Blue fluorescence indicates that the wheat material contains Whaas77577 _GG genotype; Green fluorescence indicates that the wheat material contains Whaas77577 _AA genotype; Red fluorescence indicates that the wheat material contains Whaas77577 _AG heterozygous type; Grey indicates the blank control (NTC) without genomic DNA added.

[0025] (IV) Genotyping results of the association population Use the polymorphism of this locus to genotype 207 wheat materials collected previously, and the results are as Figure 2 shown. It can be seen from the analysis that: the major qPPO3A.1 in Whaas77577 the KASP marker has good genotyping in the population. Among them, 18 wheat materials are of Whaas77577_GG genotype, accounting for about 8.70%; 188 wheat materials are of Whaas77577 _ AA genotype, accounting for about 90.82%; 1 wheat material is of Whaas77577 _ AG heterozygous type, accounting for about 0.48% (the statistical results are shown in Table 1 below). By comparing with the 660K chip sequencing results, the genotyping of this KASP marker in the population is basically correct, indicating that these two markers are available and can distinguish the base types of SNP loci.

[0026] Combined with the PPO activity phenotype data in the population, it is found that the PPO activity in the wheat grains with genotype Whaas77577_GG is significantly lower than that in the wheat materials with genotype Whaas77577_AA , and the PPO activity value has decreased by 24.48%; it shows that Whaas77577_GGThe genotype is a favorable allele for reducing the PPO activity in wheat ( Figure 3 ).

[0027] Table 1, Whaas7577 Analysis of PPO activity in wheat materials with different genotypes .

[0028] (V) Screening of wheat materials with low PPO activity The designed KASP was used to screen wheat materials with low PPO activity. Some existing wheat germplasms were screened, and a total of 18 wheat materials containing Whaas77577_GG genotype were identified, which can be used as excellent parental materials for wheat flour improvement, and further provide material support for creating wheat with low PPO activity. The specific screening results are shown in Table 2 below.

[0029] Table 2, Whaas7577_GG Distribution of PPO activity in wheat materials with genotype Note: Ave represents the average value of PPO activity measured in the associated population materials planted at different locations and in different years.

[0030] The above results show that the markers obtained in this application Whaas77577 can be effectively used for the identification of polyphenol oxidase activity in wheat grains, and can effectively screen wheat materials in the early breeding generations. Select Whaas77577 _GG genotype wheat materials for the cultivation of wheat with low PPO activity, so as to shorten the breeding time and improve the breeding process.

Claims

1. A SNP locus associated with the major gene for wheat polyphenol oxidase activity, characterized in that, The nucleotide sequence of the SNP locus is as follows: GGTACTAGACAAAATCTTGAATCATGGAACTTGGT[A / G]CTACTCCTTGTTCGGTAGTCGTCCGACTTGGCGTC; There is a polymorphic site with an A / G allelic gene mutation at the 36th base of the SNP locus. Correspondingly, there are AA homozygous genotypes and GG homozygous genotypes; That is: When the 36th base is A, Whaas77577 _ AA The nucleotide sequence of the homozygous genotype is shown in SEQ ID No.1; When the 36th base is G, Whaas77577 _ GG The nucleotide sequence of the homozygous genotype is shown in SEQ ID No.

2.

2. Use of the SNP locus according to claim 1 in wheat molecular breeding or detection of PPO activity in wheat flour, characterized in that, During application, Whaas77577_GG the PPO activity in wheat materials with Whaas77577_AA genotype was significantly lower than that in wheat materials with 3. The PCR primer set for detecting the SNP locus associated with the major gene of wheat polyphenol oxidase activity according to claim 1, wherein The PCR primer set is designed based on the KASP technology, and the specific design is as follows: Primer F1: 5’-GAAGGTGACCAAGTTCATGCTAGACAAAATCTTGAATCATGGAACTTGGTG-3’; Primer F2: 5’-GAAGGTCGGAGTCAACGGATTAGACAAAATCTTGAATCATGGAACTTGGTA-3’; Primer R: 5’-CTGTTGCCGTTGACGCCAAGTCGGA-3’.

4. Use of the PCR primer set according to claim 3 in wheat molecular breeding or in detection of PPO activity in wheat flour, characterized in that, During application, after fluorescence quantitative PCR amplification, based on the genotyping test results: The blue fluorescence indicates that the wheat material is Whaas77577_GG genotype; The green fluorescence indicates that the wheat material is Whaas77577_AA genotype; The red fluorescence indicates that the wheat material is Whaas77577_AG heterozygous; Whaas77577 _The PPO activity in wheat materials with the GG genotype was significantly lower than that in Whaas77577 _AA and Whaas77577 _wheat materials with the AG genotype.

5. A method for breeding wheat varieties using the primer set according to claim 3, characterized in that, During breeding, select Whaas77577_GG wheat materials with the Whaas77577_AA genotype as breeding parent materials with low PPO activity, and select wheat materials with the Whaas77577_AA genotype as breeding parent materials with high PPO activity.

6. The method for determining the wheat PPO activity using the primer set according to claim 3, characterized in that, It includes the following steps: (1) Extract genomic DNA For the wheat material to be tested, extract its genomic DNA; (2) PCR amplification Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the KASP marker primer set; (3) Detection and determination The blue fluorescence indicates that the wheat material is Whaas77577_GG genotype; The green fluorescence indicates that the wheat material is Whaas77577_AA genotype; The red fluorescence indicates that the wheat material is Whaas77577_AG heterozygous; Whaas77577 _The PPO activity in wheat materials with the GG genotype was significantly lower than Whaas77577 _that in wheat materials with the AA genotype.