Application of scylla antibacterial peptide Scin in preparation of anti-inflammatory composition and preparation method of scylla antibacterial peptide Scin

Abstract

The invention discloses application of scylla serrata antibacterial peptide Scycin in preparation of an anti-inflammatory composition and a preparation method of the scylla serrata antibacterial peptide Scycin. The nucleotide sequence of the scylla serrata antibacterial peptide Scycin is shown as SEQ ID NO.01. The invention further discloses a preparation method of the scylla serrata antibacterial peptide Scycin. In an LPS (lipopolysaccharide)-induced RAW 264.7 macrophage inflammation model, the recombinant expression plasmid vector containing the scylla antibacterial peptide Scin remarkably inhibits an inflammation cascade reaction by down-regulating expression of proinflammatory factors such as TNF-alpha (tumor necrosis factor-alpha) and IL-6 (interleukin-6), the anti-inflammatory effect of the recombinant expression plasmid vector is equivalent to that of a mesalazine positive control group, and obvious cytotoxicity is not observed.

Description

Technical Field

[0001] The present invention belongs to the fields of marine molecular biotechnology and protein engineering technology, and particularly relates to the use of the Scycin antibacterial peptide of mud crab in the preparation of an anti-inflammatory composition and its preparation method. Background Art

[0002] In recent years, with the increasingly serious problem of antibiotic resistance, antimicrobial peptides (AMPs) have become a hot spot in the development of new antibacterial drugs due to their broad-spectrum antibacterial activity and low tendency to induce drug resistance. However, the acquisition of traditional antimicrobial peptides mainly relies on natural extraction or chemical synthesis, and these methods have defects such as high cost, low yield, and complex processes. For example, the content of natural antimicrobial peptides in organisms is extremely low, and the separation and purification are difficult; while the chemical synthesis method can accurately control the sequence, but the large-scale production cost is high, and the product is easily affected by protease degradation, resulting in a decrease in activity. Therefore, using genetic engineering technology to efficiently produce antimicrobial peptides through a prokaryotic expression system has become the key technical direction to solve the above problems.

[0003] The functional research of antimicrobial peptides has expanded from single antibacterial activity to multiple biological activities such as anti-inflammatory and immunomodulatory. Research shows that antimicrobial peptides can not only strongly inhibit pathogenic microorganisms, but also relieve bacterial pathological damage by regulating the expression of inflammatory factors. Inflammation is a defensive response of organisms to infection, tissue damage or other stimuli, usually manifested as fever, swelling, pain, and loss of function. In general, the self-limiting acute inflammatory response is short-term, and through a complex cascade reaction, immune cells such as granulocytes are recruited to the inflamed site to eliminate the stimulus and restore physiological balance. However, in some cases, the acute inflammatory response cannot effectively eliminate the stimulus, and may turn into chronic inflammation during the continuous reaction process, thereby causing further damage to its own tissues.

[0004] At present, the commonly used anti-inflammatory drugs in clinical practice mainly include non-steroidal anti-inflammatory drugs and glucocorticoid drugs, while antibiotics (such as penicillins, cephalosporins, aminoglycosides, and tetracyclines, etc.) mainly target pathogen infections. However, the drug resistance problem faced by antibiotic drugs also affects the treatment of inflammatory diseases. Therefore, developing more effective and less toxic expression products of the Scycin antibacterial peptide for the treatment of acute or chronic inflammatory diseases has important significance and broad prospects.

[0005] In summary, developing an efficient and low-cost prokaryotic expression preparation method and deeply exploring the anti-inflammatory function of antimicrobial peptides will provide important support for the clinical application of antimicrobial peptides and lay a foundation for their industrial development. Summary of the Invention

[0006] The object of the present invention is to overcome the defects of the prior art and provide the use of Scycin, an antibacterial peptide from mud crab, in the preparation of an anti-inflammatory composition.

[0007] Another object of the present invention is to provide a recombinant expression plasmid vector

[0008] Another object of the present invention is to provide a recombinant antibacterial peptide rScycin and its preparation method.

[0009] Another object of the present invention is to provide an anti-inflammatory composition.

[0010] The technical solution of the present invention is as follows:

[0011] The use of Scycin, an antibacterial peptide from mud crab, in the preparation of an anti-inflammatory composition, wherein the nucleotide sequence of the Scycin, an antibacterial peptide from mud crab, is as shown in SEQ ID NO.01.

[0012] In a preferred embodiment of the present invention, the Scycin, an antibacterial peptide from mud crab, a reducing agent self-cleaving peptide, a linker peptide and a self-aggregating peptide are co-loaded on pET-21a to form a recombinant expression vector plasmid.

[0013] More preferably, the nucleotide sequences of the reducing agent self-cleaving peptide, the linker peptide and the self-aggregating peptide are as shown in SEQ ID NOs.02 to 04 in sequence.

[0014] A recombinant expression plasmid vector, which is based on pET-21a, and the pET-21a is loaded with Scycin, an antibacterial peptide from mud crab, a reducing agent self-cleaving peptide, a linker peptide and a self-aggregating peptide, and the nucleotide sequence of the Scycin, an antibacterial peptide from mud crab, is as shown in SEQ ID NO.01.

[0015] In a preferred embodiment of the present invention, the nucleotide sequences of the reducing agent self-cleaving peptide, the linker peptide and the self-aggregating peptide are as shown in SEQ ID NOs.02 to 04 in sequence.

[0016] A recombinant antibacterial peptide rScycin, characterized in that: it is obtained by cleavage with DTT after expression in Escherichia coli by the above recombinant expression plasmid vector.

[0017] The preparation method of the above recombinant antibacterial peptide rScycin includes the following steps:

[0018] (1) Loading the Scycin, an antibacterial peptide from mud crab, a reducing agent self-cleaving peptide, a linker peptide and a self-aggregating peptide on pET-21a, then transforming it into Escherichia coli Rosetta competent cells for culture, then inducing expression with IPTG, and then ultrasonically disrupting the bacterial cells and centrifuging to collect the precipitate;

[0019] (2) The precipitate obtained in step (1) is washed with PBS, then DTT is added for cleavage, followed by centrifugation. It is then dissolved in 0.5% acetic acid, and subsequently purified by ultrafiltration, dialyzed, and freeze-dried to obtain the product.

[0020] An anti-inflammatory composition, whose active ingredient includes the Scylla serrata antibacterial peptide Scycin with a nucleotide sequence as shown in SEQ ID NO.01.

[0021] An anti-inflammatory composition, whose active ingredient includes the above-mentioned recombinant antibacterial peptide rScycin.

[0022] The beneficial effects of the present invention are as follows:

[0023] 1. In the LPS-induced RAW 264.7 macrophage inflammation model, the recombinant expression plasmid vector containing the Scylla serrata antibacterial peptide Scycin in the present invention significantly inhibits the inflammatory cascade reaction by downregulating the expression of pro-inflammatory factors such as TNF-α and IL-6. Its anti-inflammatory effect is comparable to that of the mesalazine positive control group, and no obvious cytotoxicity is observed.

[0024] 2. The Scylla serrata antibacterial peptide Scycin in the present invention exhibits broad-spectrum antibacterial activity and has a significant inhibitory effect on clinical drug-resistant strains (including Acinetobacter baumannii, Pseudomonas aeruginosa, Staphylococcus aureus, etc.). Its minimum inhibitory concentration (MIC) is better than that of the traditional antibiotic control group. Description of the Drawings

[0025] Figure 1 It is a diagram showing the induction expression results of the Scylla serrata antibacterial peptide Scycin in Example 2 of the present invention.

[0026] Figure 2 It is a diagram showing the results of the reducing agent cleavage conditions of the Scylla serrata antibacterial peptide Scycin in Example 3 of the present invention.

[0027] Figure 3 It is a diagram showing the results of the acetic acid dissolution and purification of the Scylla serrata antibacterial peptide Scycin.

[0028] Figure 4 It is a diagram showing the results of the effect of the Scylla serrata antibacterial peptide rScycin on the protein expression level of the polarization markers of RAW 264.7 cells after LPS treatment in Example 4 of the present invention.

[0029] Figure 5 It is a diagram showing the results of the effect of the Scylla serrata antibacterial peptide rScycin on the M1-type polarization of RAW 264.7 cells after LPS treatment in Example 4 of the present invention.

[0030] Figure 6 It is a diagram showing the results of the effect of the Scylla serrata antibacterial peptide rScycin on the M2-type polarization of RAW 264.7 cells after LPS treatment in Example 4 of the present invention.

[0031] Figure 7 This is the result diagram of the effect of the mud crab antibacterial peptide rScycin on the NO level of RAW 264.7 cells after LPS treatment in Example 4 of the present invention.

[0032] Figure 8 This is the result diagram of the cytokine secretion level of the mud crab antibacterial peptide rScycin on RAW 264.7 cells after LPS treatment in Example 4 of the present invention. Detailed implementation manners

[0033] The technical solutions of the present invention will be further described and illustrated below through specific implementation manners in conjunction with the drawings.

[0034] Example 1

[0035] The nucleotide sequence of the Escherichia coli - preferred codon - optimized Scycin of the mud crab antibacterial peptide is: ctggcacgttgtctggttcgtgcatctcgttcacctcattttattattcgtggtcagtcacgcggtgttcgt (SEQ ID NO.01).

[0036] The mud crab antibacterial peptide Scycin was constructed into the pET - 21a recombinant expression vector plasmid by double digestion. The restriction enzyme sites were Nde I (catatg) and Xho I (ctcgag). The nucleotide sequences of the reducing agent self - cleaving peptide, the linker peptide, and the self - aggregating peptide were constructed into the pET21a - Scycin recombinant expression vector plasmid, so that the recombinant expression vector sequentially contained the above - mentioned mud crab antibacterial peptide Scycin, the reducing agent self - cleaving peptide, the linker peptide, and the self - aggregating peptide.

[0037] The recombinant expression plasmid was transformed into Escherichia coli DH5α competent cells, spread on an LB plate resistant to ampicillin, and single colonies were picked for sequence identification. The recombinant expression plasmid with the correct sequence was picked.

[0038] The nucleotide sequence of the reducing agent self - cleaving peptide is shown as SEQ ID NO.02:

[0039] atgcgaatgtgcatcaccggcgacgccttagtggcactgccggaaggcgaaagcgtgcgtattgccgatatcgttccgggtgcacgccctaacagcgataatgcaatcgacctgaaagtgttagatcgccacggcaatcctgttctggccgatcgcctgtttcacagtggcgaacatccggtgtacacagtgcgcaccgtggaaggtctgcgcgtgaccggcacagcaaatcacccgctgctgtgtttagtggacgttgcaggcgtgcctacactgctgtggaagctgatcgatgaaatcaagccgggtgactacgcagtgattcagcgcagtgccttcagcgttgattgcgccggttttgcacgtggcaaaccggaatttgcaccgaccacctacaccgtgggtgtgccgggcctggttcgtttcctggaagcacaccatcgtgatccggacgcacaggccattgccgatgagctgaccgacggccgcttttactatgccaaagttgccagcgtgacagatgcaggtgtgcagccggtttacagtttacgcgtggataccgccgatcacgcattcattaccaacggcttcgttagccatgccaagctt;

[0040] The nucleotide sequence of the linker peptide is shown in SEQ ID NO.03:

[0041] ccgaccccaccgaccacgccaacgccaccaaccaccccaaccccgacgccg;

[0042] The nucleotide sequence of the self - aggregating peptide is shown in SEQ ID NO.04.

[0043] ctggaactggaactgaaactgaaactggaactggaactgaaactgaaa。

[0044] Example 2

[0045] The correctly constructed recombinant expression plasmid in Example 1 was transformed into Escherichia coli Rosetta competent cells. The competent cells were spread on an LB plate containing ampicillin, and monoclonal colonies were picked and inoculated into an LB liquid medium containing ampicillin. They were cultured overnight at 37°C. The next day, they were transferred to a fresh LB liquid medium containing ampicillin at a ratio of 4‰ and cultured until OD 595 = 0.6, then the inducer IPTG was added at concentrations of 0 mM, 0.5 mM, and 1 mM respectively, and cultured at 16°C for 18 h. Subsequently, the bacterial cells were collected by centrifugation. After washing the bacterial cells with PBS, the bacterial cells were lysed using an ultrasonic disruptor, and the precipitate and supernatant were collected by centrifugation. SDS-PAGE gel electrophoresis was used to detect the expression level to determine the optimal induction concentration. As Figure 1 shown, when the IPTG concentration was 0.5 mM, a large amount of induced expression products were visible in the precipitate. Therefore, 0.5 mM IPTG was selected as the optimal induction concentration.

[0046] Example 3

[0047] Large-scale expression was carried out according to the conditions in Example 2. After centrifuging to collect the expressed bacterial cells, they were lysed under pressure to collect the precipitate. After washing the precipitate with PBS, DTT was added for cleavage, and the DTT concentrations were set at 0 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, and 80 mM. As Figure 2 shown, a 60 mM DTT concentration could make the cleavage reach equilibrium. Therefore, 60 mM DTT was selected as the optimal cleavage concentration. The precipitate added with 60 mM DTT was resuspended and cleaved at 4°C for 12 h. The liquid after cleavage was centrifuged to collect the precipitate, and the precipitate was resuspended with acetic acid. The acetic acid concentrations were set at 0%, 0.5%, 1%, 1.5%, and 2%. As Figure 3 shown, a 0.5% acetic acid concentration could dissolve the target peptide into the supernatant. Therefore, 0.5% acetic acid concentration was selected as the optimal concentration. The precipitate was dissolved with acetic acid to collect the supernatant, and the supernatant was purified using an ultrafiltration cup, and then the purified product was dialyzed into ultrapure water and stored after freeze-drying. The obtained high-purity rScycin (i.e., recombinant expression vector plasmid) is shown in Figure 3 .

[0048] Example 4

[0049] (1) Detection of the protein expression level of the polarization markers of RAW 264.7 cells after treatment with antibacterial peptides by Western-Blot method

[0050] The resuscitated RAW 264.7 cells were collected and resuspended, and evenly inoculated into a 96-well cell culture plate, and the cells were adjusted to 10 5CFU / well was placed in a 5% CO2 incubator and cultured at 37°C for 6 h until the cells adhered. Then the medium was discarded, fresh medium was added, and a negative control group (endotoxin-free water), a positive control group (2% Triton X-100), and an induction group with a LPS concentration of 1000 ng / mL were set up and cultured for 24 h. In the antimicrobial peptide treatment group, 24 μM of the antimicrobial peptide rScycin prepared in Example 2 was added to the cells 2 h after adding LPS, and they were co-incubated for 24 h.

[0051] The protein levels of inflammatory cytokines in the RAW 264.7 cell inflammation model before and after treatment with the antimicrobial peptide were detected by Western-Blot method, including the following steps:

[0052] a) Cells from each group were collected separately, washed with PBS, centrifuged, and the supernatant was discarded. 100 μL of RIPA lysis buffer was added to fully lyse the cells;

[0053] b) The lysed liquid was centrifuged at 12000 rpm, the supernatant was collected, and the protein concentration was measured using a BCA protein detection kit. The total protein concentrations of each group were adjusted to be the same;

[0054] c) SDS loading buffer was added to the total protein sample, mixed well by pipetting, and after boiling water bath for 10 min to complete sample preparation, SDS-PAGE analysis was performed;

[0055] d) The protein was transferred to a PVDF membrane using a semi-dry protein transfer system;

[0056] e) 5% skim milk was freshly prepared and used to block the PVDF membrane at room temperature for 2 h. The primary antibody (1:2000) was added and incubated at room temperature for 2 h, and then rinsed 3 times with PBST;

[0057] f) The secondary antibody (1:5000) was added and incubated at room temperature for 1 h, and then rinsed 3 times with PBST;

[0058] g) The PVDF membrane was placed in a chemiluminescence imaging system for development.

[0059] As Figure 4 shown, rScycin can reduce the protein expression level of the type 1 polarization marker iNOS in RAW 264.7 cells induced by LPS and increase the protein expression level of the type 2 polarization marker Arg.

[0060] (2) Detection of the effect of the antimicrobial peptide on the polarization of RAW 264.7 cells by immunofluorescence method

[0061] The effect of the antimicrobial peptide on the polarization of RAW 264.7 cells was detected by immunofluorescence method, including the following steps:

[0062] a) RAW 264.7 cells were collected and resuspended, and evenly seeded into a 96-well cell culture plate. The cells were adjusted to 104 Place <CFU> / well in a 5% CO₂ incubator and culture at 37 °C for 6 h. After the cells adhere to the wall, discard the culture medium and add fresh culture medium.

[0063] b) Add 1000 ng / mL LPS and the antimicrobial peptide respectively. At the same time, set up groups without adding LPS and without adding the antimicrobial peptide to LPS as controls, and co-incubate in a 5% CO₂ incubator at 37 °C for 12 h.

[0064] c) Discard the culture medium, add pre-cooled PBS to soak the cells for 2 min, and repeat 3 times.

[0065] d) Add 100 μL of 4% paraformaldehyde to each well to fix the cells for 10 min, add pre-cooled PBS to soak the cells for 2 min, and repeat 3 times.

[0066] e) Add 100 μL of 0.5% Triton X-100 PBS to each well to permeabilize the cells for 5 min, add pre-cooled PBS to soak the cells for 5 min, and repeat 3 times.

[0067] f) Add 10×FBS diluted with 0.5% Triton X-100 PBS to block the cells for 30 min.

[0068] g) Add the primary antibody (1:200) diluted with 0.5% Triton X-100 PBS and incubate at room temperature for 2 h. Add pre-cooled 0.3% Tween 20 PBS to soak the cells for 5 min, and repeat 3 times.

[0069] h) Add the fluorescent secondary antibody (1:200) diluted with 0.3% Tween 20 PBS and incubate at room temperature in the dark for 1 h. Add pre-cooled 0.3% Tween 20 PBS to soak the cells for 5 min, and repeat 3 times.

[0070] i) Add DAPI (10 μg / mL) diluted with 0.3% Tween 20 PBS and incubate at room temperature in the dark for 5 min. Add pre-cooled 0.3% Tween 20 PBS to soak the cells for 5 min, and repeat 3 times. Observe the cell fluorescence using a laser confocal microscope.

[0071] As Figure 5 shown, rScycin can reduce the protein expression level of the type 1 polarization marker iNOS in RAW 264.7 cells after LPS induction; as Figure 6 shown, rScycin can increase the protein expression level of the type 2 polarization marker Arg in RAW 264.7 cells after LPS induction.

[0072] (3) Determination of the content of NO in the supernatant of the cell culture medium after treatment with the antimicrobial peptide

[0073] The determination of the NO content in the cell culture supernatant by the Griess method includes the following steps:

[0074] a) Prepare the nitrate reduction reagent by mixing an appropriate amount of sulfanilic acid solution and α-naphthylamine solution in equal amounts;

[0075] b) Take 550 μL of the cell culture supernatant, add 100 μL of the nitrate reduction reagent, and incubate at 37 °C for 10 min;

[0076] c) Detect the sample reading at the OD 540 wavelength.

[0077] As Figure 7 shown, rScycin can significantly reduce the NO release amount of RAW 264.7 cells after LPS induction.

[0078] (4) Detect the protein levels of inflammatory cytokines in the RAW 264.7 cell inflammation model after treatment with antibacterial peptides by ELISA

[0079] Use ELISA to detect the expression levels of inflammatory cytokine proteins in the RAW 264.7 cell inflammation model before and after treatment with antibacterial peptides, including the following steps:

[0080] a) Collect the cell supernatants of each group respectively, dilute them to 2 μg / mL with 50 mM sodium carbonate (Na2CO3), add 100 μL to each well in a 96-well ELISA plate, and incubate overnight at 4 °C for coating;

[0081] b) Wash the plate wells 3 times with PBST, add 5% fetal bovine serum (FBS) to each well, and block at 37 °C for 1 h;

[0082] c) Wash the plate wells 3 times with PBST, add 100 μL of primary antibody at different dilution multiples to each well, and incubate at 37 °C for 1 h;

[0083] d) Wash the plate wells 3 times with PBST, add 100 μL of secondary antibody (diluted 1:5000) to each well, and incubate at 37 °C for 30 min;

[0084] e) Wash the plate wells 3 times with PBST, add 100 μL of HRP substrate TMB to each well for color development, and add 20% dilute sulfuric acid to terminate the reaction after 15 min;

[0085] f) Detect the reading at 450 nm wavelength with an enzyme-labeled instrument.

[0086] As Figure 8 shown, rScycin can significantly reduce the expression levels of pro-inflammatory factors IL-6, IL-1β and TNF-α in RAW 264.7 cells after LPS induction, and significantly increase the expression level of the anti-inflammatory cytokine IL-10.

[0087] Example 5

[0088] The strains involved in this example are: Staphylococcus aureus, Acinetobacter baumannii, Pseudomonas hydrophila, Enterococcus faecium, Enterococcus faecalis, Bacillus cereus, and Escherichia coli.

[0089] All the strains were purchased from the China General Microbiological Culture Collection Center (CGMCC) and stored in this laboratory.

[0090] The specific method is as follows:

[0091] (1) Spread the preserved bacteria on a nutrient broth plate and incubate it in an inverted position at appropriate temperatures for 18 - 24 h.

[0092] (2) Pick colonies from each plate and inoculate them on the corresponding culture medium slants, and continue to culture for 18 - 24 h. Adjust the concentration of the bacterial suspension to a final concentration of 1×10 6 CFU / mL with 10 mM sodium phosphate buffer (pH = 7.4).

[0093] (3) Dissolve the rScycin powder prepared in Example 3 in sterilized ddH2O respectively, filter it through a 0.22 μm filter membrane, and serially dilute the polypeptide concentration to 0 μM, 1.25 μM, 2.5 μM, 5 μM, 10 μM, and 20 μM, and place it on ice for later use.

[0094] (4) On a 96 - well cell culture plate, set up a blank control group, a negative control group, and a test experimental group for each bacterium to be tested, and set three parallels for each group:

[0095] a Blank control group: 50 μL of the polypeptide sample to be tested and 50 μL of the culture medium

[0096] b Negative control group: 50 μL of sterile ddH2O and 50 μL of the bacterial suspension

[0097] c Test experimental group: 50 μL of the polypeptide sample to be tested and 50 μL of the bacterial suspension

[0098]

[0099] ​(5) Place the 96-well cell culture plate in an incubator at 28 °C and incubate for 48 h to observe the MIC results in the test experimental group. After pipetting and mixing the test experimental group, pipette an appropriate amount of the bacterial solution and drop it onto the corresponding solid medium plate, and incubate it inverted at an appropriate temperature for 1-2 days to observe the MBC results.

[0100] The observed results of rScycin MIC and MBC are shown in Table 1. rScycin has broad-spectrum antibacterial activity against a variety of Gram-negative and Gram-positive bacteria.

[0101] Table 1 Antibacterial activity of the antibacterial peptide rScycin from mud crab

[0102]

[0103] Note: MIC: minimum inhibitory concentration (μM), expressed as a - b. a: the highest polypeptide concentration with visible bacterial growth to the naked eye; b: the lowest polypeptide concentration without visible bacterial growth to the naked eye

[0104] MBC: minimum bactericidal concentration (μM), expressed as a - b. a: the highest polypeptide concentration with visible colony growth on the plate; b: the lowest polypeptide concentration without visible colony growth on the plate.

[0105] As mentioned above, it is only the preferred embodiment of the present invention, so the scope of implementation of the present invention cannot be limited thereby. That is, equivalent changes and modifications made according to the scope of the present invention patent and the content of the specification should still fall within the scope covered by the present invention.

Claims

1. Use of Scycin, an antibacterial peptide from Scylla serrata, in the preparation of an anti-inflammatory composition, characterized in that: The nucleotide sequence of the Scylla serrata antimicrobial peptide Scycin is shown in SEQ ID NO.

01.

2. The use according to claim 1, wherein: The Scylla serrata antimicrobial peptide Scycin, the reducing agent self-cleaving peptide, the linker peptide, and the self-aggregating peptide are co-loaded into pET-21a to form a recombinant expression vector plasmid.

3. The use according to claim 2, wherein: The nucleotide sequences of the reducing agent self-cleaving peptide, the linker peptide, and the self-aggregating peptide are shown in SEQ ID NO.02 to 04 in sequence.

4. A recombinant expression plasmid vector, characterized in that: Based on pET-21a, the pET-21a is loaded with the Scylla serrata antimicrobial peptide Scycin, the reducing agent self-cleaving peptide, the linker peptide, and the self-aggregating peptide, and the nucleotide sequence of the Scylla serrata antimicrobial peptide Scycin is shown in SEQ ID NO.

01.

5. The recombinant expression plasmid vector according to claim 4, characterized in that: The nucleotide sequences of the reducing agent self-cleaving peptide, the linker peptide, and the self-aggregating peptide are shown in SEQ ID NO.02 to 04 in sequence.

6. A recombinant antimicrobial peptide rScycin, characterized in that: It is obtained by cleavage with DTT after expression of the recombinant expression plasmid vector described in claim 4 or 5 in Escherichia coli.

7. The preparation method of a recombinant antibacterial peptide rScycin as claimed in claim 6, characterized in that: Comprising the following steps: (1) Load the Scylla serrata antimicrobial peptide Scycin, the reducing agent self-cleaving peptide, the linker peptide, and the self-aggregating peptide onto pET-21a, then transform it into Escherichia coli Rosetta competent cells for culture, then perform IPTG induction expression, and then ultrasonically disrupt the bacterial cells and centrifuge to collect the precipitate; (2) Wash the precipitate obtained in step (1) with PBS, add DTT for cleavage, then centrifuge, dissolve it with 0.5% acetic acid, and then perform ultrafiltration purification, dialysis, and freeze-drying to obtain it.

8. An anti-inflammatory composition, characterized in that: Its active ingredient includes the Scylla serrata antimicrobial peptide Scycin with the nucleotide sequence shown in SEQ ID NO.

01.

9. An anti-inflammatory composition, characterized in that: Its active ingredient includes the recombinant antimicrobial peptide rScycin described in claim 6.

Images