A recombinant rabbit monoclonal antibody specifically recognizing VP56 protein of grass carp reovirus type II and application thereof
The recombinant monoclonal antibody IC5 was prepared using single B cell screening technology and HEK293 cell expression system, which solved the problem of lack of prevention and detection methods for grass carp reovirus type II. It achieved efficient and stable antibody preparation and rapid detection, which is suitable for immunological and biological research.
Patent Information
- Application Number
- CN202510780585.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-11
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2045-06-11
AI Technical Summary
Current technologies lack effective vaccines or drugs for the prevention and control of grass carp reovirus type II (GCRV-II), and there is a lack of rapid detection methods. Traditional monoclonal antibody preparation methods have low yields and unstable quality, making it difficult to meet research and diagnostic needs.
Recombinant monoclonal antibodies were prepared by using rabbits to generate specific antibodies through single B cell screening technology. High-titer recombinant monoclonal antibody IC5 was screened using HEK293 cell expression system and ELISA titer detection. The antibody with high specificity and stability against GCRV-II VP56 protein was obtained by expressing it through a recombinant vector.
This study achieved efficient and stable preparation of recombinant monoclonal antibodies against GCRV-II VP56 protein, improving antibody yield and quality consistency, providing a rapid detection method, and enhancing the specific recognition ability of the virus, making it suitable for immunological and biological research.
Smart Images

Figure HDA0005445577370000011 
Figure HDA0005445577370000012 
Figure HDA0005445577370000021
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of antibody preparation, and particularly relates to a recombinant rabbit monoclonal antibody specifically recognizing type II grass carp reovirus VP56 protein and application thereof. BACKGROUND
[0002] Type II grass carp reovirus (GCRV) is the main pathogen causing the outbreak of grass carp hemorrhagic disease, which causes extremely high mortality in grass carp and also causes extensive infection and death in blue carp fry, and has a highly seasonal epidemic characteristic. During the latent infection period, GCRV-II can only be detected in the brain tissue of grass carp, and under natural infection conditions, the viral load in the brain tissue and eye tissue is also relatively high. However, there is still no effective vaccine or drug that can be used for the prevention and treatment of GCRV-II, and there is also no rapid detection method in practical production and application.
[0003] VP56, as one of the most important surface fiber proteins of GCRV-II, is encoded by the virus S7 segment, participates in the cell attachment process, hinders the initial immune function of RIG-I through the double mechanism of blocking and degradation, weakens its recognition of viral RNA signal transduction, and further weakens the downstream signal transduction and interferon response, so that the corresponding host antiviral effectors are reduced, and the cytopathic effect is increased. At the same time, it can also play a synergistic effect with VP4 outer coat protein, more effectively weaken the interferon and antiviral effectors, and help the virus escape. In recent years, great progress has been made in the pathogenesis and host immune response of GCRV-II, but there is still a lack of key antibodies, which hinders further research.
[0004] Monoclonal antibodies have high specificity and sensitivity, and can be widely used in basic research of virus transcription, replication, antigen mechanism, etc., and can also be used as diagnostic preparations for clinical detection and diagnosis. Monoclonal antibodies prepared by classical hybridoma technology depend on purification from mouse ascites, and the yield of antibodies is generally low, and the quality of each batch also has differences.
[0005] And the recombinant monoclonal antibody obtained by single B cell screening technology is produced in a recombinant expression system, avoiding the use of experimental animals to produce antibodies, so that the yield and quality are consistent between batches, the antibody level is stable, and the repeatability is good. SUMMARY
[0006] In view of the deficiencies of the prior art, the purpose of the present application is to provide an anti-GCRV-II VP56 protein high-affinity recombinant monoclonal antibody and its application, the light chain variable region of the monoclonal antibody is shown as SEQ ID NO. 3, and the heavy chain variable region is shown as SEQ ID NO. 1. The recombinant antibody has a clear gene structure, high specificity, strong stability, and high sensitivity in multiple detection methods.
[0007] Another purpose of the present application is to provide the application of the above-mentioned monoclonal antibody in the preparation of a GCRV-II detection kit.
[0008] The above technical purposes of the present application are realized by the following technical solutions, specifically as follows:
[0009] The S7 sequence of grass carp reovirus type II is synthesized and used to immunize experimental animals rabbits through a HEK293 cell eukaryotic expression system, the rabbits are used to produce excellent antibodies against the antigen by taking advantage of the specificity and diversity of the antibodies of the rabbits, the specific antisera produced by the rabbits are collected and subjected to ELISA titer detection, the peripheral blood and spleen B cells are extracted after positive immune response, enrichment screening is carried out, and single-hole single-B-cell culture proliferation and antibody secretion are achieved through limited gradient dilution, the supernatant is detected to determine positive B cell clones, the heavy and light chain sequences of the positive B cell antibodies are copied out through molecular amplification, and the sequences are constructed into an expression vector for in-vitro recombinant expression to obtain a positive recombinant monoclonal antibody IC5.
[0010] The amino acid sequence of the light chain variable region of the monoclonal antibody is shown as SEQ ID NO. 3, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO. 1.
[0011] The protection scope of the present application also includes the coding genes of the light chain variable region and the heavy chain variable region of the above-mentioned monoclonal antibody.
[0012] The coding genes are preferably the coding gene of the light chain variable region protein shown as SEQ ID NO. 4 and the coding gene of the heavy chain variable region protein shown as SEQ ID NO. 2.
[0013] The expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the above-mentioned coding gene combination.
[0014] The application of the above-mentioned monoclonal antibody, the coding gene or the expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the above-mentioned coding gene in the preparation of a GCRV-II detection kit.
[0015] The application of the monoclonal antibody, the coding gene or the expression cassette with the coding gene, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell in the preparation of a VP56 protein detection kit of GCRV-II.
[0016] A rabbit-derived recombinant monoclonal antibody capable of specifically recognizing the VP56 protein of grass carp reovirus type II, wherein the amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO. 8, and the amino acid sequence of the heavy chain is shown in SEQ ID NO. 7.
[0017] Coding genes of the light chain and the heavy chain of the monoclonal antibody.
[0018] The coding genes, preferably, the coding gene of the light chain is shown in SEQ ID NO. 6, and the coding gene of the heavy chain is shown in SEQ ID NO. 5.
[0019] An expression cassette, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell with the combination of the coding genes.
[0020] The application of the monoclonal antibody, the coding gene or the expression cassette with the coding gene, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell in the preparation of a GCRV-II detection kit.
[0021] Compared with the prior art, the application has the following beneficial effects:
[0022] The VP56 recombinant protein is successfully prepared, and the New Zealand white rabbits are immunized by taking the VP56 recombinant protein as an immunogen, so that the B cells in the white rabbits proliferate and differentiate into plasma cells, and the specific antibodies against the VP56 protein are secreted, and a recombinant rabbit monoclonal antibody capable of specifically recognizing the VP56 protein of grass carp reovirus type II is obtained through a single B cell antibody screening technology, and the gene engineering antibody is verified to have a high titer and affinity and a specific recognition ability for the natural protein VP56 through ELISA, immunofluorescence and protein immunoblotting experiments.
[0023] The method for obtaining the recombinant monoclonal antibody provided by the application has high efficiency and can quickly complete the antibody screening work. The antibody gene structure is clear, active and stable, and compared with the traditional monoclonal screening method, the number of cells required is small, the yield of the obtained antibody is large, time and cost are saved. At the same time, a new type of grass carp antibody is added, which provides a new idea and implementation route for the production and preparation of the antibody, and is widely applied in immunology, biology and other related fields. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 VP56 protein purification and identification results.
[0025] Figure 2The results of ELISA detection titer of rabbit serum.
[0026] Figure 3 The results of ELISA detection titer of monoclonal antibody IC5.
[0027] Figure 4 The results of SDS-PAGE verification of recombinant monoclonal antibody 1C5 after purification
[0028] Wherein: lane IN is the sample stock solution, FT is the flow-through sample, M is Marker, W is the washing liquid, and E is the eluent.
[0029] Figure 5 The WB identification diagram of recombinant monoclonal antibody 1C5.
[0030] Wherein: lane 1 is the grass carp brain tissue protein sample infected with GCRV-II, lane 2 is the healthy grass carp brain tissue sample, and lane 3 is the grass carp gill tissue protein sample infected with GCRV-II.
[0031] Figure 6 The immunofluorescence diagram of recombinant monoclonal antibody 1C5 detecting grass carp brain tissue sections. DETAILED DESCRIPTION
[0032] The technical solutions of the present application are clearly and completely described in the following content combined with the embodiments and the drawings, so that those skilled in the art can fully understand the present application. The embodiments are only to help understand the present application and should not be regarded as specific limitations of the present application. Of course, the embodiments are only used to explain a part of the preferred embodiments of the present application, and are not used to explain the whole scope of the present application. Improvements or replacements made to the specific embodiments of the present application without departing from the scope and spirit of the present application shall fall within the scope of the present application.
[0033] In the following examples, the specific techniques or conditions not specified are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions. The reagents or instruments not specified by the manufacturer are all conventional products that can be commercially available through regular channels.
[0034] Example 1:
[0035] Preparation of anti-grass carp GCRV-II VP56 recombinant rabbit monoclonal antibody:
[0036] 1.1 Cloning of GCRV-II S7 gene
[0037] According to the GCRV YX246 strain S7 gene sequence (gene accession number: PQ553632.1) design specific primers, upstream primer: GA GCCTCTCCCTGTCTCCGGGTGCACCTGTGCCTGTGTCCGCTCTGAGAACCCCACCTGT, downstream primer: TT ATTAGCCAGAGGTCGAGGTCGGGTCAGGAAGGGGGGGGCCAGTATCTTGTCAGCTTGT. The synthesized S7 gene sequence as a template, using the above primers PCR amplification of GCRV-II S7 gene, amplified fragments by Hind III and BamH I enzyme cutting site and pTT5 vector, get recombinant expression vector S7-pTT5.
[0038] 1-2 μl of recombinant expression vector S7-pTT5 was transformed into TOP10 competent cells, ice for 30 minutes, then 42℃ water bath heat activation for 90 seconds, adding ampicillin resistance medium, in 37℃ constant temperature incubator culture, picking colonies, sequencing identified to obtain the positive plasmid containing the target gene.
[0039] 1.2 Expression and purification of VP56 protein
[0040] The positive plasmid obtained above was transfected into HEK293 cells (1.5-2.0 x 10 6 cells / ml) for protein expression, which was cultured at 37℃, 130 rpm / min for 6 days. The culture supernatant was collected and centrifuged at high speed, and then filtered through a 0.22 μm filter membrane.
[0041] The Protein A affinity chromatography column was pre-equilibrated with PBS, and then the filtered culture supernatant was combined with Protein A. The washing solution (PBS, pH = 7.4) was added to wash until no protein flowed out. Then the elution solution (0.1 M glycine, pH = 3.0) was added to wash until no protein flowed out. Finally, the neutralization solution (1 M Tris-Cl, pH = 8.5) was added to wash until no protein flowed out.
[0042] The elution solution sample was collected to obtain the recombinant protein VP56, which was subjected to SDS-PAGE to detect the protein purity. The detection result was consistent with the predicted size of the target protein, which was 70.7 Kda Figure 1 ), and a total of 3.5 mg of protein was obtained.
[0043] 1.3 Animal immunization
[0044] Two 4-month-old healthy female New Zealand white rabbits were selected as immunized animals, and the recombinant protein VP56 prepared in step 1.2 was used as an immunogen to immunize the New Zealand white rabbits. 200 μg of VP56 protein was mixed with an equal volume of complete Freund's adjuvant to emulsify, and multiple point injections were performed on the back of the rabbit subcutaneously. The second boost was performed 14 days later, using 200 μg of VP56 protein mixed with an equal volume of incomplete Freund's adjuvant to emulsify, and multiple point injections were performed on the back of the rabbit subcutaneously. The boost was performed every 14 days, and the same volume of immunogen was used to repeat the operation until a total of 5 immunizations were performed. The serum titer was determined by ELISA 7 days after the last 5 immunizations.
[0045] 1.4 Anti-serum titer detection
[0046] The GCRV-II recombinant VP56 protein obtained in step 1.2 was diluted to 2 μg / ml with 0.05 mol / L carbonate (pH = 9.6) as an antigen, and was coated into an ELISA plate, 100 μl was added to each well, and was incubated at 4°C overnight; the antigen was discarded, the ELISA plate was washed with PBST containing 0.05% Tween-20 for 3 times, 3 minutes each time, 150 μl of PBST containing 5% skimmed milk powder was added to each well, and was blocked at 37°C for 1 hour; the blocking solution was discarded, the ELISA plate was washed with PBST for 3 times, 3 minutes each time, the collected serum was diluted according to 1:1000, and was further diluted by a ratio, 100 μl was added to each well, and was incubated at 37°C for 1 hour. PBS was set as a negative control at the same time; the antibody was discarded, the ELISA plate was washed with PBS T for 3 times, 3 minutes each time, a horseradish enzyme-labeled goat anti-rabbit IgG (H+L) (Jackson) was diluted according to 1:8000 as a secondary antibody, 100 μl was added to each well, and was incubated at 37°C for 45 minutes; the antibody was discarded, the ELISA plate was washed with PBST for 5 times, 3 minutes each time, 100 μl of substrate solution (TMB) was added to each well, and was reacted for 5-10 minutes, 100 μl of 2 mol / L sulfuric acid was finally added to each well to terminate the reaction; then the OD value was detected, an enzyme label instrument (Kewei ST-360) was used to determine the OD value at 450 nm wavelength, and the serum titer was ≥1024000( Figure 2 )。
[0047] 1.5 B lymphocyte acquisition and identification
[0048] The white rabbit B with high serum titer was selected, the B cells were isolated from the spleen under sterile condition, the cells were washed twice, each time with 50 ml of washing solution, centrifuged at 1500 rpm for 5 minutes, the supernatant was discarded, and the B cells were collected. The collected B cells were counted and subjected to limited dilution, and the cells were plated in a 96-well plate and cultured in the culture medium (Mabisol). The supernatant was collected on day 15, and the ELISA detection was performed according to the method in step 1.4 above. The antibody titer of the supernatant corresponding to each B cell was detected, and the detection results are shown in Table 1. The supernatant of the single cell culture was subjected to ELISA detection, and the OD value of the 1C5 antibody was the highest (marked with an underline). 450
[0049] Table 1. ELISA detection of specific B cell antibodies
[0050] Antibody No. OD 450 values Antibody No. OD 450 values Antibody No. OD 450 values Antibody No. OD 450 value 1A1 0.13 1A4 0.098 1A6 0.131 1A8 0.117 1B1 0.105 1B4 0.091 1B6 0.097 1B8 0.095 1C1 0.097 1C4 0.079 1C6 0.078 1C8 0.08 1D1 0.102 1D4 0.069 1D6 0.068 1D8 0.079 1E1 0.184 1E4 0.073 1E6 0.07 1E8 0.077 1F1 0.118 1F4 0.087 1F6 0.08 1F8 0.074 1G1 0.12 1G4 0.089 1G6 0.084 1G8 0.085 1H1 0.145 1H4 0.1 1H6 0.105 1H8 0.103 1A2 0.108 1A5 0.106 1A7 0.185 1A9 0.136 1B2 0.228 1B5 0.088 1B7 0.097 1B9 0.108 1C2 0.086 1C5 0.254 1C7 0.087 1C9 0.087 1D2 0.078 1D5 0.074 1D7 0.203 1D9 0.082 1E2 0.079 1E5 0.089 1E7 0.075 Positive control 2.96
[0051] The single B cell corresponding to the antibody 1C5 was sequenced. After extracting the cell RNA, the cDNA was reverse transcribed and amplified. The upstream primer for amplifying the heavy chain (including the constant region and the variable region) was GGTACCGAGCTCGGATCCATGGAGACTG, and the downstream primer for amplifying the heavy chain was GCTGGATATCTGCAGAATTCTCATTTACCC. The amplified heavy chain gene sequence is shown in SEQ ID NO. 5, which contains the heavy chain variable region shown in SEQ ID NO. 2. The upstream primer for amplifying the light chain (including the constant region and the variable region) was GGTACCGAGCTCGGATCCATGGACACGA, and the downstream primer for amplifying the light chain was CACTGTGCTGGATATCTGCAGAATTCTCAGCAGTCA. The amplified light chain gene sequence is shown in SEQ ID NO. 6, which contains the light chain variable region shown in SEQ ID NO. 4.
[0052] In order to obtain the recombinant monoclonal antibody, the heavy chain gene and the light chain gene amplified in the above 1.5 step are respectively connected to the position of BamH I or ECOR I of the mammalian expression vector pcDNA3.1 by the method of homologous recombination, and the specific method is as follows: first, the vector pcDNA3.1 is subjected to enzyme cutting, and the enzyme cutting system is: pcDNA3.1 1 μg, enzyme cutting buffer 5 μl, BamH I 2 μl or EcoR I 2 μl; the reaction condition is: 37°C, 60 minutes. After enzyme cutting, recombination connection is carried out with the antibody heavy chain or the antibody light chain, and the connection system is: pcDNA3.1 4 μl, recombination enzyme 10 μl, the PCR product of the antibody heavy chain or the antibody light chain is 6 μl respectively; the connection is completed at 52°C water bath for 40 minutes. At the same time, verification is carried out, and the expression vector pcDNA3.1 carrying the full-length gene of the heavy chain and the expression vector pcDNA3.1 carrying the full-length gene of the light chain are respectively subjected to double enzyme cutting verification with BamHI and EcoRI to determine that the recombination constructed plasmid is correct, and the constructed plasmid is subjected to sequencing verification to determine that the inserted target antibody sequence is correct.
[0053] The successfully constructed expression vectors are co-transfected into HEK293 cells, and after the cells are cultured for 6 days, the cell culture supernatant is collected for protein purification. The specific protein expression and purification steps are referred to the above step 1.2, and the recombinant monoclonal antibody 1C5 is obtained. Figure 4 ).
[0054] After obtaining the recombinant antibody 1C5, the antibody is diluted according to the proportion, and the detection is carried out according to the ELISA method in the above step 1.4. The OD 450 values obtained by different dilution multiples are as shown in the table. Figure 3
[0055] Example 2:
[0056] Reactivity of rabbit-derived recombinant monoclonal antibody 1C5 with grass carp reovirus type II
[0057] 1. Western blot (WB) detection
[0058] The proteins of the brain tissue and the gill tissue of the grass carp infected with grass carp reovirus type II are extracted, and the proteins of the brain tissue of the grass carp not infected with grass carp reovirus type II are used as a control to prepare samples and carry out immunoblotting. The primary antibody is the rabbit-derived recombinant monoclonal antibody 1C5 prepared in Example 1 (1:1000), which is incubated at room temperature for 1 hour, and is washed with PBST for 4 times, each time for 5 minutes. The secondary antibody is HRP-labeled goat anti-rabbit IgG (H+L) (1:10000), which is incubated at room temperature for 40 minutes, and is washed with PBST for 4 times. Finally, color development is observed. At the same time, the sample incubated with the primary antibody of rabbit IgG is set as a negative control.
[0059] The WB results, as shown in Figure 5 Table 1, show that the rabbit-derived recombinant monoclonal antibody 1C5 prepared in the application can specifically recognize the VP56 protein of grass carp reovirus type II.
[0060] 2. Immunofluorescence (IF) detection:
[0061] The rabbit-derived recombinant monoclonal antibody 1C5 prepared in Example 1 was used for immunofluorescence analysis of the intestinal tissue sections of grass carp infected with grass carp reovirus type II, specifically as follows:
[0062] After fixing the tissue sections, the sections were repaired with a repair solution, washed with PBS twice for 5 minutes each time, dried, and then a circle was drawn on the slide using a group of histological pens, 0.3% Triton X-100 was added to each circle to break the membrane for 15 minutes, washed with PBS twice for 5 minutes each time, and then blocking solution was added for 30 minutes; the primary antibody was the rabbit-derived recombinant monoclonal antibody 1C5 prepared in Example 1 (diluted 1:100), and healthy grass carp intestinal tissue sections were set as negative controls, and Control Rabbit IgG was set as an ISO control, incubated overnight at 4°C, washed with PBS 4 times for 5 minutes each time; the secondary antibody was Cy3-labeled goat anti-rabbit IgG (H+L), incubated at room temperature for 40 minutes in the dark, washed with PBS 4 times for 5 minutes each time; DAPI dye (1:10) was used to stain the cell nucleus for 8 minutes, washed with PBS twice for 5 minutes each time; after sealing with an anti-fluorescence sealing agent, the fluorescence was observed under a fluorescence microscope.
[0063] The IFA results, as shown in Figure 6 Table 2, show that the rabbit-derived recombinant monoclonal antibody 1C5 described in the application can recognize grass carp reovirus type II in infected tissues.
[0064] The above only describes preferred embodiments of the application, and the protection scope of the application is not limited to this. It should be noted that, for those skilled in the art, without departing from the principles of the application, a number of improvements and modifications can be made, and these improvements and modifications should also be considered as the protection scope of the application.
Claims
1. A rabbit-derived recombinant monoclonal antibody specifically recognizing grass carp reovirus type II VP56 protein, wherein the amino acid sequence of the light chain variable region of the monoclonal antibody is shown in SEQ ID NO. 3, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.
1. 2.A gene encoding the light chain variable region and the heavy chain variable region of the monoclonal antibody of claim 1. 3.The gene of claim 2, wherein the gene encoding the light chain variable region is shown in SEQ ID NO. 4, and the gene encoding the heavy chain variable region is shown in SEQ ID NO.
2. 4.An expression cassette, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell having the gene of claim 2. 5.Use of the monoclonal antibody of claim 1, the gene of claim 2 or the expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the gene of claim 2 in the preparation of a detection kit for grass carp reovirus type II. 6.A rabbit-derived recombinant monoclonal antibody specifically recognizing grass carp reovirus type II VP56 protein, wherein the amino acid sequence of the light chain of the monoclonal antibody is shown in SEQ ID NO. 8, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.
7. 7.A gene encoding the light chain and the heavy chain of the monoclonal antibody of claim 6. 8.The gene of claim 7, wherein the gene encoding the light chain is shown in SEQ ID NO. 6, and the gene encoding the heavy chain is shown in SEQ ID NO.
5. 9.An expression cassette, a recombinant vector, a recombinant microorganism or an ex vivo recombinant cell having the gene of claim 7. 10.Use of the monoclonal antibody of claim 6, the gene of claim 7 or the expression cassette, the recombinant vector, the recombinant microorganism or the ex vivo recombinant cell having the gene of claim 7 in the preparation of a detection kit for grass carp reovirus type II.
Citation Information
Patent Citations
Hybridoma cell strain secreting GCRV VP4 protein monoclonal antibody and monoclonal antibody and application thereof
CN119735653A