Nuclear autoantigen sperm protein-containing pharmaceutical composition for promoting myocardial regeneration and repair and application of nuclear autoantigen sperm protein-containing pharmaceutical composition

Abstract

The invention relates to the technical field of biological medicines, and discloses a nuclear autoantigen sperm protein-containing pharmaceutical composition for promoting myocardial regeneration and repair and application of the nuclear autoantigen sperm protein-containing pharmaceutical composition. The nucleotide sequence of the NASP gene is as shown in SEQ ID NO: 1, and the coded amino acid sequence of the NASP gene is as shown in SEQ ID NO: 2. The pharmaceutical composition disclosed by the invention can promote the number of myocardial cells and repair necrotic myocardium on the gene level, so that acute myocardial infarction is improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to a pharmaceutical combination containing nuclear autoantigenic sperm protein for promoting myocardial regeneration and repair and its application. Background Art

[0002] The incidence and mortality of acute myocardial infarction (AMI) still show a rapid upward trend. At present, the treatment of myocardial infarction mainly focuses on the revascularization of the infarcted coronary artery to improve myocardial blood perfusion, but this cannot increase the number of myocardial cells or repair the necrotic myocardium. Finding effective targets for myocardial cell regeneration and promoting the repair of heart tissue and function is of great significance for slowing down and even reversing the progression of diseases after myocardial infarction. Research has found that the heart of mammals maintains the ability to regenerate within 7 days after birth. The endogenous proliferation ability of the myocardium is rapidly activated after myocardial infarction within 7 days after birth, and ultimately complete repair of heart tissue and function is achieved. However, this regenerative ability rapidly disappears 7 days after birth. Currently, multiple genes, including ERBB2 and Hippo / YAP, have been found to have reduced or disappeared expression after birth; while restoring their expression in the adult stage can restart the endogenous myocardial regeneration and repair ability of the damaged heart. Therefore, achieving an increase in the number of myocardial cells and repairing the necrotic myocardium at the gene level is the key technology for improving heart myocardial infarction.

[0003] Nuclear autoantigenic sperm protein (NASP) is a histone molecular chaperone encoded by the NASP gene, with a molecular weight of 85.2 kDa and consisting of 788 amino acids, and has a high degree of sequence conservation in humans and mice. NASP is divided into somatic type (sNASP), which is expressed in all mitotic cells and located in the nucleus, and testicular type (tSNAP), which is expressed in embryonic tissues, tumor cells, and testes. NASP mainly binds to histone H1 and HSP90 proteins, promoting the transport of histones to the dividing cell nucleus, and is essential for DNA replication, cell cycle progression, and cell proliferation. NASP is highly expressed in the neonatal heart and has low expression in the adult heart. Through searching domestic and foreign literature, there is no relevant research on NASP protein improving cardiac function after myocardial infarction by promoting myocardial cell regeneration. Summary of the Invention

[0004] In order to solve the above technical problems, the present invention provides a pharmaceutical combination containing nuclear autoantigenic sperm protein for promoting myocardial regeneration and repair and its application. The pharmaceutical combination of the present invention can, at the gene level, promote the number of myocardial cells and repair the necrotic myocardium, thereby improving acute myocardial infarction.

[0005] The present invention provides an application of a drug combination containing nuclear autoantigenic sperm protein in the preparation of a drug for treating acute myocardial infarction, and the drug composition includes the NASP gene; The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, and the amino acid sequence encoded by it is shown in SEQ ID NO:2.

[0006] Furthermore, the drug combination further includes a pharmaceutically acceptable carrier.

[0007] Furthermore, the carrier contains the myocardial-specific promoter cTNT.

[0008] Furthermore, the NASP gene is overexpressed in the myocardial tissue of the body.

[0009] The present invention also provides a drug combination containing nuclear autoantigenic sperm protein for promoting myocardial regeneration and repair, and the drug combination contains the NASP gene.

[0010] The present invention also provides an application of the drug combination containing nuclear autoantigenic sperm protein in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury.

[0011] The present invention also provides an application of the drug combination containing nuclear autoantigenic sperm protein in the preparation of a drug for promoting the proliferation of myocardial cells.

[0012] Any of the following applications of the NASP gene: (1) an application in the preparation of a drug or reagent for promoting the proliferation of myocardial cells; (2) an application in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury.

[0013] The embodiments of the present invention have the following technical effects: 1. The present invention first proves that the NASP protein has the effect of promoting myocardial regeneration and repair: by increasing the content of the NASP protein in myocardial cells, the proliferation ability is significantly enhanced both in primary mouse myocardial cells cultured in vitro and in mature myocardial cells in vivo. After acute myocardial ischemia injury in the adult heart, the NASP protein promotes the endogenous regeneration of myocardial cells to be rapidly activated. This process helps to promote the regeneration and repair of the damaged myocardium, reduce the formation of scar tissue, and contribute to the recovery of cardiac function.

[0014] 2. Myocardial cell-specific cTNT promoter enhances treatment precision and efficiency: The present invention uses a viral vector carrying the myocardial cell-specific promoter cTNT. This design ensures that only myocardial cells can activate and express the exogenous NASP gene in the vector. This method achieves precise treatment of myocardial cells while significantly reducing the risk of side effects in non-target tissues or cells. Using this viral vector to carry a cTNT-driven therapeutic gene fragment provides an ideal strategy for the treatment of myocardial infarction.

[0015] 3. Ease and safety of operation: The gene expression vector provided by the present invention can be administered by two methods: local in-situ injection into the myocardium and intravenous injection. It is convenient and easy to perform, and can effectively avoid the huge risks brought by means such as extracorporeal circulation and heart transplantation, providing a new strategy for the biological treatment of acute myocardial infarction and ischemia-reperfusion injury.

[0016] 4. Significant effects of cardiac protection and repair: Preliminary experimental results show that in-situ injection into the myocardium and in-situ injection into the infarct border zone can effectively promote the endogenous proliferation of adult mouse myocardial cells, reduce chronic scar formation, inhibit ventricular pathological remodeling, and significantly improve cardiac function. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0018] Figure 1 It is the plasmid vector map of pDC315-CTnT-3flag-T2A-egfp provided by the embodiment of the present invention.

[0019] Figure 2 It is the plasmid vector map of GV425 pAAV-cTNT promoter-EGFP-FT2A-WPRE-SV40polyA provided by the embodiment of the present invention.

[0020] Figure 3 It is the PCR electrophoresis map of the NASP plasmid of the present invention.

[0021] Figure 4 It is the result of NASP protein expression in the cell experiment provided by the embodiment of the present invention.

[0022] Figure 5 It is the result of NASP protein expression in the animal experiment provided by the embodiment of the present invention.

[0023] Figure 6 are the positive rates of Ki67 + and pH3 + in the cell experiments provided by the embodiments of the present invention. Among them, Figure 6 a in [description] is a typical graph of the Ki67 + index in the control group, Figure 6 b in [description] is a typical graph of the Ki67 + index in the experimental group, Figure 6 c in [description] is a typical graph of the pH3 + index in the control group, Figure 6 d in [description] is a typical graph of the pH3 + index in the experimental group, Figure 6 e in [description] is a statistical graph of the Ki67 + index, Figure 6 f in [description] is a statistical graph of the pH3 + index.

[0024] Figure 7 are the staining results of Ki67 + and pH3 + on the 14th day in the animal experiments provided by the embodiments of the present invention. Among them Figure 7 a in [description] is the staining result of pH3 + in the control group, Figure 7 b in [description] is the staining result of pH3 + in the experimental group, Figure 7 c in [description] is the staining result of Ki67 + in the control group, Figure 7 d in [description] is the staining result of Ki67 + in the experimental group, Figure 7 e in [description] is Figure 7 a partial enlarged view of the staining result of (a), Figure 7 f in [description] is Figure 7 a partial enlarged view of the staining result of (b), Figure 7 g in [description] is Figure 7 a partial enlarged view of the staining result of (c), Figure 7 h in [description] is Figure 7 a partial enlarged view of the staining result of (d), Figure 7 i in [description] is a statistical graph of the Ki67 + index, Figure 7 j in [description] is a statistical graph of the pH3 + index.

[0025] Figure 8 are the echocardiograms provided by the embodiments of the present invention. Among them Figure 8 a in [description] is the echocardiogram of the control mouse on the 1st day after myocardial infarction, Figure 8 b in [description] is the echocardiogram of the control mouse on the 28th day after myocardial infarction, Figure 8In panel c is the echocardiogram of the mouse with myocardial infarction on the 1st day after NASP treatment, Figure 8 In panel d is the echocardiogram of the mouse with myocardial infarction on the 28th day after NASP treatment, Figure 8 In panel e are the echocardiogram ejection fraction (EF) measurement results of the control mice and NASP-treated mice on the 1st day and the 28th day after myocardial infarction. The abscissa represents the 1st day after myocardial infarction in the control mice, the 1st day after myocardial infarction in the treated mice, the 28th day after myocardial infarction in the control mice, and the 28th day after myocardial infarction in the treated mice, Figure 8 In panel f are the fractional shortening (FS) measurement results of the control mice and NASP-treated mice on the 1st day and the 28th day after myocardial infarction. The abscissa represents the 1st day after myocardial infarction in the control mice, the 1st day after myocardial infarction in the treated mice, the 28th day after myocardial infarction in the control mice, and the 28th day after myocardial infarction in the treated mice.

[0026] Figure 9 is the cardiac Masson staining of the control group and the NASP treatment group mice provided in the embodiment of the present invention at 28 days after myocardial infarction, where Figure 9 In panel a is the staining result of the control group mice, Figure 9 In panel b is the staining result of the NASP treatment group, Figure 9 In panel c are the quantitative data of the cardiac scar areas of the control (CON) and NASP treatment group (NASP) mice. Detailed implementation manners

[0027] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0028] In a first aspect, some embodiments of the present invention provide an application of a drug combination containing nuclear autoantigen sperm protein in the preparation of a drug for treating acute myocardial infarction, and the drug composition includes the NASP gene; The nucleotide sequence of the NASP gene is as shown in SEQ ID NO:1, and the amino acid sequence encoded by it is as shown in SEQ ID NO:2.

[0029] In some implementation manners, the drug combination further includes a pharmaceutically acceptable carrier.

[0030] In some implementation manners, the carrier contains the myocardial-specific promoter cTNT.

[0031] In some implementation manners, the NASP gene is overexpressed in the myocardial tissue of the body.

[0032] Second aspect, in some embodiments of the present invention, a drug combination containing nuclear autoantigen sperm protein for promoting myocardial regeneration and repair is further provided, and the drug combination contains the NASP gene.

[0033] Third aspect, in some embodiments of the present invention, the application of the drug combination containing nuclear autoantigen sperm protein in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury is further provided.

[0034] Fourth aspect, in some embodiments of the present invention, the application of the drug combination containing nuclear autoantigen sperm protein in the preparation of a drug for promoting myocardial cell proliferation is further provided.

[0035] Fifth aspect, in some embodiments of the present invention, any one of the following applications of the NASP gene is provided: (1) Application in the preparation of a drug or reagent for promoting myocardial cell proliferation; (2) Application in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury.

[0036] The following is elaborated with specific examples: In the present invention, Figure 1 and Figure 2 two different plasmid vector maps were designed, and the synthesis from the design and preparation of the plasmid vector to the preparation of the drug combination was entrusted to Shanghai Genechem Co., Ltd.

[0037] In the present invention, the information of the tool vector: Vector name: pDC315-CTnT-3flag-T2A-egfp; Element order: CTnT-MCS-3flag-T2A-egfp; Element order after construction: CTnT-NM_016777 (Nasp)-3flag-T2A-egfp; Restriction enzyme sites: AgeI / AgeI; See the vector map in Figure 1 ; Vector name: GV425 pAAV-cTNT promoter-EGFP-FT2A-WPRE-SV40 polyA; Element order: cTNT promoter-EGFP-FT2A-MCS-WPRE-SV40 polyA; Element order after construction: cTNT promoter-EGFP-FT2A-NM_016777 (Nasp)-WPRE-SV40 polyA; Restriction enzyme sites: BamHI / SacII; See the vector map in Figure 2 .

[0038] Example 1, Preparation of a viral preparation of NASP protein driven by a myocardial-specific cTNT promoter: 1. Construction of an overexpression NASP protein viral plasmid vector driven by a myocardial-specific promoter cTNT (1)Target gene: NASP.

[0039] The nucleotide sequence of the NASP gene is shown in SEQ ID NO:1, where

[0040] The amino acid sequence encoded by the nucleotide sequence of SEQ ID NO:1 is as shown in SEQ ID NO:2, wherein: SEQ ID NO:2 is: MATESTAAAAIAAELVSADKIEDAPAPSTSADKMESLDVDSEAKKLLGLGQKHLVMGDIPAAVNAFQEAASLLGKKYGETANECGEAFFFYGKSLLELARMENGVLGNALEGVHVEEEEGEKTEDESLVENNDNVDEEAREELREQVYDAMGEKEAKKAEGKSLTKPETDKEQESEVEKGGREDMDISEPEEKLQETVEPTSKQLTESSEEAKEAAIPGLNEDEVASGKTEQESLCTEKGKSISGAYVQNKEFRETVEEGEEIISLEKKPKETSEDQPIRAAEKQGTLMKVVEIEAEIDPQVKSADVGGEEPKDQVATSESELGKAVLMELSGQDVEASPVVAAEAGAEVSEKPGQEITVIPNNGPVVGQSTVGDQTPSEPQTSAERLTETKDGSSVEEVKAELVPEQEEAMLPVEESEAAGDGVETKVAQRATEKAPEDKFKIAANEETQERDEQMKEGEETEGSEEEDRENDKAEETPNESVLEKKSLQENEEEEIGNLELAWDMLDLAKIIFKRQETKEAQLYAAQAHLKLGEVSVESENYIQAVEEFQACLSLQEQYLEAHDRLLAETHYQLGLAYGYNSQYDEAVAQFGKSIDVIEKRMAVLHEQMKEAEGSFTEYEKEIEELKELLPEIREKIEDAKESQRSGNVAELALKATLVESSTSGFTPSGAGASVSMIASRKPTDGASSSNCVTDISHLVRKKRKPEEESPRKDDAKKAKQEPEVNGGSGDAVSSGKEVSENMEAEAENQAESQTAEGTVESAATIKSTAC.

[0041] (2)Species: Mouse.

[0042] (3)According to Figure 1 and Figure 2 the plasmid vector maps, two plasmid vectors ligated with the myocardial-specific promoter cTNT were prepared.

[0043] (4)Vector digestion: Prepare deionized water (ddH2O), 10× CutSmart Buffer, the plasmid vector in (3) (concentration 1 μg / μL), and AgeI enzyme (10 U / μL). Each 50 μL digestion system contains: 42 μL ddH2O, 5 μL 10× CutSmart Buffer, 2 μL plasmid vector, and 1 μL AgeI enzyme. Gently pipette to mix the reagents, avoiding the generation of bubbles. Briefly centrifuge to settle the liquid to the bottom of the tube and remove any possible bubbles. Place the entire system in a constant temperature environment at 37°C for overnight reaction. After digestion, analyze the digestion products by agarose gel electrophoresis and recover the target DNA fragment according to the electrophoresis results.

[0044] (5)Obtaining the target gene fragment: The upstream primer (NASP-p1) is shown in SEQ ID NO:3: AGAGTACTGCTAGCACCGGTCGCCACCATGGCCACAGAGTCTACAGCCGCTG.

[0045] The downstream primer (NASP-p2) is shown in SEQ ID NO:4: TCCATGGTGGCGACCGGTGCACATGCAGTGCTTTTAATTGTAGCTG.

[0046] (6)PCR amplification of the target gene fragment: Prepare a 50 μL reaction system (5 μL 10× PCR Buffer, 4 μL dNTP, add the upstream and downstream primers in (5), 1 μL upstream primer (10 μM), 1 μL downstream primer (10 μM), 5 μL template DNA of the target gene NASP (10 ng / μL), 0.5 μL Taq DNA polymerase, and make up to 50 μL with DEPC water), gently pipette to mix, briefly centrifuge, and place in a PCR instrument for reaction to obtain the target gene.

[0047] (7)Exchange and transformation of the PCR product and the plasmid vector Prepare the ligation reaction system under ice-water bath conditions, and ligate the target gene in (6) into the plasmid vector in (4). Gently pipette and mix well, and briefly centrifuge to remove any possible bubbles. Incubate the reaction system in a 37°C water bath for 30 minutes. After the reaction is completed, transfer the system to an ice-water bath to cool for 5 minutes to terminate the reaction. Take 10 μL of the ligation reaction product and add it to 100 μL of competent cells, mix well, and let it stand on ice for 30 minutes to pre-cool the cells. Then, transfer the tube containing the reaction mixture to a 42°C water bath for heat shock treatment for 90 seconds, and after completion, place it back in the ice-water bath to cool for 2 minutes. Add 500 μL of LB medium to the tube, and incubate it on a shaker at 37°C for 1 hour. Finally, take an appropriate amount of the bacterial liquid, evenly spread it on an agar plate containing the corresponding antibiotic with a sterile spreading rod, invert the plate and place it in a constant temperature incubator, and culture it at 37°C for 12 - 16 hours to screen out the bacterial clones containing the target inserted fragment.

[0048] (8) Colony PCR identification: The identification upstream primer is as shown in SEQ ID NO:5: CTGTACTCCATGAGCAGATG; The identification downstream primer is as shown in SEQ ID NO:6: CGTCGCCGTCCAGCTCGACCAG.

[0049] Prepare 10×PCR Buffer, dNTPs, identification upstream primer, identification downstream primer, Taq DNA polymerase, and DEPC water. Prepare the PCR reaction system under sterile conditions. Each 50 μL reaction system contains: 5 μL of 10×PCR Buffer, 4 μL of dNTPs, 1 μL of the identification upstream primer, 1 μL of the identification downstream primer, 5 μL of the template DNA of the target gene NASP, 0.5 μL of Taq DNA polymerase, and make up to 50 μL with DEPC water. Pick a single colony with a sterile pipette tip in a laminar flow hood, put the picked colony into the prepared PCR reaction tube, and briefly centrifuge. Put the PCR reaction system containing the colony DNA template into a PCR instrument for amplification, and take a small amount of the product for agarose gel electrophoresis. Identification result: The electrophoresis result of the PCR product is consistent with the expected result, as Figure 3 shown.

[0050] (9)Sequencing: Inoculate the identified positive clone transformant into an appropriate amount of LB liquid medium containing the corresponding antibiotic, culture it at 37°C for 12 h - 16 h, and take an appropriate amount of the bacterial liquid for sequencing. Compare and analyze the sequencing result with the target gene sequence. Comparison result description: The sequencing result is completely consistent with the target sequence.

[0051] 2. Perform virus packaging on the plasmid vector obtained after exchanging step (6) in 1: (1) Adenovirus harvest: Cultivate HEK293 cells in an incubator at 37°C and 5% CO2 until the confluence reaches 50%-60%. Replace the medium with serum-free medium 2 hours before transfection. In a laminar flow hood, take plasmid DNA solution (5 μg of shuttle plasmid and 5 μg of helper plasmid, where the shuttle plasmid is the plasmid vector constructed in 1 of Example 1), 10 μL of P3000™, and mix well with 250 μL of serum-free Opti-MEM™ medium. Incubate at room temperature for 5 minutes. Separately, take 3.75 μL of Lipofectamine™ 3000 transfection reagent and mix well with 250 μL of serum-free Opti-MEM™ medium. Add all the diluted plasmid DNA solution to the diluted Lipofectamine™ 3000 solution, gently pipette to mix well, avoid air bubbles, and incubate at room temperature for 20 minutes to form a DNA / Lipofectamine™ 3000 transfection complex. Slowly drip the transfection complex into the HEK293 cell medium, gently shake the medium to make it evenly distributed, and culture in an incubator at 37°C and 5% CO2. 48-72 hours after transfection, observe under a microscope whether there are cytopathic effect (CPE) manifestations such as cell morphological changes, cell aggregation, cell detachment, or decreased cell viability in HEK293 cells. When most cells show CPE and 50% of the cells are detached from the wall, centrifuge at low speed to collect the cells and resuspend them in 10 mL of DMEM medium. Freeze-thaw and oscillate 3 times at -70°C / 37°C, centrifuge at 4°C and 7000g for 5 min, collect the virus supernatant and store it at -70°C to obtain the adenovirus with the target vector.

[0052] (2) Adeno-associated virus harvest: Culture AAV-293 cells in an incubator at 37°C and 5% CO2 until they reach 70%-80% confluence. Replace the medium with serum-free medium 2 hours before transfection. Take the plasmids required for co-transfection (viral plasmid vector (the vector constructed in the example), pAAV-RC vector, pHelper vector), and adjust the plasmid concentration to 1 mg / mL with TE buffer at pH 7.5. For each 100 mm culture dish to be packaged with virus, 10 μL (10 μg) of each of the three plasmids is needed. Mix them with 1 mL of 0.3 M CaCl2. Take 1 mL of 2×HBS solution into a 15 mL centrifuge tube, add 1.03 mL of the DNA / CaCl2 mixture, gently pipette to mix evenly, and drop the mixed solution into the cell culture dish, gently shake to mix evenly, and culture in an incubator at 37°C and 5% CO2. 48-72 hours after transfection, observe under a microscope whether there are cytopathic effect (CPE) manifestations such as changes in cell morphology, cell aggregation, cell detachment, or decreased cell viability in AAV-293 cells. When most cells show CPE and 50% of the cells are detached from the wall, centrifuge at low speed to collect the cells and resuspend them in 10 mL of DMEM medium, freeze-thaw and oscillate 3 times at -70°C / 37°C, centrifuge at 4°C and 7000g for 5 min, collect the virus supernatant and store it at -70°C to obtain the adeno-associated virus with the target vector.

[0053] 2. Virus amplification: Amplification can be selected according to the actual situation. Culture HEK293 cells in a 10 cm culture dish in DMEM medium containing 10% FBS (fetal bovine serum) at 37°C and 5% CO2 until they reach 50%-60% confluence. Take 0.5 μL of the virus stock solution for the first amplification, add DMEM medium containing 10% FBS to 1 mL, mix well, remove the original culture medium in the culture dish, add the virus mixture, shake crosswise and culture in an incubator at 37°C and 5% CO2 for 90 minutes, then add 9 mL of DMEM medium containing 10% FBS and continue to culture for 72 hours for MOI determination. Collect the cells, centrifuge at 4°C and 600xg for 5 minutes to precipitate the cells, slowly pour off the supernatant, add 1 mL of virus preservation solution to resuspend the cells, freeze-thaw 3 times at -20°C / 37°C, centrifuge at 4°C and 7000g for 5 minutes, collect the supernatant, and perform virus titer determination. Aliquot the collected virus particles and store them at -70°C.

[0054] (3)Virus purification: Use the Adeno-X™ Virus Purification Kit. Take out the Adeno-X purification device, filter the crude virus stock solution with a 0.45 µm filter membrane, and save the filtrate in a collection bottle; add 4 µL of Benzonase at 25 U / µL to the virus filtrate, mix well, incubate at 37 °C for 30 min, and then add 10 mL of 1× Dilution buffer and mix evenly. Assemble the purification filter onto a standard-sized Luer-Lok syringe, and assemble a one-way valve between the filter and the syringe. After equilibrating the filter with Equilibration Buffer, insert the sleeve into the virus filtrate in the collection bottle, and pull the syringe out at a speed of 5 mL / min to allow the virus filtrate to flow through the filter, and the virus particles will adsorb onto the membrane of the filter. First, wash the filtration device with 1× WashBuffer to remove the unadsorbed impurities, and then use 1× Elution Buffer to elute the virus particles adsorbed on the filter membrane. Pass the elution buffer through the filter and collect the eluate containing the purified virus. Collect the eluted virus into a sterile centrifuge tube, measure the titer of the purified virus, aliquot the purified virus, and store it at -70 °C.

[0055] Example 2: Cell experiment, experimental study on the promotion of the proliferation of primary mouse cardiomyocytes by the NASP protein kinase gene expression vector driven by the cTNT promoter: (1)Extraction of primary mouse cardiomyocytes Take newborn mice aged 1 - 3 days after birth, disinfect by soaking in alcohol, and then open the chest to cut the ventricular muscle. Rinse with PBS buffer and cut into pieces, and complete the whole process within 5 minutes. Digest with a digestive solution containing trypsin and collagenase 6 - 8 times (37 °C, 120 rpm, 8 minutes each time) until the myocardial tissue becomes white flocculent. Collect all the supernatants, centrifuge at 1200 rpm for 8 min, and discard the supernatant. Resuspend the cells with complete medium, filter through a 40 µm cell sieve, and remove a large number of fibroblasts by differential adhesion for 45 min, and then separate and purify the cardiomyocytes by Percoll method. Culture in an incubator at 37 °C with 5% CO2, and change the medium after 48 hours.

[0056] Transfect primary mouse cardiomyocytes with Ad5:cTNT-NASP: Transfect the extracted cardiomyocytes with empty virus (i.e., adenovirus without a Figure 1 vector, denoted as Ad5:cTNT-CON) and cardiomyocyte-specific human NASP gene expression vector (Ad5:cTNT-NASP, i.e., loaded with Figure 1The adenovirus of the vector, denoted as Ad5:cTNT-NASP), was cross-shaken evenly and cultured in a 37°C, 5% CO2 incubator for 36 - 48 hours, and the fluorescence transfection efficiency was observed under a microscope.

[0057] Establish a glucose and oxygen deprivation model of primary mouse cardiomyocytes (i.e., an acute myocardial infarction model): Remove the original cell culture medium, replace it with serum-free DMEM medium without glucose, and in a sealed anaerobic culture chamber, remove the oxygen in the culture chamber and incubate at 37°C for 8 hours. Perform Ki67 + and pH3 + staining detection, and the specific operations are as follows: (1) Remove the culture medium and wash the cells 3 times with PBS buffer. Add 4% paraformaldehyde to each well to fix the cells for 30 minutes. Remove the fixative and wash the cells 3 times with PBS buffer. Add PBS buffer containing 0.2% Triton X-100 to each well and permeabilize on a shaker at room temperature for 10 - 15 minutes. Remove the permeabilization solution and wash the cells 3 times with PBS buffer. Add PBS buffer containing 10% goat serum and block on a shaker at room temperature at 60 - 70 rpm for 2 hours. Remove the blocking solution and add the primary antibody dilution solution (cTNT (Anti-Cardiac Troponin T antibody [1C11] (ab8295)): PBS buffer with 10% goat serum at a volume ratio of 1:200. Among them, for Ki67 + staining, use Ki67 (Anti-Ki67 antibody (ab15580)): PBS buffer with 10% goat serum at a volume ratio of 1:200; for pH3 + staining, pH3 (Anti-PH3 antibody [EPR13306] (ab180577)): PBS buffer with 10% goat serum at a volume ratio of 1:200), and incubate on a shaker at 4°C at 60 - 70 rpm overnight.

[0058] (3) Remove the primary antibody dilution solution, add the corresponding species secondary antibody dilution solution (PBS buffer with 10% goat serum) and incubate on a slow shaker at room temperature at 50 rpm for 2 hours.

[0059] (4) Remove the secondary antibody dilution solution and wash 3 times with PBS buffer. Add DAPI dye and incubate on a shaker at room temperature at 60 - 70 rpm for 20 minutes. After removing the dye, wash 3 times with PBS. Use a laser confocal microscope to collect images and perform quantitative analysis of Ki67 + and pH3 + positive cells.

[0060] The results are as Figure 4 shown, in Figure 4It can be found that the adenovirus carrying the target gene in Example 1 successfully infects cardiomyocytes, thereby promoting an increase in the content of NASP protein in cardiomyocytes.

[0061] In Figure 6 it can also be further verified that the positive rates of two indicators, Ki67 + and pH3 + in cardiomyocytes infected with the adenovirus carrying the target gene in Example 1 are high, proving that the ability of cardiomyocytes to divide and proliferate is stronger. It can be seen that the viral vector obtained in Example 1 of the present invention can successfully promote the proliferation of cardiomyocytes.

[0062] Example 3: Animal experiment, experimental study on the promotion of myocardial regeneration and repair by a human NASP protein kinase gene expression vector driven by the cTNT promoter: Sixty 8-week-old male C57BL / 6J mice purchased from the Medical Experimental Animal Center of Nanjing Medical University were randomly divided into two groups, and a myocardial infarction model combined with intramyocardial injection of AAV9 model (i.e., the adenovirus-associated virus carrying the Figure 2 vector) was constructed respectively. The specific operation was as follows: Adult C57BL / 6 mice were sedated with 1.2% avertin (Sigma-Aldrich, St. Louis, USA), and artificial ventilation was performed after tracheal intubation. After a skin incision, the intercostal muscles were bluntly dissected, and a left thoracotomy was performed at the third intercostal space. The left anterior descending coronary artery (LAD) was ligated with a 7-0 suture needle with a thread, and an assistant used a microsyringe with a 36G needle to perform intramyocardial injection of the adenovirus-associated virus AAV9:cTNT-NASP preparation (i.e., the adenovirus-associated virus carrying the Figure 2 vector, denoted as AAV9:cTNT-NASP) on the left, right, and upper sides of the pale infarct area around the ligation site as the experimental group or a control virus (the adenovirus-associated virus not carrying the Figure 2 vector, denoted as AAV9:cTNT-CON) as the control group, 3 μL at each point, and the total amount of injected virus was 1.1×109 v.g. The chest wall and skin incisions were sutured with 3-0 non-absorbable sutures. Then the mice were placed on a warming table, and their vital signs were continuously monitored until they recovered from anesthesia. The subsequent experiments were as follows: (1) Seven mice were randomly selected from each group to monitor the recovery of cardiac function at different time points after modeling. Echocardiography was performed on the two groups on the 1st and 28th days after surgery to detect the differences in cardiac function. Figure 5 The results showed that the adenovirus-associated virus carrying the target gene also successfully infected cardiomyocytes, thereby promoting an increase in the content of NASP protein in the myocardial tissue of mice. Figure 8The results showed that: 28 days after the operation, 7 mice survived in the myocardial infarction + AAV9:cTNT-CON group, and 7 mice survived in the myocardial infarction + AAV9:cTNT-NASP group; the ejection fraction (EF value) of the hearts of the mice injected with the AAV9:cTNT-NASP group was significantly increased compared with that of the AAV9:cTNT-CON group, and maintained a slow upward trend until the longest observation time point, indicating that the viral preparation could significantly and continuously promote the recovery of cardiac function after MI in mice. As Figure 9 shown, 28 days after the operation, after performing echocardiography, all the experimental mice in this part were sacrificed, and fresh heart tissues were taken to prepare paraffin specimen sections. The tissue sections were stained using a Masson staining kit, and it was found that the degree of myocardial fibrosis in the mice injected with the AAV9:cTNT-NASP group was significantly reduced compared with that of the AAV9:cTNT-CON group, indicating that the AAV9:cTNT-NASP preparation could promote myocardial regeneration and repair, reduce the fibrotic area, inhibit cardiac remodeling, and improve cardiac function.

[0063] (2)Three mice were randomly selected from each group for the detection of myocardial cell proliferation 14 days after modeling. The results were as Figure 7 shown. Fresh hearts of the mice 14 days after the operation were used to make paraffin sections of the injury border area, and Ki67 + and pH3 + staining were performed. The results showed that the cell cycle activity and mitosis of myocardial cells in the injury border area of the mice in the AAV9:cTNT-NASP group were significantly increased, suggesting that the AAV9:cTNT-NASP preparation could promote the proliferation of myocardial cells after MI injury in adult mice. It is shown that: the AAV9:cTNT-NASP preparation can be used as a new strategy for the treatment of regeneration and repair after acute myocardial infarction injury.

[0064] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the technical solutions of the embodiments of the present invention.

Claims

1. Use of a drug combination containing nucleosome autoantigenic sperm protein for promoting myocardial regeneration and repair in the preparation of a drug for treating acute myocardial infarction, characterized in that, The pharmaceutical composition comprises the NASP gene; The nucleotide sequence of the NASP gene is as shown in SEQ ID NO:1, and the amino acid sequence encoded thereby is as shown in SEQ ID NO:

2.

2. The application according to claim 1, characterized in that, The pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

3. The application according to claim 2, wherein The carrier contains the cardiac muscle specific promoter cTNT.

4. The application according to claim 1, characterized in that, The NASP gene is overexpressed in the cardiac muscle tissue of the body.

5. A drug combination containing nucleosome autoantigenic sperm protein for promoting myocardial regeneration and repair, characterized in that, The pharmaceutical composition contains the NASP gene in any one of the applications described in claims 1-4.

6. Use of the pharmaceutical composition containing nuclear autoantigenic sperm protein in any one of the applications described in claims 1-4 in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury.

7. Use of the pharmaceutical composition containing nuclear autoantigenic sperm protein in any one of the applications described in claims 1-4 in the preparation of a drug for promoting myocardial cell proliferation.

8. Any one of the following uses of the NASP gene: (1) Use in the preparation of a drug or reagent for promoting myocardial cell proliferation; (2) Use in the preparation of a drug for promoting myocardial regeneration and repair after myocardial injury.

Images