Mini-mucus targeting PRRSV nucleocapsid (N) protein, mini-mucus composition and application

Abstract

The invention relates to the technical field of biological medicine and animal virus prevention and control, and discloses a PRRSV (porcine reproductive and respiratory syndrome virus) nucleocapsid (N) protein targeted mini sticky body, a mini sticky body composition and application thereof, the mini sticky body is selected from binder-1, binder-2 or binder-3, and the sequences of the binder-1, the binder-2 and the binder-3 respectively contain amino acid sequences shown as SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The mini sticky body composition is prepared from at least two of a binder-1, a binder-2 and a binder-3. The mini-sticky body or the mini-sticky body composition can be specifically combined with PRRSV nucleocapsid (N) protein, and proliferation of the PRRSV is inhibited.

Description

Technical Field

[0001] The present invention relates to the technical fields of biomedicine and animal virus prevention and control, and particularly relates to a mini-antibody targeting the nucleocapsid (N) protein of PRRSV, a mini-antibody composition and applications thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is caused by Porcine reproductive and respiratory syndrome virus (PRRSV), which is the number one disease in pig farms and one of the most important pig diseases in the global pig industry. Various PRRSV strains have been prevalent in China for nearly 30 years, causing incalculable economic losses to the pig industry.

[0003] At present, there is no effective anti-PRRSV drug. Clinically, antibiotics such as acetylisovaleryl tylosin tartrate (also known as tiamulin) and tilmicosin are often used to control the disease. However, they are not specific anti-PRRSV drugs and can only reduce the mortality rate of diseased pig herds to a limited extent without preventing virus infection. Moreover, the extensive use of antibiotics brings problems such as bacterial drug resistance and drug residues, greatly increasing public health safety issues. In terms of prevention, although there are currently various vaccines against PRRSV in use, there are still certain problems in terms of safety and effectiveness. Moreover, PRRSV is one of the RNA viruses with the fastest known mutation rate and there are many strains, which results in the vaccines being unable to provide comprehensive and effective protection for pig herds. The emergence of highly pathogenic PRRSV strains in recent years has dealt a heavy blow to the pig industry.

[0004] The nucleocapsid (N) protein of PRRSV is a structural protein necessary for virus assembly and maturation, and is also the most conserved protein among different strains. The N protein binds to the viral genome, packages the viral genome and maintains the assembly structure of the virus. Specific antibodies against the N protein have been proven to effectively inhibit virus proliferation. However, the development cycle of traditional antibodies (such as monoclonal antibodies, nanobodies, etc.) is long and the steps are cumbersome, making it difficult to cope with the rapid mutation of the virus. The relatively high cost also limits their application in the breeding industry.

[0005] Mini-binder is a new type of macromolecular drug between antibodies and small molecule drugs, and has become a hot topic in new drug research and development in recent years because it combines the advantages of antibodies and small molecules. Mini-binders designed against specific targets using de novo protein design have high specificity and affinity, thus achieving the blockade of pathogen invasion or the regulation of host signaling pathways. At the same time, mini-binders have a small molecular weight, high stability, stronger permeability than traditional antibodies, etc., and almost no immunogenicity; mini-binders can also be directly expressed by Escherichia coli, supporting rapid screening and iterative optimization, effectively reducing the research and development and production costs. Therefore, mini-binders are ideal alternatives to antibodies. Summary of the Invention

[0006] To solve the problems in the background art, the present invention provides a mini-binder targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein, a mini-binder composition and its application. The mini-binder or mini-binder composition can inhibit the proliferation of PRRSV and has a good inhibitory effect on PRRSV. The technical solution of the present invention to solve the above technical problems is as follows: In a first aspect, the present invention provides a mini-binder targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein. The mini-binder is selected from binder-1, binder-2 or binder-3. The sequence of binder-1 contains the amino acid sequence shown in SEQ ID NO: 1, the sequence of binder-2 contains the amino acid sequence shown in SEQ ID NO: 2, and the sequence of binder-3 contains the amino acid sequence shown in SEQ ID NO: 3.

[0007] According to the above scheme, binder-1, binder-2 and binder-3 also include tag sequences, restriction enzyme site sequences or signal sequences related to expression and purification located upstream or downstream of the sequence.

[0008] In a second aspect, the present invention provides a mini-binder composition targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein, including at least two of the above binder-1, binder-2 and binder-3.

[0009] According to the above scheme, the composition at least includes binder-2.

[0010] In a third aspect, the present invention provides the application of the above mini-binder targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein or the mini-binder composition targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein in the preparation of drugs for treating PRRSV infection.

[0011] In a fourth aspect, the present invention provides a drug for treating PRRSV infection, comprising the above-mentioned mini-antibody targeting the PRRSV nucleocapsid (N) protein, or a mini-antibody composition targeting the PRRSV nucleocapsid (N) protein.

[0012] According to the above scheme, the drug for treating PRRSV infection further comprises an optional pharmaceutically acceptable excipient.

[0013] According to the above scheme, the PRRSV includes CH-1a strain, WUH3 strain and FJZ03 strain.

[0014] The beneficial effects of the present invention are as follows: the mini-antibody or mini-antibody composition of the present invention can target the nucleocapsid (N) protein of PRRSV, specifically bind to the nucleocapsid (N) protein of PRRSV to form a stable complex, prevent the normal formation of the PRRSV virus capsid, make the virus lose the genomic protective shell and infectivity, thereby inhibiting the proliferation of PRRSV virus. It has a good inhibitory effect on PRRSV and can provide a feasible targeted drug for PRRSV infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Schematic diagram of the predicted interaction between different mini-antibodies and nucleocapsid (N) protein in Example 1 of the present invention; Figure 2 Protein gel electrophoresis results of binder-1, binder-2 and binder-3 purified in Example 2 of the present invention; Figure 3 Circular dichroism results of binder-1, binder-2 and binder-3 purified in Example 2 of the present invention; Figure 4 Confocal images of the localization of different mini-antibodies in the cytoplasm in Example 3 of the present invention; Figure 5 Bio-layer interferometry experimental result graph of different mini-antibodies in Example 3 of the present invention; Figure 6 Cytotoxicity detection results of different mini-antibodies in Example 3 of the present invention; Figure 7 Inhibitory effects of different mini-antibodies on different PRRSV strains in Marc-145 cells in Example 3 of the present invention; Figure 8 Inhibitory effects of different mini-antibodies on different PRRSV strains on primary porcine alveolar macrophages in Example 3 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0016] The principles and features of the present invention will be described below in conjunction with the accompanying drawings and specific embodiments. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0017] The present invention uses the nucleocapsid (N) protein of porcine reproductive and respiratory syndrome virus (PRRSV) as the target protein, and designs and screens multiple mini-binders (binder-1, binder-2, and binder-3) targeting the nucleocapsid (N) protein of PRRSV, and their sequences respectively include the amino acid sequences shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3. The mini-binder or mini-binder composition of the present invention can target the nucleocapsid (N) protein of PRRSV, specifically bind to the nucleocapsid (N) protein of PRRSV, prevent the normal formation of the PRRSV virus capsid, thereby causing the virus to lose the genomic protective shell and infectivity, and inhibiting the proliferation of PRRSV virus.

[0018] Furthermore, based on the above multiple mini-binders, a mini-binder composition is provided, which includes at least two of the above mini-binders.

[0019] The mini-binder or mini-binder composition of the present invention has a good inhibitory effect on a variety of PRRSV strains including PRRSV-2 (North American type) prevalent in China. The present invention takes the PRRSV-2 strains including the classical CH-1a strain, the highly pathogenic WUH3 strain, and the NADC30-like FJZ03 strain as examples for illustration. The results show that the mini-binder or mini-binder composition of the present invention has a significant inhibitory effect on the widely prevalent classical CH-1a strain, the highly pathogenic WUH3 strain, and the NADC30-like FJZ03 strain.

[0020] Specifically, the above mini-binder can be obtained by artificial synthesis or by genetic engineering methods. For example, the coding nucleotides of the binder are biosynthesized and expressed and purified through Escherichia coli to obtain the binder protein.

[0021] Those skilled in the art know that adding one or several amino acids, such as adding a tag sequence, a cleavage site sequence, a signal sequence, or a secretion signal sequence, to the C-terminus and / or N-terminus of a protein usually does not change the function of the resulting protein. Therefore, the mini-binder of the present invention may also include a tag sequence, a cleavage site sequence, a signal sequence, or a secretion signal sequence.

[0022] The following are specific embodiments.

[0023] Example 1 Design of Mini-binder (1) Design and screening of mini-binders targeting the nucleocapsid (N) protein of PRRSV Predict the three-dimensional structure of the nucleocapsid (N) protein of PRRSV, analyze the hydrophobicity of the surface of the target protein, use the hydrophobic region as the binding interface of the minibody, and preliminarily design and obtain the amino acid sequence of the minibody. Further, through molecular dynamics simulation, analyze the stability of the complex formed by the designed minibody and the target protein, as well as the intermolecular interactions. Combining its hydrophobicity, conformational stability, and affinity for the target protein, etc., design and screen to finally obtain 3 minibody sequences, named binder-1, binder-2, and binder-3 respectively, and their amino acid sequences are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3 respectively.

[0024] Table 1

[0025] Figure 1 Schematic diagrams of the predicted interactions between different minibodies and the nucleocapsid (N) protein, showing representative hydrogen bonds between the proteins, where the binding domain of the nucleocapsid (N) protein is brown. As shown in the figure, multiple amino acids of the two proteins in each nucleocapsid (N) protein-minibody complex participate in the formation of hydrogen bonds. Among them, ARG13, ARG21, and ARG46 of the nucleocapsid (N) protein form stable multiple hydrogen bonds, indicating that these three amino acids of the nucleocapsid (N) protein are important targets for minibody design. Both ARG13 and ARG21 on the nucleocapsid (N) protein monomer can form two hydrogen bonds with adjacent GLU on the minibody; ARG46 on the nucleocapsid (N) protein not only forms a hydrogen bond with GLU of the minibody, but also forms a hydrogen bond with HIS on the minibody, such as HIS52 on binder-2. In addition, in the captured conformations of the nucleocapsid (N) protein-minibody complexes (binder-1 / binder-2 / binder-3), there are 9, 6, and 7 residues on the nucleocapsid (N) protein respectively, which form hydrogen bonds with 10, 6, and 8 residues on the minibody.

[0026] Example 2 Expression of minibody (1)The gene sequences of the above-mentioned binder-1, binder-2, and binder-3 were synthesized by Sangon Biotech Co., Ltd.

[0027] (2)Amplify the above gene sequences by PCR, and batch clone the gene sequences into the pET-22b vector without enzymes, and verify by colony PCR.

[0028] Among them, the coding nucleotide sequences of binder-1, binder-2, and binder-3 are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6 respectively.

[0029] SEQ ID NO:4 GATGTTAAAGAAAGGGTAAAGAAATTACTAAAGAAAGCGAAAAAAATCGAAGATCCGAAAAAGGCGCGTAAGGTGCTTCACGAAGCGGCTGAGCTGGTGCACAAATACAACGACGAAGAACTCTTGGAATTGGTGTTGGAGGTTCTGCAAGAACTG SEQ ID NO:5 TCCAAAGAGGAAAAGCGTATTCGTCGTCTCCTGAAACGTGCGAAACATATTCAAGATGAAGAGGAGGCGCGTAAACTGCTTAAGAAGGCTATGCAGCTGGCGCGCAAGGCTAATGACCCAAAACTGTTAGAGCTGGTTGCAAGAGTCTTTGAGCACCTG SEQ ID NO:6 GATGTTAAAGAACTGTTGGAGAAGGCGGTTGAGCTCTTGTTCGAAGGCAACCCGGAAGAGGCTGAAAAGGTGCTGCGCAAGGCGATCCGCTTAGCCCGTAAGCGCGGTGACCCGGAATTGCTGCGTGATCTGCGTAGATGGCTGCGTCGCGTCGAG The above sequences were cloned into the pET-22b vector using the enzyme-free cloning technique. The amplification primers for binder-1, binder-2, and binder-3 are shown as B1-F, B1-R, B2-F, B2-R, B3-F, and B3-R respectively, and the specific sequences are shown in Table 2 below.

[0030] Table 2

[0031] (3) The constructed pET-22b-binder-1 vector, pET-22b-binder-2 vector, and pET-22b-binder-3 vector were respectively transformed into E. coli BL21(DE3) for expression. Specifically, take BL21 competent cells and plasmids, thaw and mix them on ice, perform heat shock transformation on the mixture, spread the plate and pick single colonies, transfer them to a bacterial flask containing LB with Amp resistance for culture, add IPTG for induction, culture at 16 °C, perform ultrasonic disruption, and verify whether the target protein exists according to the bands.

[0032] (4)Purified by Ni column to obtain mini - adhesin binder - 1, binder - 2 and binder - 3.

[0033] The results of SDS - PAGE of the purified binder - 1, binder - 2 and binder - 3 are as Figure 2 shown. Lane M is the Marker band. The size of the mini - adhesin is about 6 kDa, which is consistent with the SDS - PAGE result, and the band is clean, indicating that the mini - adhesin is correctly expressed and purified.

[0034] Example 3 Performance Analysis of Mini - adhesin 1. Thermal Stability of Mini - adhesin The thermal stabilities of binder - 1, binder - 2 and binder - 3 proteins were analyzed by circular dichroism spectroscopy. Briefly, the mini - adhesin was dissolved in phosphate buffer (70 mM K2HPO4, 30 mM KH2PO4, pH 7.4) to a final concentration of 0.5 mg / mL, and the detection wavelength was from 260 nm to 190 nm. When detecting, the temperature of the protein solution was set to rise from 25 °C to 95 °C and then decrease to 25 °C. Figure 3 The circular dichroism spectra of the mini - adhesin at different temperatures (green at 25 °C; red at 95 °C; blue from 95 °C to 25 °C) and the circular dichroism signal at 222 nm as a function of temperature are shown. The results show that the mini - adhesin has two negative peaks at 208 nm and 222 nm, indicating that the secondary structure of the mini - adhesin is α - helix, and its spectrum conforms to the design expectation. When the temperature rises to 95 °C, the α - helix remains unchanged, and its ellipticity changes little with the increase of temperature. In summary, it shows that the mini - adhesin (binder - 1, binder - 2 and binder - 3) is highly thermostable.

[0035] 2. Analysis of the Membrane Permeability of Mini - adhesin Protein The original design of the mini - adhesin is to target the assembly of viral capsid proteins (the main site is the cytoplasm). Therefore, the above - mentioned mini - adhesin was labeled with FITC for the membrane permeability experiment, and a confocal microscope was used to observe the fluorescence position and intensity to analyze the membrane permeability of the mini - adhesin.

[0036] (1)Label the mini - adhesin with FITC: Mix the mini - adhesin solution (1 mg / mL) with the FITC solution (dissolved in DMSO) at a mass ratio of 1:50. The mixed solution was incubated in the dark at room temperature for 8 h, then 5 M NH4Cl was added to a final concentration of 50 mM, and it was placed at 4 °C for 2 h to terminate the reaction. An ultrafiltration centrifugal tube was used to remove the unreacted fluorescent dye and concentrate the protein solution.

[0037] (2)Add mini - adhesin - FITC to Marc - 145 cells to a final concentration of 1 μM. After incubation for 4 h, wash three times with PBS and fix with 4% paraformaldehyde. DAPI is used for nuclear staining, and fluorescence is observed using a fluorescence confocal microscope.

[0038] The results of the confocal images are as Figure 4 shown. Both binder - 1, binder - 2, and binder - 3 can penetrate the cell membrane and enter the cytoplasm.

[0039] 3. Analysis of the binding affinity between mini - adhesin and PRRSV nucleocapsid (N) protein The bio - layer interferometry (BLI) was used to analyze the binding affinity between mini - adhesin and the structural domain of PRRSV nucleocapsid (N) protein. The specific steps are as follows: (1)Add an Avi - tag when expressing the nucleocapsid (N) protein. Dissolve the expressed protein in 8 M urea for denaturation, and then renature it in a solution of 0.78 M urea and 50 mM Tris. (2)Biotinylate the nucleocapsid (N) protein with an Avi - tag and incubate it in the binding buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 3 mM EDTA, 0.05% Tween 20, 1% BSA) for 15 min to immobilize it on the SSI sensor. Mini - adhesin is serially diluted with the binding buffer to different concentrations for detection. The sensor probe is inserted into the buffer to measure the baseline, then into the mini - adhesin solution for binding, and then back into the buffer for dissociation. Data analysis is performed using Octet Analysis Studio v.13.0.1.35.

[0040] The results of the bio - layer interferometry are as Figure 5 shown. Both binder - 1, binder - 2, and binder - 3 can bind to the target protein. The dissociation constants (K d ) are 32.22 μM, 24.01 μM, and 41.32 μM respectively. The K d value is inversely proportional to the binding affinity. The smaller the K d value, the stronger the intermolecular interaction (the higher the affinity). The results show that both mini - adhesin binder - 1, binder - 2, and binder - 3 have good affinities, and binder - 2 has the highest affinity.

[0041] 4. Analysis of the in vitro anti - PRRSV activity of mini - adhesin Cell experiments were conducted using Marc-145 cells or primary porcine alveolar macrophages (PAMs) to evaluate the antiviral activities of the above-mentioned binder-1, binder-2, binder-3, and the compositions of at least two of the above-mentioned binders against the classical CH-1a strain, highly pathogenic WUH3 strain, and NADC30-like FJZ03 strain of PRRSV.

[0042] The specific experimental steps were as follows: Marc-145 cells or primary porcine alveolar macrophages (PAMs) were plated in 96-well plates. After the cells grew to confluence or adhered stably, the classical CH-1a strain, highly pathogenic WUH3 strain, and NADC30-like FJZ03 strain of PRRSV were inoculated respectively, with a multiplicity of infection (MOI) of 1. After incubation at 4 °C for 1 h to ensure complete virus adsorption, the medium containing the virus was discarded, and the cells were washed 3 times with PBS. Different gradient dilutions of mini-vaccines (0.3 μM, 0.6 μM, 1.2 μM, 2.4 μM, 4.8 μM) or tylvalosin tartrate (0.15 μM, 0.3 μM, 0.6 μM, 1.2 μM, 2.4 μM, 5 μM) were added to the cells respectively, and the cells were cultured for another 48 h. Absolute quantitative PCR (qPCR) was used to detect the copy number of the viral gene (a standard curve of the PRRSV viral gene had been established previously, y = 34.739 - 3.0689x), the inhibition rate of the mini-vaccine against the virus was calculated, and the IC 50 .

[0043] (1) According to the above experimental procedure, without inoculating PRRSV, the cytotoxicity of different concentrations of mini-vaccines against Marc-145 cells was determined. The results of the cell survival rate were as Figure 6 shown, indicating that the designed mini-vaccines (binder-1, binder-2, and binder-3) had no cytotoxicity within the tested concentration range.

[0044] (2) To evaluate the inhibitory effect of the mini-vaccines designed in the present invention against PRRSV, tylvalosin tartrate, a commonly used drug in pig farms, was selected as the positive compound, and the inhibitory effects of different mini-vaccines on different strains of PRRSV in Marc-145 cells under the same experimental conditions were tested. The results were as Figure 7As shown, the overall mini-antibody inhibition rate curve we designed is more towards the upper right compared to acetylisovaleryl tylosin tartrate, indicating that the therapeutic effect of the mini-antibody is better than that of the positive compound. Binder-1, binder-2, and binder-3 on CH-1a strain, WUH3 strain, and FJZ03 strain of IC 50 As shown in Table 3: Table 3

[0045] The results showed that binder-1, binder-2, and binder-3 could significantly inhibit the proliferation of PRRSV CH-1a strain, WUH3 strain, and FJZ03 strain in Marc-145 cells. Among them, binder-2 had the strongest inhibitory effect, and the IC 50 values for the above three strains were 44 nM, 153 nM, and 40 nM respectively. When the concentration of binder-2 was 1.2 μM, its inhibition rates on PRRSV CH-1a strain, WUH3 strain, and FJZ03 strain were 100%, 92.33%, and 96.67% respectively; when the concentration of binder-2 was 2.4 μM, its inhibition rates on PRRSV CH-1a strain, WUH3 strain, and FJZ03 strain were 100%, 96.67%, and 98.33% respectively.

[0046] (3)The inhibition of different mini-antibodies on different strains of PRRSV on primary porcine alveolar macrophages (PAMs) was as follows Figure 8 As shown, the IC 50 of binder-1, binder-2, and binder-3 on CH-1a strain, WUH3 strain, and FJZ03 strain was as shown in Table 4: Table 4

[0047] The results showed that binder-1, binder-2, and binder-3 could significantly inhibit the proliferation of PRRSV CH-1a strain, WUH3 strain, and FJZ03 strain in primary porcine alveolar macrophages (PAMs). Among them, binder-2 had the strongest inhibitory effect, and the IC 50 values for the above three strains were 70 nM, 295 nM, and 175 nM respectively. (4)The mini-virion composition consisting of binder-1 and / or binder-2 and / or binder-3 of the present invention has good inhibitory effects on PRRSV CH-1a strain, WUH3 strain and FJZ03 strain in Marc-145 cells. It also has good inhibitory effects on PRRSV CH-1a strain, WUH3 strain and FJZ03 strain on primary porcine alveolar macrophages (PAMs).

[0048] Taking the combinations of binder-1 and binder-2 and the combination of binder-2 and binder-3 as examples, the anti-PRRSV (CH-1a strain, WUH3 strain and FJZ03 strain) activity of the mini-virion composition in Marc-145 cells will be described below.

[0049] Four combinations are set, namely combination A, combination B, combination C and combination D, and their compositions are shown in Table 5 below.

[0050] Table 5

[0051] Among them, "+" means added, and "-" means not added Detect the inhibition rates (%) of the above combinations A, B, C and D on PRRSV CH-1a strain, WUH3 strain and FJZ03 strain in Marc-145 cells. Set 3 parallels for each group and take the average value. The results are shown in Table 6.

[0052] Table 6

[0053] The results show that combinations A, B, C and D all have good inhibitory effects on PRRSV CH-1a strain, WUH3 strain and FJZ03 strain.

[0054] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A miniaturized adhesin targeting the porcine reproductive and respiratory syndrome virus (PRRSV) nucleocapsid (N) protein, characterized in that, The mini - adhesin is selected from binder - 1, binder - 2 or binder - 3. The binder - 1 sequence contains the amino acid sequence shown in SEQ ID NO:

1. The binder - 2 sequence contains the amino acid sequence shown in SEQ ID NO:

2. The binder - 3 sequence contains the amino acid sequence shown in SEQ ID NO:

3.

2. The miniaturized adhesin targeting the PRRSV nucleocapsid (N) protein according to claim 1, characterized in that, The binder - 1, binder - 2 and binder - 3 further include tag sequences, cleavage site sequences or signal sequences related to expression and purification located upstream or downstream of the sequence.

3. A miniaturized adhesin composition targeting the PRRSV nucleocapsid (N) protein, characterized in that, It includes at least two of binder - 1, binder - 2 and binder - 3 described in claim 1 or 2.

4. The miniaturized adhesin composition targeting the PRRSV nucleocapsid (N) protein according to claim 3, characterized in that, The composition at least includes binder - 2.

5. Use of the mini - adhesin targeting the PRRSV nucleocapsid (N) protein described in claim 1 or 2 in the preparation of a drug for treating PRRSV infection.

6. Use of the mini - adhesin composition targeting the PRRSV nucleocapsid (N) protein described in claim 3 or 4 in the preparation of a drug for treating PRRSV infection.

7. A drug for treating PRRSV infection, characterized in that, It includes the mini - adhesin targeting the PRRSV nucleocapsid (N) protein described in claim 1 or 2, or the mini - adhesin composition targeting the PRRSV nucleocapsid (N) protein described in claim 3 or 4.

8. The medicament for treating PRRSV infection according to claim 7, wherein, It further includes optionally pharmaceutically acceptable excipients.

9. The medicament for treating PRRSV infection according to claim 7 or 8, characterized in that, The PRRSV includes CH - 1a strain, WUH3 strain and FJZ03 strain.

Images