Lactobacillus rhamnosus A21173 capable of inhibiting infection of multi-drug-resistant strains and clostridium difficile, resisting oxidation, resisting aging, prolonging life and improving cognition as well as product and application of lactobacillus rhamnosus A21173

Abstract

The invention discloses a lactobacillus rhamnosus A21174 for inhibiting infection of multiple drug-resistant strains and clostridium difficile and application of the lactobacillus rhamnosus A21174. The lactobacillus rhamnosus A21174 has an obvious inhibiting effect on drug-resistant staphylococcus aureus, pseudomonas aeruginosa, drug-resistant escherichia coli, drug-resistant acinetobacter baumannii and clostridium difficile type strains. Compared with a commercial strain # imgabs0 # lactobacillus rhamnosus, the lactobacillus rhamnosus A21173 disclosed by the invention has a better antibacterial effect on clostridium difficile. The lactobacillus rhamnosus A21174 also shows good effects in in-vivo and in-vitro experiments such as artificial gastrointestinal fluid resistance, cholate resistance, aging resistance, life prolonging, oxidation resistance, cognition improvement and the like, so that the strain can be used as a probiotic agent for preparing a product for regulating intestinal flora, and has a good application prospect. The invention has important significance for preventing and / or treating diseases caused by multidrug-resistant bacterium infection, clostridium difficile and pseudomonas aeruginosa infection.

Description

Technical Field

[0001] The present invention relates to the technical field of functional strains, and particularly relates to a Lactobacillus rhamnosus A21174 that inhibits multi-drug resistant strains, Clostridioides difficile infection, has antioxidant properties, anti-aging and life-prolonging effects, and improves cognition, and its products and applications. Background Art

[0002] Lacticaseibacillus rhamnosus (also known as Lactobacillus rhamnosus) is an edible probiotic that has the functions of regulating the microecological balance and enhancing the intestinal resistance of the host. It is widely used in infant formula foods and various dietary supplements and is a research hotspot in the fields of modern nutrition and medicine. Numerous studies have shown that it can prevent or relieve diseases such as inflammatory bowel disease (IBD) and diarrhea by regulating the intestinal microbial composition, protecting the intestinal epithelial cell barrier, and regulating immune disorders.

[0003] Nowadays, due to the abuse of antibiotics, a large number of multi-drug resistant bacteria and even superbugs have emerged. Currently, clinically common multi-drug resistant bacteria include methicillin-resistant Staphylococcus aureus (MRSA), Enterobacteriaceae bacteria producing extended-spectrum β-lactamases (ESBLs) (such as Escherichia coli and Klebsiella pneumoniae), multi-drug resistant Pseudomonas aeruginosa (MDR-PA), multi-drug resistant Acinetobacter baumannii (MDR-AB), etc. Multi-drug resistant bacteria render conventional antibiotic treatments ineffective, significantly increasing the difficulty of clinical infection treatment and the risk to patients. In addition, Clostridioides difficile infection (CDI) is also one of the urgent public health threats. The main symptoms are abdominal pain, diarrhea, fever, etc. Improper or untimely treatment can even lead to pseudomembranous colitis, toxic megacolon, etc., and it is one of the most common causes of nosocomial infections and deaths.

[0004] To address multi-drug resistant bacterial infections, the screening of new antibiotics is essential, but using the antagonistic effect between probiotics and drug-resistant bacteria to restore intestinal balance should be a more preferable and safer option. Summary of the Invention

[0005] The present invention aims to at least solve one of the above technical problems in the prior art. For this reason, the object of the present invention is to provide a Lactobacillus rhamnosus A21174 that inhibits multi-drug resistant strains, Clostridioides difficile infection, has antioxidant properties, anti-aging and life-prolonging effects, and improves cognition, and its products and applications.

[0006] To achieve the above object, the technical solutions adopted by the present invention are as follows:

[0007] In the first aspect of the present invention, a Lactobacillus rhamnosus is provided. The Lactobacillus rhamnosus is Lactobacillus rhamnosus A21174, taxonomically named Lacticaseibacillus rhamnosus, and was deposited at the Guangdong Microbial Culture Collection Center (GDMCC) on January 13, 2025 (the deposit address is: 5th Floor, Building 59, 100th Yard, Xianlie Middle Road, Guangzhou), with the deposit number GDMCC No: 65769.

[0008] In some embodiments of the present invention, the colony morphology of Lactobacillus rhamnosus A21174 is circular, convex, entire, and colorless colonies.

[0009] In some embodiments of the present invention, the 16S sequence of Lactobacillus rhamnosus A21174 is as shown in SEQ ID NO: 3.

[0010] In some embodiments of the present invention, the screening and isolation method of Lactobacillus rhamnosus A21174 is as follows: Take the fecal samples of centenarians in Guangxi Zhuang Autonomous Region and place them in MRS solid medium. After smearing evenly, place them in an anaerobic workstation for culturing for two days. Pick at least a small amount of colonies with circular, convex, entire, and colorless colony morphology on the plate and culture them in MRS liquid medium. After PCR amplification and identification, Lactobacillus rhamnosus A21174 is obtained.

[0011] In some embodiments of the present invention, the culture conditions in the anaerobic workstation are 37°C, 90% nitrogen + 10% carbon dioxide.

[0012] In some embodiments of the present invention, the primers used for PCR amplification and identification are as shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0013] In some embodiments of the present invention, the amplification system for PCR amplification and identification is:

[0014] Component Content 10 μM upstream primer 16S-F 1 μL 10 μM downstream primer 16S-R 1 μL PCR amplification solution 12.5 μL DNA template 1 μL <![CDATA[ddH2O]]> Make up to 25 μL.

[0015] In some embodiments of the present invention, the amplification program for PCR amplification and identification is 95°C for 3 min; 95°C for 40 s, 56°C for 30 s, 72°C for 1 min, for 30 cycles; 72°C for 8 min.

[0016] In the second aspect of the present invention, a culture of Lactobacillus rhamnosus A21174 is provided.

[0017] In some embodiments of the present invention, the culture comprises the supernatant obtained by culturing Lactobacillus rhamnosus A21174.

[0018] The third aspect of the present invention provides a bacterial agent.

[0019] In some embodiments of the present invention, the bacterial agent comprises Lactobacillus rhamnosus A21174 described in the above aspect and / or the culture of Lactobacillus rhamnosus A21174.

[0020] In some embodiments of the present invention, the bacterial agent is a solid bacterial agent or a liquid bacterial agent.

[0021] The fourth aspect of the present invention provides the use of Lactobacillus rhamnosus A21174 described in the above aspect and / or the culture of Lactobacillus rhamnosus A21174 and / or the bacterial agent in at least one of (I) to (IV);

[0022] (I) Preparing an antibacterial agent;

[0023] (II) Preparing a product for preventing and / or treating multi-drug resistant bacteria infections;

[0024] (III) Preparing a product for preventing and / or treating Clostridium difficile infections;

[0025] (IV) Preparing a product for regulating the intestinal flora.

[0026] In some embodiments of the present invention, the antibacterial agent is a reagent for inhibiting the number, activity and / or growth of viable bacteria in vitro, including but not limited to: any reagent for surface sterilization, antibacterial or controlling microbial reproduction.

[0027] In some embodiments of the present invention, the bacteria are Gram-positive bacteria or Gram-negative bacteria.

[0028] In some embodiments of the present invention, the bacteria include Clostridium difficile and Pseudomonas aeruginosa.

[0029] In some embodiments of the present invention, the bacteria further include multi-drug resistant bacteria; further including drug-resistant Escherichia coli and drug-resistant Acinetobacter baumannii.

[0030] In some embodiments of the present invention, the bacteria further include drug-resistant Staphylococcus aureus.

[0031] In some embodiments of the present invention, the multi-drug resistant bacteria in (II) are Gram-positive bacteria or Gram-negative bacteria.

[0032] In some embodiments of the present invention, the multi-drug resistant bacteria in (II) include bacteria resistant to β-lactam antibiotics.

[0033] In some embodiments of the present invention, the β-lactam antibiotics include carbapenem antibiotics, penicillin antibiotics, cephalosporin antibiotics, and monocyclic β-lactam antibiotics.

[0034] In some embodiments of the present invention, the penicillin antibiotics include methicillin.

[0035] In some embodiments of the present invention, the multi-drug resistant bacteria in (II) include drug-resistant Escherichia coli and drug-resistant Acinetobacter baumannii.

[0036] In some embodiments of the present invention, the drug-resistant Escherichia coli is Extended-Spectrum β-Lactamases (ESBL)-Producing Escherichia coli.

[0037] In some embodiments of the present invention, the drug-resistant Acinetobacter baumannii is heteroresistant Acinetobacter baumannii strain HRAB-85.

[0038] In some embodiments of the present invention, the multi-drug resistant bacteria in (II) further include drug-resistant Staphylococcus aureus.

[0039] In some embodiments of the present invention, the drug-resistant Staphylococcus aureus is Methicillin-resistant Staphylococcus aureus (MRSA).

[0040] The fifth aspect of the present invention provides a product containing any one or more of the Lactobacillus rhamnosus A21174 described in the above aspects, the culture of the Lactobacillus rhamnosus A21174, and the bacterial agent.

[0041] In some embodiments of the present invention, the product includes food, food additives, feed, feed additives, and pharmaceuticals.

[0042] In some embodiments of the present invention, the product further contains excipients.

[0043] In some embodiments of the present invention, the excipients include food additives or pharmaceutically acceptable adjuvants.

[0044] The sixth aspect of the present invention provides a non-therapeutic method for inhibiting the viable count and / or activity and / or growth of multi-drug resistant bacteria, Clostridium difficile, and Pseudomonas aeruginosa.

[0045] In some embodiments of the present invention, the method includes the step of using Lactobacillus rhamnosus A21174 described in the above aspects, a culture of Lactobacillus rhamnosus A21174, and / or the bacterial agent.

[0046] In some embodiments of the present invention, the multi-drug resistant bacteria are Gram-positive bacteria or Gram-negative bacteria.

[0047] In some embodiments of the present invention, the multi-drug resistant bacteria include drug-resistant Escherichia coli and drug-resistant Acinetobacter baumannii.

[0048] In some embodiments of the present invention, the multi-drug resistant bacteria further include drug-resistant Staphylococcus aureus.

[0049] The beneficial effects of the present invention are as follows:

[0050] The present invention provides Lactobacillus rhamnosus A21174 for inhibiting multi-drug resistant strains and Clostridium difficile infections, which has obvious inhibitory effects on drug-resistant Staphylococcus aureus, Pseudomonas aeruginosa, drug-resistant Escherichia coli, drug-resistant Acinetobacter baumannii, and Clostridium difficile reference strains. Compared with the commercial strain Lactobacillus rhamnosus, the Lactobacillus rhamnosus A21174 of the present invention has a better antibacterial effect against Clostridium difficile. The Lactobacillus rhamnosus A21174 also shows good effects in in vivo and in vitro experiments such as resistance to artificial gastrointestinal juice, bile salt, anti-aging, life extension, antioxidant, and cognitive improvement. Therefore, this strain can be used as a probiotic bacterial agent for preparing products for regulating the intestinal flora, which is of great significance for preventing and / or treating diseases caused by multi-drug resistant bacteria infections, Clostridium difficile, and Pseudomonas aeruginosa infections. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is an evolutionary tree of Lactobacillus rhamnosus A21174.

[0052] Figure 2 It is the inhibitory effect of Lactobacillus rhamnosus A21174 on drug-resistant Staphylococcus aureus.

[0053] Figure 3 It is the inhibitory effect of Lactobacillus rhamnosus A21174 on Pseudomonas aeruginosa.

[0054] Figure 4 It is the inhibitory effect of Lactobacillus rhamnosus A21174 on drug-resistant Escherichia coli.

[0055] Figure 5 It is the inhibitory effect of Lactobacillus rhamnosus A21174 on drug-resistant Acinetobacter baumannii.

[0056] Figure 6 The antibacterial effect of Lactobacillus rhamnosus A21174 against Clostridium difficile.

[0057] Figure 7 The antibacterial effect of the culture supernatant of Lactobacillus rhamnosus A21174 against Clostridium difficile.

[0058] Figure 8 The effect of Lactobacillus rhamnosus A21174 on Clostridium difficile in the nematode model.

[0059] Figure 9 Colonies of Lactobacillus rhamnosus A21174 growing on Columbia blood agar.

[0060] Figure 10 The antioxidant effect of Lactobacillus rhamnosus A21174.

[0061] Figure 11 The heat resistance effect of Lactobacillus rhamnosus A21174.

[0062] Figure 12 The effect of Lactobacillus rhamnosus A21174 on the lifespan of nematodes.

[0063] Figure 13 The effect of Lactobacillus rhamnosus A21174 on the body bending of nematodes.

[0064] Figure 14 The effect of Lactobacillus rhamnosus A21174 on the head swinging of nematodes.

[0065] Figure 15 For commercial strains The antibacterial effect of Lactobacillus rhamnosus against Clostridium difficile.

[0066] Figure 16 For commercial strains The antibacterial effect of the culture supernatant of Lactobacillus rhamnosus against Clostridium difficile. Detailed implementation manners

[0067] The content of the present invention will be further described in detail through specific embodiments below. The raw materials, reagents or devices used in the embodiments and comparative examples can be obtained from conventional commercial channels or can be obtained by existing technical methods without special instructions. Unless otherwise specified, the test or testing methods are conventional methods in the art.

[0068] Example 1 Isolation and purification of Lactobacillus rhamnosus A21174

[0069] This example provides a method for the isolation and purification of Lactobacillus rhamnosus A21174, and the specific experimental steps are as follows.

[0070] (1) Take the fecal samples of centenarians in Guangxi Zhuang Autonomous Region. Take an appropriate amount of fecal samples into MRS solid medium, smear evenly, and place in an anaerobic workstation. Culture for two days under the conditions of 37°C, 90% nitrogen + 10% carbon dioxide;

[0071] (2) After the culture is completed, pick at least a small amount of colonies with round, raised, entire and colorless colony morphology on the plate into MRS liquid medium (peptone 10 g / L, beef extract powder 5 g / L, yeast extract powder 4 g / L, glucose 20 g / L, dipotassium hydrogen phosphate 2 g / L, ammonium citrate tribasic 2 g / L, sodium acetate 5 g / L, magnesium sulfate 0.2 g / L, manganese sulfate 0.05 g / L, agar 15 g / L, Tween - 80 1 g / L. After mixing the above components, add 1 L of deionized water, adjust the pH value to 6.2 ± 0.2, and sterilize at 121°C for 15 min to obtain it), mix evenly and transfer to a PCR tube, and continue to culture in a 37°C incubator for 24 h;

[0072] (3) Add PCR amplification solution (2×Taq PCR StarMix with Loading Dye, Beijing Kangrun Chengye Biotechnology Co., Ltd.) to the cultured PCR tube, and add 16S primers for PCR amplification (the amplification system is shown in Table 1 below);

[0073] Among them, the 16S primers are:

[0074] Upstream primer 16S - F: 5’ - AGAGTTTGATCCTGGCTCAG - 3’ (SEQ ID NO:1);

[0075] Downstream primer 16S - R: 5’ - TACGGCTACCTTGTTACGACTT - 3’ (SEQ ID NO:2);

[0076] Table 1 PCR amplification system of Lactobacillus rhamnosus

[0077]

[0078]

[0079] The amplification program is: 95°C for 3 min; 95°C for 40 s, 56°C for 30 s, 72°C for 1 min, cycle 30 times; 72°C for 8 min;

[0080] Send the amplification product to Sangon Biotech (Shanghai) Co., Ltd. for sequencing and identification.

[0081] After sequencing and identification, it is confirmed to be Lactobacillus rhamnosus, and its 16S sequence is:

[0082]

[0083] (4) The confirmed culture medium was purified by streak plate method twice. Single colonies after purification were picked for repeated culture to obtain bacterial liquid. The bacterial liquid was mixed with 40% glycerol preservation solution at a volume ratio of 1:1 in a strain cryopreservation tube and stored in a -80 °C refrigerator.

[0084] (5) The 16S sequences obtained in (3) were used to construct a phylogenetic tree by the neighbor-joining method on MEGA-X 10.2.2 software (https: / / www.megasoftware.net / ).

[0085] The construction result of the phylogenetic tree is as Figure 1 shown. It can be seen that the strain isolated and purified in this example is Lactobacillus rhamnosus, and it was named Lactobacillus rhamnosus A21174.

[0086] The obtained Lactobacillus rhamnosus A21174 was sent to the Guangdong Provincial Culture Collection Center of Microorganisms (GDMCC) for preservation. Its taxonomic name is: Lacticaseibacillus rhamnosus, the preservation date is: January 13, 2025, the preservation address is: 5th Floor, Building 59, No. 100 Compound, Xianlie Middle Road, Guangzhou, and the preservation number is: GDMCC No: 65769.

[0087] Example 2 Antibacterial Test of Lactobacillus rhamnosus A21174 against Drug-Resistant Staphylococcus aureus

[0088] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against drug-resistant Staphylococcus aureus. The drug-resistant Staphylococcus aureus is Methicillin-resistant Staphylococcus aureus (MRSA) (kindly provided by Researcher Huang Ying of the Institute of Microbiology, Chinese Academy of Sciences). The specific experimental steps are as follows.

[0089] (1) The obtained Lactobacillus rhamnosus A21174 in Example 1 was cultured in a conventional MRS liquid medium and placed in a shaker at 37 °C for 48 hours.

[0090] (2) The drug-resistant Staphylococcus aureus was cultured in an LB liquid medium (tryptone, 10 g / L; yeast extract, 5 g / L; sodium chloride, 10 g / L). Prepare an LB solid medium. Before pouring the medium, when the temperature of the medium is about 42 °C - 45 °C, add the drug-resistant Staphylococcus aureus bacterial liquid to the LB with a final concentration of 5% by volume. Pour the plate as soon as possible before the medium solidifies, and ensure that the volume of the medium in each plate is the same.

[0091] (3) Punch holes in the flat plate with a 9 mm punch, add 150 μL of the above-mentioned Lactobacillus rhamnosus A21174 bacterial solution to the flat plate, set two parallel holes, and then culture in a biochemical incubator at 37 °C for 24 hours, take pictures and record the size of the inhibition zone.

[0092] The experimental results are as Figure 2 shown. The size of the inhibition zone is 23 mm. The experimental results show that the drug-resistant strain Staphylococcus aureus is sensitive to Lactobacillus rhamnosus A21174, that is, Lactobacillus rhamnosus A21174 has an obvious inhibitory effect on drug-resistant Staphylococcus aureus.

[0093] Example 3 Antibacterial test of Lactobacillus rhamnosus A21174 against Pseudomonas aeruginosa

[0094] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against Pseudomonas aeruginosa PAO1 (gifted by Researcher Huang Ying of the Institute of Microbiology, Chinese Academy of Sciences). On the basis of the experimental steps in Example 2, Pseudomonas aeruginosa is used for the antibacterial test.

[0095] The experimental results are as Figure 3 shown. The average inner diameter of the inhibition zone is 16.5 mm. The experimental results show that Pseudomonas aeruginosa is sensitive to Lactobacillus rhamnosus A21174, that is, Lactobacillus rhamnosus A21174 has an obvious inhibitory effect on Pseudomonas aeruginosa.

[0096] Example 4 Antibacterial test of Lactobacillus rhamnosus A21174 against drug-resistant Escherichia coli

[0097] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against drug-resistant Escherichia coli. The drug-resistant Escherichia coli is ESBLs-producing Escherichia coli (Extended-Spectrum β-Lactamases (ESBL)-Producing Escherichia coli) (gifted by Researcher Huang Ying of the Institute of Microbiology, Chinese Academy of Sciences). On the basis of the experimental steps in Example 2, drug-resistant Escherichia coli is used for the test.

[0098] The experimental results are as Figure 4 shown. The average size of the inhibition zone is 19 mm. The experimental results show that the drug-resistant strain Escherichia coli is sensitive to Lactobacillus rhamnosus A21174, that is, Lactobacillus rhamnosus A21174 has an obvious inhibitory effect on drug-resistant Escherichia coli.

[0099] Example 5 Antibacterial test of Lactobacillus rhamnosus A21174 against drug-resistant Acinetobacter baumannii

[0100] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against drug-resistant Acinetobacter baumannii. The drug-resistant Acinetobacter baumannii is Acinetobacter baumannii HRAB-85 (heteroresistant Acinetobacter baumannii strain HRAB-85, reference: Li P, Huang Y, Yu L, Liu Y, Niu W, Zou D, Liu H, Zheng J, Yin X, Yuan J, Yuan X, Bai C. Isolation and Whole-genome Sequence Analysis of the Imipenem Heteroresistant Acinetobacter baumannii Clinical Isolate HRAB-85. Int J Infect Dis. 2017 Sep, 62:94-101.) (kindly donated by Researcher Huang Ying of the Institute of Microbiology, Chinese Academy of Sciences), and the test is carried out using drug-resistant Acinetobacter baumannii on the basis of the experimental steps in Example 2.

[0101] The experimental results are as Figure 5 shown. The average size of the inhibition zone is 17 mm. The experimental results indicate that the drug-resistant strain Acinetobacter baumannii is sensitive to Lactobacillus rhamnosus A21174, that is, Lactobacillus rhamnosus A21174 has an obvious inhibitory effect on drug-resistant Acinetobacter baumannii.

[0102] Example 6 Antibacterial Test of Lactobacillus rhamnosus A21174 against Clostridium difficile

[0103] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against Clostridium difficile (ATCC 43255). The specific experimental steps are as follows.

[0104] (1) Culture Lactobacillus rhamnosus A21174 in a conventional MRS liquid medium and incubate it in a shaker at 37 °C for 48 h;

[0105] (2) Take 1 mL of the cultured bacterial liquid in (1), centrifuge it at 5000 rpm for 1 min, wash it once with 1×PBS, remove the supernatant, and reserve the bacterial cells;

[0106] (3) Culture the Clostridium difficile reference strain (ATCC 43255) in a commercially available MYPG liquid medium and anaerobically culture it at 37 °C for 48 hours;

[0107] (4) In the anaerobic workstation, take 300 μL of the Clostridium difficile bacterial solution obtained in (3) and spread it evenly on the MYPG solid plate. After spreading evenly, add 20 μL of the Lactobacillus rhamnosus A21174 cells obtained in (2) onto the plate. Set three parallels, and then incubate anaerobically at 37 °C for 24 h. Take a photo and record the size of the inhibition zone.

[0108] The experimental results are as Figure 6 shown. The average diameter of the inhibition zone is 14.5 mm. The experimental results show that Clostridium difficile is sensitive to Lactobacillus rhamnosus A21174, that is, the Lactobacillus rhamnosus A21174 cells have an obvious inhibitory effect on Clostridium difficile.

[0109] Example 7 Antibacterial test of the culture supernatant of Lactobacillus rhamnosus A21174 against Clostridium difficile

[0110] This example provides a test on the antibacterial effect of the culture supernatant of Lactobacillus rhamnosus A21174 against Clostridium difficile (ATCC 43255). The specific experimental steps are as follows.

[0111] (1) The culture method of Lactobacillus rhamnosus A21174 is the same as that in step (1) of Example 6;

[0112] (2) Take 1 mL of the cultured bacterial solution in (1), centrifuge at 5000 rpm for 1 min, and take the supernatant for use;

[0113] (3) The culture method of the Clostridium difficile reference strain (ATCC 43255) is the same as that in step (3) of Example 6;

[0114] (4) In the anaerobic workstation, take 300 μL of the Clostridium difficile bacterial solution and spread it evenly on the MYPG solid plate. After spreading evenly, use a 9-mm punch to punch holes on the plate, and add 150 μL of the culture supernatant of Lactobacillus rhamnosus A21174 prepared in (2) onto the plate. Set two parallel holes, and then incubate anaerobically at 37 °C for 24 hours. Take a photo and record the size of the inhibition zone.

[0115] The experimental results are as Figure 7 shown. The average diameter of the inhibition zone is 21.75 mm, indicating that Clostridium difficile is sensitive to the secondary metabolites of Lactobacillus rhamnosus A21174, and the culture supernatant of Lactobacillus rhamnosus A21174 has an obvious inhibitory effect on Clostridium difficile.

[0116] Example 8 Effect of Lactobacillus rhamnosus A21174 on Clostridium difficile in a nematode model

[0117] This example provides a test on the antibacterial effect of Lactobacillus rhamnosus A21174 against Clostridium difficile. The specific experimental steps are as follows.

[0118] (1) The culturing steps of Lactobacillus rhamnosus A21174 and Clostridium difficile (ATCC 43255) are the same as those in (1) and (3) of Example 6;

[0119] (2) Culture Escherichia coli OP50 in LB liquid medium under the following conditions: temperature 37°C, time 20 hours, rotation speed 200 rpm;

[0120] (3) Spread the bacterial suspensions of Lactobacillus rhamnosus A21174 and Escherichia coli OP50 onto nematode growth medium (NGM) plates and culture overnight;

[0121] The formula of the NGM medium is as follows: 3 g of sodium chloride, 17 g of agar powder, 2.5 g of peptone, 975 mL of deionized water. After thoroughly mixing the above components, seal with tin foil. Autoclave for 20 min and then cool in a water bath to 55°C. Under sterile conditions, add the following sterilized solutions: 1 mL of 1 M CaCl2, 1 mL of 1 M MgSO4, 25 mL of 1 M KPO4 buffer (108.3 g of KH2PO4 and 35.6 g of K2HPO4, dissolved in 1000 mL of distilled water, adjust the pH value to 6.0), 1 mL of 5 mg / mL cholesterol (dissolved in 95% ethanol);

[0122] (4) After centrifuging the thawed wild-type nematodes (Caenorhabditis elegans, kindly provided by Researcher Bin Wang of Guangxi Academy of Sciences), add them to the NGM medium with Escherichia coli OP50 respectively and culture in an incubator at 20°C for 3 days;

[0123] (5) Suspend the nematodes cultured in (4) using M9 buffer (Na2HPO4: 6.0 g; KH2PO4: 3.0 g; NaCl: 5.0 g; MgSO4·7H2O: 0.25 g; dissolved in 1 L of distilled water, autoclaved at high temperature and high pressure), and aspirate them into a culture tube. Add lysis solution (5 mol / L NaOH and 5% sodium hypochlorite solution by volume ratio) to each tube and lyse for 6 minutes;

[0124] (6) Subsequently, centrifuge the lysed liquid in (5) at 3500 r / min for 1 min, discard the supernatant, wash repeatedly with M9 buffer 4 times, centrifuge again and discard the supernatant. Transfer the precipitate to the NGM medium and culture overnight at 20°C to obtain L1-stage nematode larvae;

[0125] (7) After rinsing and centrifuging once with M9 buffer, transfer the nematode larvae to an NGM plate containing Escherichia coli OP50 and culture at 20°C for 28 - 30 hours to obtain synchronized nematodes, namely L4-stage nematodes;

[0126] (8) Randomly divide the synchronized nematodes obtained in (7) into two groups (control group (Clostridium difficile) and experimental group (Lactobacillus rhamnosus A21174 + Clostridium difficile, mixed at a concentration of 1:1)), and culture 150 nematodes in each group. The day when L4-stage nematodes are picked is recorded as day 0. During the experiment, the NGM medium containing Clostridium difficile and A20083 + Clostridium difficile is changed every 2 days for the nematodes, and the lifespan is counted until all nematodes die. Abnormally dead nematodes are not included in the statistics. Statistical analysis is performed using GraphPad Prism 5. One-way ANOVA is used to compare the significance of differences among multiple groups; the t-test method is used to analyze the differences between two groups. P < 0.05 indicates a significant difference, and P < 0.01 indicates a highly significant difference.

[0127] The experimental results are as Figure 8 shown. The median lifespan of nematodes in the experimental group is 22 days, and the median in the control group is 18 days. The lifespan of nematodes in the experimental group is increased by 22.22% compared to the control group. The experimental results show that Lactobacillus rhamnosus A21174 has a significant buffering effect on alleviating the toxicity caused by Clostridium difficile to nematodes, and Lactobacillus rhamnosus A21174 can be used to regulate the intestinal microbiota of the host.

[0128] Example 9 Hemolysis test of Lactobacillus rhamnosus A21174

[0129] This example provides a hemolysis test of Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0130] Activate and culture the Lactobacillus rhamnosus A21174 obtained in Example 1 on a Columbia agar plate containing 5% sheep blood, and then place it in an anaerobic workstation at 37°C for 48 hours to observe whether there is a hemolysis zone around the colonies.

[0131] The experimental results are as Figure 9 shown. There is no hemolysis zone around the colonies of Lactobacillus rhamnosus A21174, indicating that Lactobacillus rhamnosus A21174 has high safety.

[0132] Example 10 In vitro experiment of Lactobacillus rhamnosus A21174 resistance to artificial gastrointestinal fluid

[0133] This example provides an in vitro experiment of Lactobacillus rhamnosus A21174 resistance to artificial gastrointestinal fluid. The specific experimental steps are as follows.

[0134] (1) Take the Lactobacillus rhamnosus A21174 obtained in Example 1 for overnight culture and activation, and inoculate the bacterial solution into artificial gastric juice (Regen Biotech) with a pH of 3 at an inoculation amount of 10% by volume;

[0135] (2) 100 μL of the solution was taken at 0 h, 1 h, and 3 h respectively and spread on MRS plates, and the number of single colonies was counted after anaerobic incubation at 37 °C for 48 h;

[0136] (3) Using the bacterial solution treated with gastric juice for 3 h as the initial bacterial solution concentration for the intestinal juice experiment, the bacterial solution was inoculated into artificial intestinal juice (Regen Biotech) with a pH of 8. 100 μL of the solution was taken at 2 h, 4 h, 6 h, and 8 h respectively and spread on MRS plates, and the number of single colonies was counted after anaerobic incubation at 37 °C for 48 h. The survival rate of Lactobacillus rhamnosus A21174 in artificial gastrointestinal juice was calculated with 0 h of gastric juice as the initial concentration based on the number of single colonies in the above experiment.

[0137] The experimental results are shown in Table 2 below. The survival rate of Lactobacillus rhamnosus A21174 in artificial gastric juice for 3 h was 97.17%, the survival rate in intestinal juice for 6 h was 20.91%, and the survival rate in intestinal juice for 8 h was 35.22%. The overall trend of Lactobacillus rhamnosus A21174 in intestinal juice was gradually increasing, indicating that Lactobacillus rhamnosus A21174 had strong colonization ability in the gastrointestinal tract without cryoprotectant.

[0138] Table 2 Resistance of Lactobacillus rhamnosus A21174 to artificial gastrointestinal juice

[0139]

[0140] Example 11 In vitro experiment on the bile salt resistance of Lactobacillus rhamnosus A21174

[0141] This example provides an in vitro experiment on the bile salt resistance of Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0142] The Lactobacillus rhamnosus A21174 obtained in Example 1 was taken for overnight culture and activation. According to an inoculation amount of 10% by volume, the bacterial solution was inoculated into MRS liquid medium with 0.1 g / L bile salt. 100 μL of the solution was taken at 0 h, 1 h, 2 h, 3 h, and 4 h respectively and spread on MRS plates, and the number of single colonies was counted after anaerobic incubation at 37 °C for 48 h.

[0143] The experimental results are shown in Table 3 below. The survival rates of Lactobacillus rhamnosus A21174 in bile salt at 1 h, 2 h, 3 h, and 4 h were 137.33%, 87.33%, 152%, and 188% respectively, indicating that Lactobacillus rhamnosus A21174 could survive and even proliferate in 0.1 g / L bile salt.

[0144] Table 3 Bile salt resistance of Lactobacillus rhamnosus A21174

[0145]

[0146] Example 12 Antioxidant effect of Lactobacillus rhamnosus A21174

[0147] This example provides the detection of the antioxidant effect of Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0148] (1) Synchronized L4-stage hermaphrodite nematodes were cultured according to the experimental steps of Example 8.

[0149] (2) Synchronized L4-stage hermaphrodite nematodes of comparable size and vitality were randomly divided into 2 groups, namely the control group (fed Escherichia coli OP50) and the experimental group (fed the experimental strain A21174), and cultured in a constant temperature incubator at 20°C. The day when L4-stage nematodes were picked was recorded as day 0, and on the 5th day, the nematodes were transferred to NGM medium containing 3.375 mM H2O2 (30 nematodes / group). At 1-hour intervals, the number of dead nematodes was counted under a microscope according to the nematode death criteria until all nematodes died.

[0150] The experimental results are as Figure 10 shown, A21174 can improve the antioxidant capacity of nematodes by 75%.

[0151] Example 13 37°C heat stress effect of Lactobacillus rhamnosus A21174

[0152] This example provides the detection of the 37°C heat stress effect of Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0153] (1) Synchronized L4-stage hermaphrodite nematodes were cultured according to the experimental steps (1)-(7) in Example 8.

[0154] (2) Synchronized L4-stage hermaphrodite nematodes of comparable size and vitality were randomly divided into 2 groups, namely the control group (fed Escherichia coli OP50) and the experimental group (fed the experimental strain A21174), and cultured in a constant temperature incubator at 20°C. The day when L4-stage nematodes were picked was recorded as day 0, and on the 5th day, the nematode plates were transferred to a 37°C incubator for heat shock experiments (30 nematodes / group). At 1-hour intervals, the number of dead nematodes was counted under a microscope according to the nematode death criteria until all nematodes died.

[0155] The experimental results are as Figure 11 shown, A21174 can improve the heat stress resistance of nematodes by 25% and can improve the host's ability to cope with environmental stress.

[0156] Example 14 Effect of Lactobacillus rhamnosus A21174 on the lifespan of Caenorhabditis elegans

[0157] This example provides a 37°C heat stress test for Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0158] (1) According to the experimental steps of Example 8, synchronized L4-stage hermaphroditic nematodes were cultured.

[0159] (2) Synchronized L4-stage hermaphroditic nematodes of similar size and vitality were randomly divided into two groups, namely the control group (fed with Escherichia coli OP50) and the experimental group (fed with the experimental strain A21174). They were cultured in a constant temperature incubator at 20°C. The day when the L4-stage nematodes were picked was recorded as day 0. During the experiment, the nematodes were transferred to new NGM plates coated with the corresponding bacterial solution every 48 hours. The number of nematodes alive and dead was counted under a stereomicroscope every day until all nematodes died. Among them, accidental loss of nematodes or abnormal death was not included in the lifespan statistics. The nematodes were considered dead when they stopped pharyngeal suction or did not respond to gentle mechanical stimulation of the worm body with the platinum wire of the worm picker. Abnormal death includes physical intervention death (poking, scalding, and drying on the pick); death without reason in the first 5 days; transparent worm body; death due to internal hatching; inactive worm body in the first 5 days and a large number of worm eggs nearby.

[0160] The experimental results are as follows Figure 12 As shown, Lactobacillus rhamnosus A21174 can extend the lifespan of nematodes by 13.33%.

[0161] Example 15 Anti-aging test of Lactobacillus rhamnosus A21174

[0162] This example provides an anti-aging test of Lactobacillus rhamnosus A21174. The specific experimental steps are as follows.

[0163] According to the experimental steps of Example 8, L4 hermaphrodite nematodes were prepared by synchronization with Escherichia coli OP50 and Lactobacillus rhamnosus A21174, and 30 nematodes were randomly selected from each group. The body bending rate was measured using a stereo microscope (Motic) on the 5th, 10th and 15th days of culture. The test nematodes were placed on a clean NGM plate and allowed to move freely for 30 seconds to adapt to the plate before the test began. When the body of the nematode showed spontaneous and / or regular sine / cosine motion, one sine / cosine motion was completed and recorded for 30 seconds.

[0164] The experimental results are as follows Figure 13 and Figure 14 As shown, Lactobacillus rhamnosus A21174 can significantly improve the motility of nematodes in the early, middle and late stages.

[0165] Example 16 Effect of Lactobacillus rhamnosus A21174 on Parkinson's nematode model

[0166] This example provides a detection of the effect of Lactobacillus rhamnosus A21174 on a Parkinson's nematode model. The specific experimental steps are as follows.

[0167] (1) Preparation of a Parkinson's nematode model with 6-OHDA

[0168] BZ555:egIs1[dat-1p::GFP]; NL5901:pkIs2386[unc-54p::a-synuclein::YFP + unc-119] (hereinafter referred to as BZ555, purchased from the Caenorhabditis Genetics Center (CGC), USA) is a transgenic Parkinson's disease model nematode. Generally, the nematodes need to be induced with the neurotoxin 6-OHDA (6-hydroxydopamine) to induce Parkinson's symptoms in the nematodes. Synchronize BZ555 in the same way as the wild-type nematodes in Example 8. Place the obtained eggs on an NGM medium plate until the nematodes reach the L1-L2 stage. Collect the worms and expose them in a 50 mM 6-OHDA solution for 1 h. Gently shake with M9 every 10 min to wash away 6-OHDA, and wash 3-5 times repeatedly. Centrifuge at 3000 rpm until the supernatant is clear. Then, pipette an appropriate volume of the worm solution and place it on a plate containing Lactobacillus rhamnosus and a normal plate to grow for 48 h, divided into the Lactobacillus rhamnosus A21174 experimental group and the Parkinson's model experimental group, and use wild-type nematodes as the control group, growing on a normal plate for 48 h.

[0169] (2) Observation of food perception behavior

[0170] Pick the nematodes prepared in step (1) onto a sterile NGM medium containing Escherichia coli OP50. After waiting for 2 min, observe the number of movements (body bending times) of nematodes in different groups within 30 s. Normal nematodes will move slowly on the bacterial plate due to eating food (Escherichia coli OP50), and will move faster on the sterile plate due to searching for food (Escherichia coli OP50). Calculate the reduction rate of nematode food perception using the following formula:

[0171] Reduction rate = (Number of movements of nematodes under sterile conditions - Number of movements of nematodes with Escherichia coli OP50) / Number of movements of nematodes under sterile conditions * 100%.

[0172] The experimental results show that the reduction rate of food perception in the normal control group is 73.08%, and that in the model group is -58.33%. It is proved that under the treatment of the neurotoxin 6-OHDA, the nematodes in the model group are induced with Parkinson's symptoms and cognitive disorders; the reduction rate of the A21174 experimental group is 51.96%, indicating that Lactobacillus rhamnosus A21174 has a very obvious effect on hindering the pathogenesis of Parkinson's nematodes.

[0173] Comparative Example 1 Commercial strain Lactobacillus rhamnosus Inhibitory effect on Clostridium difficile

[0174] This embodiment provides a commercial strain An in vitro experiment of Lactobacillus rhamnosus (hereinafter referred to as LGG) on Clostridium difficile. The specific experimental steps are as follows.

[0175] (1) Based on the experimental steps of Example 6, use LGG to conduct an antibacterial test on Clostridium difficile;

[0176] (2) Based on the experimental steps of Example 7, use the culture supernatant of the said LGG to conduct an antibacterial test on Clostridium difficile.

[0177] The experimental results are as Figure 15 - 16 shown. The antibacterial zone diameter of the cells of the commercial strain Lactobacillus rhamnosus is 11 mm ( Figure 15 ), and the antibacterial zone diameter of the supernatant is 21 mm ( Figure 16 ). The experimental results show that Clostridium difficile is sensitive to the commercial strain LGG of Lactobacillus rhamnosus and its culture supernatant. At the same time, it can be seen that compared with LGG, Lactobacillus rhamnosus A21174 has a better antibacterial effect on Clostridium difficile.

[0178] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A Lactobacillus rhamnosus, characterized in that, The Lactobacillus rhamnosus is Lactobacillus rhamnosus A21174, taxonomically named Lacticaseibacillus rhamnosus, and was deposited at the Guangdong Microbial Culture Collection Center on January 13, 2025, with the deposit number GDMCC No: 65769.

2. The culture of the Lactobacillus rhamnosus according to claim 1.

3. A bacterial agent, characterized in that, The bacterial agent comprises the Lactobacillus rhamnosus according to claim 1 and / or the culture according to claim 2.

4. The microbial agent according to claim 3, characterized in that, The bacterial agent is a solid bacterial agent or a liquid bacterial agent.

5. Use of any one or more of the Lactobacillus rhamnosus according to claim 1, the culture of the Lactobacillus rhamnosus according to claim 2, and the bacterial agent according to claim 3 in at least one of the following (I) to (IV); (I) Preparing an antibacterial agent; (II) Preparing a product for preventing and / or treating multi-drug resistant bacterial infections; (III) Preparing a product for preventing and / or treating Clostridium difficile infections; (IV) Preparing a product for regulating the intestinal flora.

6. The application according to claim 5, wherein The multi-drug resistant bacteria include bacteria resistant to β-lactam antibiotics.

7. The application according to claim 5, wherein The multi-drug resistant bacteria include drug-resistant Staphylococcus aureus, drug-resistant Escherichia coli, and drug-resistant Acinetobacter baumannii.

8. A product containing any one or more of the Lactobacillus rhamnosus described in claim 1, the culture of Lactobacillus rhamnosus described in claim 2, and the bacterial agent described in claim 3, characterized in that The product includes food, food additives, feed, feed additives, and pharmaceuticals.

9. The product according to claim 8, wherein The product further contains excipients; the excipients include food additives or pharmaceutically acceptable adjuvants.

10. A method for inhibiting the viable count and / or activity and / or growth of multidrug-resistant bacteria, Clostridium difficile, and Pseudomonas aeruginosa, characterized in that, It includes the step of using the Lactobacillus rhamnosus according to claim 1, the culture of the Lactobacillus rhamnosus according to claim 2, and / or the bacterial agent according to claim 3; the multi-drug resistant bacteria are Gram-positive bacteria or Gram-negative bacteria.

Images