SNP loci associated with cotton boll node height traits and application thereof

Abstract

The application discloses a SNP site associated with cotton boll node height character and application thereof. Based on whole genome resequencing data of a natural population of upland cotton and two years of field phenotypic investigation, a stable SNP site associated with cotton boll node height is identified through whole genome association analysis, the site is located at the base of 15876258bp on the A05 chromosome of upland cotton, the site is a single base mutation from T to C, and the boll node height of cotton of the TT type is significantly higher than that of cotton of the CC type. In the mechanical harvesting process of cotton, the boll node height is an important parameter for determining whether a cotton variety is suitable for mechanical harvesting. The SNP site associated with the cotton boll node height character provided by the application can be applied to screening of germplasm resource materials of upland cotton suitable for mechanical harvesting, and can also be applied to molecular marker assisted breeding of mechanical harvesting cotton materials, so as to accelerate the breeding process of new cotton varieties suitable for mechanical harvesting, and lay a foundation for cotton full-process mechanization.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a SNP site associated with the fruit initial node height trait of cotton and application thereof. BACKGROUND

[0002] Cotton is an important economic crop and strategic material in China. With the improvement of land circulation and mechanization level, mechanical harvesting is an important measure to promote the full mechanization of cotton production and has become the only way for the development of cotton industry. Xinjiang, as the main cotton planting base in China, plays an extremely important role in the cotton industry in China. Its planting technology and scale have gradually become modernized. In recent years, with the wide promotion and application of full mechanization of cotton planting in Xinjiang, the development trend of cotton production in Xinjiang is that the cost of cotton planting is reduced, the proportion of large-scale planting is greatly increased, and the level of intensive cotton planting is rapidly improved. From the perspective of mechanical planting mode and actual mechanical planting area, the mechanical harvesting of cotton in Xinjiang Corps develops rapidly. According to the data of the Department of Agriculture and Rural Affairs of Xinjiang Uygur Autonomous Region, the full mechanization cotton field in the northern region of Xinjiang has reached more than 90%, and the mechanical harvesting area and cotton mechanical harvesting rate in the southern region of Xinjiang have also increased year by year. As of 2022, the mechanical harvesting rate of cotton in Xinjiang has reached 80%, the full mechanization rate has reached 94%, and more than 7,000 cotton picking machines are in use.

[0003] Since the large-scale application of mechanical harvesting in cotton production in Xinjiang, it has to some extent solved the problems of labor shortage, high cost and low efficiency in cotton harvesting, improved labor productivity and comprehensive economic benefits, and improved the level of full mechanization of cotton production in Xinjiang. However, there are still many problems, difficulties and challenges in the development of cotton mechanization, such as higher loss rate of mechanical picking of cotton than manual picking, mismatch between agronomy and agricultural machinery, lack of suitable cotton varieties for mechanical picking, etc. At present, cotton production practices often choose cotton varieties suitable for mechanical harvesting from conventional varieties, but most of them have low fruit initial node height, uneven boll shedding, and poor boll retention, etc. Therefore, certain cultivation management and chemical regulation measures need to be taken to make part of the plant traits meet the requirements of mechanical picking.

[0004] In order to adapt to the development of modern agriculture, it is very important to select cotton new varieties suitable for mechanical picking. New varieties need to have the characteristics of good mechanical picking performance to ensure the efficiency and quality stability of mechanical harvesting. The requirements of mechanical harvesting for cotton plant traits are different from those of conventional upland cotton. It has higher requirements for early maturity, plant height, fruit initial node height, boll shedding concentration, boll retention, sensitivity to defoliant, etc. At present, it is generally believed that the cotton plant type suitable for mechanical picking should be tower-shaped or cylinder-shaped, with compact plant type structure (non-zero fruit branch or limited fruit branch), first fruit branch height above 18 cm, boll concentration in the inner circle, slightly smaller leaf with strong photosynthetic capacity, sensitivity to defoliant, early and concentrated boll shedding, and moderate boll retention.

[0005] Studies have shown that cotton varieties with excessively low fruiting branch first node height are more prone to picking up impurities such as plastic film during mechanical harvesting, increasing the impurity content of seed cotton, reducing cotton fiber grading, and impacting cotton farmers' economic income. Therefore, in the breeding of new cotton varieties suitable for machine harvesting, the fruiting branch first node height is a crucial indicator for determining whether cotton is suitable for machine harvesting, directly affecting cotton yield and quality. Researching the genetic mechanisms underlying fruiting branch first node height lays the foundation for breeding new cotton varieties with suitable fruiting branch first node height, provides theoretical support for mechanized cotton harvesting, promotes the sustainable development of the cotton industry, and accelerates the development of machine-harvested cotton in my country. Summary of the Invention

[0006] The purpose of this invention is to provide an SNP site associated with the height trait of the first node of cotton fruiting branches and its application.

[0007] The objective of this invention can be achieved through the following technical solutions:

[0008] The first aspect of this invention provides a SNP locus associated with the height trait of the first node of a cotton fruiting branch. The SNP locus is located at 15,876,258 bp on chromosome A05 of the upland cotton genetic standard line TM-1 reference genome (ZJU TM-1V2.1; Hu et al. Nature Genetic, 2017). The nucleotide sequences of the SNP locus within 200 bp upstream and downstream are shown in SEQ ID NO. 5.

[0009] SEQ ID NO.5:

[0010] AGTAAAAGAGAAAGTGAAATAATGAGAACCACGGTATTTGGAAGAATCTTTGTGGTCGTTTGAGTGAAATAAGCAAGAGATGAAAATAGGGGAATTGGGAGGCTTAGTTTGGGTTTGCGAGTAAATGTGAAAGTTTTAAGAAAGTTTGATGAGAAGCTGACGTGAAAGACATGTTTGGTATCTTGTAGGAAAAATTTTn GGTTCTGGCGAGTGTTGAGAAATGATCAGTTTTTGTTAAATTTTTAATTCTAAATTTTATATGAACCAAAGAGTTTAGATCAATGTTGTAGAGATTTTATTTTTTGTTAATCCTCCGAATTGATAAAACTTAATTCCTAAATGTATGATATTGTACTTACCGATTTGTTCTTCAACTGAATGAAATTGGGGTTTCATTT

[0011] This site is located at 200 bp in SEQ ID NO. 5, denoted by n, and represents a single-base mutation from T to C, with genotypes including "TT" or "CC". Furthermore, the initial node height of the fruiting branch in TT-type cotton is significantly higher than that in CC-type cotton.

[0012] The DNA sequence of the amplified product of the SNP site being the TT haplotype is shown in SEQ ID NO.1;

[0013] The DNA sequence of the amplified product of the SNP site being the CC haplotype is shown in SEQ ID NO.2.

[0014] In a second aspect, the present invention provides the application of the SNP locus associated with the height of the first node of cotton fruiting branches in locating genes closely linked to the height of the first node of fruiting branches.

[0015] In a third aspect, the present invention provides a reagent for detecting SNP sites associated with the height of the first node of cotton fruiting branches in the identification of the height of the first node of cotton fruiting branches.

[0016] Furthermore, the reagent is a nucleotide primer sequence used to detect the amplification primer of the SNP site, with the upstream primer being SEQ ID NO.3 and the downstream primer being SEQ ID NO.4, and the DNA sequence of the amplification product being shown in SEQ ID NO.1 or SEQ ID NO.2.

[0017] Furthermore, the application specifically includes:

[0018] Obtain the genomic DNA of the cotton sample;

[0019] The obtained genomic DNA was amplified by PCR using reagents that detect SNP sites associated with the height trait of the first node of cotton fruit branches;

[0020] The height of the first node of the fruiting branch of the cotton plant to be tested is determined based on the genotype of the SNP site described in the PCR amplification product; wherein, if the genotype of the SNP site described in the PCR amplification product is homozygous TT genotype, the phenotype is high fruiting branch first node height; if the genotype of the SNP site described in the PCR amplification product is homozygous CC genotype, the phenotype is low fruiting branch first node height.

[0021] Furthermore, the PCR reaction system used for the PCR amplification is as follows: 10 μl amplification system, including 1 μl DNA template, 0.5 μl each of upstream and downstream primers, 5 μl high-fidelity enzyme MIX, and 3 μl sterile water.

[0022] Furthermore, the PCR amplification process used was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 0.5 min, 57℃ annealing for 0.5 min, 72℃ extension for 1 min, 30 cycles, and then 72℃ extension for 10 min.

[0023] In a fourth aspect, the present invention provides the application of a reagent for detecting SNP sites associated with the height of the first node of cotton fruiting branches in screening suitable cotton varieties (lines) for mechanized harvesting. By identifying the height of the first node of the fruiting branches of the cotton to be tested, cotton with a higher height of the first node of the fruiting branches is more suitable for mechanized harvesting of cotton.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0025] This invention identifies a single NP locus associated with the height of the first node of cotton fruiting branches through resequencing data and genome-wide association analysis of cotton varietal populations. This locus can be used for marker-assisted breeding of this trait. Because marker-assisted breeding is rapid, simple, and has high throughput, the SNP locus provided by this invention has significant application value in breeding cotton fruiting branch height.

[0026] The height of the first node of the fruiting branch is an important indicator for mechanized cotton harvesting. The SNP loci provided by this invention can be used to screen cotton germplasm suitable for mechanized harvesting, laying the foundation for breeding new cotton varieties suitable for mechanized harvesting.

[0027] The SNP sites provided by this invention can be applied to the fine mapping, cloning, and genome-wide selection of breeding materials for genes related to the height of the first node of cotton fruit branches, thereby improving the efficiency and accuracy of cotton molecular breeding. Attached Figure Description

[0028] Figure 1 This is a histogram showing the frequency distribution of the first node height of fruiting branches for 486 upland cotton varieties or strains.

[0029] Figure 2 This is a Manhattan plot of the genome-wide association analysis of the height trait at the first node of cotton fruiting branches on chromosome A05.

[0030] Figure 3 This is a box plot comparing the height of the first node of the fruit branch between the TT haplotype and the CC haplotype.

[0031] Figure 4 It is a scatter plot of results near the associated sites and a heatmap of linkage disequilibrium decay. Detailed Implementation

[0032] The present invention will now be described in detail through specific embodiments. These embodiments are provided so that this invention will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.

[0033] As used throughout the specification and claims, the terms "comprising" or "including" are open-ended and should be interpreted as "comprising but not limited to". The following descriptions are preferred embodiments for carrying out the invention; however, these descriptions are for the purpose of understanding the general principles of the specification and are not intended to limit the scope of the invention. The scope of protection of this invention is determined by the appended claims.

[0034] The upland cotton genome version used in this invention is the upland cotton genetic standard line TM-1 reference genome ZJU TM-1V2.1; the specific reference is Yan Hu, Jiedan Chen, Lei Fang, Zhiyuan Zhang, Wei Ma, Yongchao Niu, et al. Gossypium barbadense and Gossypium hirsutum genomes provide insights into the origin and evolution of allotetraploid cotton[J]. Nature Genetics, 2019, 51:739-748.

[0035] Example 1

[0036] In 2016 and 2017, 486 upland cotton varieties or lines were planted in an experimental field in Shihezi, Xinjiang. Three replicates were planted for each material in the field to conduct a detailed survey of the height of the first fruiting branch node. The data on the height of the first fruiting branch node conformed to a normal distribution model. Figure 1 It exhibits a large range of variation and can be used for subsequent genome-wide association analysis.

[0037] Simultaneously, whole-genome resequencing was performed on these 486 upland cotton materials, and the sequenced sequences were aligned to the cotton upland cotton TM-1 reference genome ZJU TM-1V2.1 (Hu et al. Nature Genetic, 2017). Bioinformatics software was used to identify whole-genome SNP variations. SNP variations were filtered based on the following criteria: deletion rate ≤0.2, heterozygosity rate ≤0.2, minimum allele frequency >0.05, and unique matching of SNP markers in the cotton genome. Finally, 4,489,601 high-quality SNPs were obtained for subsequent analysis.

[0038] Genome-wide association analysis was performed on phenotypic and genotypic data using a mixed linear model, based on p < 1 × 10⁻⁶.-6 After screening for SNP-associated signal sites, a stable SNP signal site highly associated with the first node of the fruiting branch was finally detected on the cotton A05 chromosome. The information of this associated site is A05:15876258bp. Figure 2 ).

[0039] At a base position of 15876258 bp on chromosome A05, there is a single-base mutation from T to C, resulting in either a homozygous "TT" or "CC" genotype. Primers were designed using this SNP site, and their nucleotide sequences are as follows:

[0040] Upstream primer (SEQ ID NO.3):

[0041] AGTAAAAGAGAAAGTGAAATAA

[0042] Downstream primer (SEQ ID NO.4):

[0043] AAATGAAACCCCAATTTCATTC

[0044] Genomic DNA was extracted from different cotton varieties and amplified. The PCR reaction system used for amplification was 10 μl, including 1 μl DNA template, 0.5 μl each of forward and reverse primers, 5 μl high-fidelity enzyme MIX, and 3 μl sterile water. The PCR reaction program was: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 0.5 min, 57℃ annealing for 0.5 min, 72℃ extension for 1 min, 30 cycles, followed by a final extension at 72℃ for 10 min. In this example, 328 cotton materials with haplotype TT and 81 cotton materials with haplotype CC were identified from this natural population. Single-base association analysis of these two SNP haplotypes with the phenotypic value of fruiting branch first node height showed that the mean fruiting branch first node height of TT-type cotton was 21.63 cm, while that of CC-type cotton was 18.76 cm, with TT-type cotton significantly higher than CC-type cotton (t-test detection, P<0.01). Figure 3 The TT haplotype indicates that cotton is more suitable for mechanized cotton harvesting (Table 1). This demonstrates a significant association between this locus and the height of the first node of the fruiting branch, and can be applied to breeding and scientific research on this trait.

[0045] Table 1. Representative materials suitable for and unsuitable for mechanical mining.

[0046]

[0047]

[0048] Example 2

[0049] Linkage disequilibrium was calculated within the 500 kb upstream and 500 kb downstream regions of this SNP locus. A strong linkage disequilibrium was found between 15858795 bp and 16180063 bp on chromosome A05. Therefore, the candidate QTL region associated with the fruit branch initiation node was narrowed down to the 15858795 bp to 16180063 bp region on chromosome A05. Figure 4 The SNP variant A05:15876258 is located within a region of strong linkage disequilibrium decay, further demonstrating that this locus is significantly associated with the height of the first node of the fruiting branch. This can be applied to breeding and scientific research on the trait of the first node of the fruiting branch in cotton. Furthermore, this indicates that this SNP locus can be used to locate genes closely linked to the height of the first node of the fruiting branch.

[0050] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting SNP sites associated with the height of the first node of a cotton fruiting branch in the identification of the height of the first node of a fruiting branch in upland cotton, characterized in that, The SNP site is located at 15,876,258 bp on chromosome A05 of the reference genome of the upland cotton genetic standard line TM-1. The nucleotide sequence of 200 bp upstream and downstream of the SNP site is shown in SEQ ID NO.5, and the site is located at 200 bp in SEQ ID NO.

5. The SNP site is a single base mutation from T to C. The cotton with the T base has a higher fruiting branch initiation node height than the cotton with the C base.

2. The application according to claim 1, characterized in that, The reagent for detecting SNP sites associated with the height trait of the first node of cotton fruit branches includes amplification primers, which include upstream and downstream primers with nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

3. The application according to claim 1, characterized in that, The specific application is as follows: Obtain the genomic DNA of the cotton sample; The obtained genomic DNA was amplified by PCR using a reagent that detects the SNP sites associated with the height trait of the first node of cotton fruit branches as described in claim 1. The height of the first node of the fruiting branch of the cotton plant to be tested is determined based on the genotype of the SNP site described in the PCR amplification product; wherein, if the genotype of the SNP site described in the PCR amplification product is homozygous TT genotype, the phenotype is high fruiting branch first node height; if the genotype of the SNP site described in the PCR amplification product is homozygous CC genotype, the phenotype is low fruiting branch first node height.

4. The application according to claim 3, characterized in that, The PCR amplification process used a PCR reaction system of 10 μl, which included 1 μl of DNA template, 0.5 μl each of upstream and downstream primers, 5 μl of high-fidelity enzyme MIX, and 3 μl of sterile water.

5. The application according to claim 3, characterized in that, The PCR amplification was performed using the following PCR reaction program: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 0.5 min, 57℃ annealing for 0.5 min, 72℃ extension for 1 min, 30 cycles, followed by a final extension at 72℃ for 10 min.

6. The application of a reagent for detecting SNP loci associated with the height of the first node of cotton fruiting branches in screening suitable upland cotton germplasm materials for mechanized harvesting, characterized in that... The SNP site is located at 15,876,258 bp on chromosome A05 of the reference genome of the upland cotton genetic standard line TM-1. The nucleotide sequence of 200 bp upstream and downstream of the SNP site is shown in SEQ ID NO.5, and the site is located at 200 bp in SEQ ID NO.

5. The SNP site is a single base mutation from T to C. The cotton with the T base has a higher fruiting branch initiation node height than the cotton with the C base. Among them, cotton with the TT haplotype is more suitable for mechanized cotton harvesting.

Images