Genetic engineering strain for improving fermentation yield and conversion rate of L-glutamine, method and application
By knocking out the promoter of glutamate transporter gene cgl1221 and replacing the α-ketoglutarate dehydrogenase gene cgl1129 as the growth-coupled promoter PCP_2836, the problems of byproduct accumulation and plasmid dependence in L-glutamine fermentation were solved, yield and conversion rates were improved, and stable fermentation without plasmid was achieved.
Patent Information
- Application Number
- CN202510845886.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-24
- Publication Date
- 2025-07-25
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The existing L-glutamine fermented strains have the problem of a large accumulation of by-product L-glutamate and the need to carry plasmids, resulting in a decrease in yield and unstable industrial production.
By knocking out the glutamate transporter gene cgl1221 and replacing the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129 as the growth-coupled promoter PCP_2836, the genetically engineered strain T-5-2 was constructed to dynamically regulate metabolic flow to L-glutamine synthesis.
It significantly reduces the by-product amount of L-glutamic acid, improves the yield and sugar acid conversion rate of L-glutamine, and achieves the stability and wide application of the plasmid-free fermentation process.
Smart Images

Figure CN120366180A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and in particular relates to a genetic engineering strain, method and application for improving the fermentation yield and conversion rate of L-glutamine. Background Art
[0002] L-glutamine is one of the twenty essential amino acids for the human body. Currently, it can be used as a nutritional supplement and a drug for gastric ulcers. In addition, it can also be used as animal feed to improve the intestinal immunity of animals. In microorganisms, L-glutamine plays an important role as an amino acid donor in the human cell metabolism cycle and is widely involved in the biosynthesis of important compounds such as amino acids and nucleosides. The production methods of L-glutamine mainly include chemical synthesis method, fermentation method and enzymatic method. Among them, the chemical synthesis method involves the reaction of phthalyl protecting agent and acyl chloride followed by condensation with L-glutamine to obtain the crude product and then purification. The method is simple but may have problems of by-products and environmental pollution. The fermentation method uses microbial fermentation for production, which has the advantages of mild reaction conditions, low cost and high product purity, and is suitable for industrial-scale production. The enzymatic method uses specific enzymes for catalytic synthesis, which has the advantages of precise reaction and few by-products, but is less used in practical applications due to the high cost of enzymes. Currently, the fermentation method is the most commonly used and cost-effective production method.
[0003] Using Corynebacterium glutamicum as the starting strain, L-glutamine fermentation strains can be obtained through mutagenesis breeding or genetic engineering methods. Common metabolic engineering strategies include enhancing the synthesis flux of glutamine, weakening competing pathways, enhancing cofactor supply and increasing the activity of key enzymes, etc. In previous patent work (Chinese Patent Publication No. CN113913356A), using Corynebacterium glutamicum CGMCC No. 1.16145 as the starting strain, the glutamate synthase gene ncgl10181 was knocked out to block the formation of two molecules of glutamate from L-glutamine and α-ketoglutarate, obtaining strain T-1; the glutaminase ncgl12395 gene was knocked out to block the formation of L-glutamate from L-glutamine, obtaining strain T-3; one copy of the glutamine synthetase gene glnA from Bacillus subtilis was integrated bsu , obtaining strain T-4; one copy of the glutamine synthetase gene glnA from Lactobacillus acidophilus was integrated lcb , obtaining strain T-5; the glutamine synthetase gene glnA bsu was inserted into the pXT01 plasmid to construct the plasmid pXT01-glnA bus , and pXT01-glnA bsuElectroporated into strain T-5 to construct strain T-6. In the disclosed patent document, although the final strain T-6 achieved high production of L-glutamine, due to the strain carrying a plasmid, antibiotics still needed to be added during the fermentation process, and there was a relatively large accumulation of the by-product L-glutamic acid. In addition, the plasmid was prone to loss during large-scale production, resulting in a decrease in yield, which was not conducive to the stability of large-scale industrial production. Based on the previous patent work, this patent used T-5 as the starting strain, knocked out the glutamate transporter gene cgl1221, reduced the secretion of L-glutamic acid to the extracellular space, and provided more precursors for the synthesis of L-glutamine; replaced the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129 with the growth-coupled promoter P CP_2836 , and more carbon metabolic flux was distributed to L-glutamine synthesis while maintaining normal growth. Through the above transformation, a plasmid-free and auxotrophy-free L-glutamine fermentation production strain was finally obtained, and the yield of L-glutamine and the sugar-acid conversion rate were improved, and the content of the by-product L-glutamic acid was significantly reduced. Summary of the Invention
[0004] The object of the present invention is to overcome the deficiencies in the prior art and provide a genetically engineered strain, method and application for improving the fermentation yield and conversion rate of L-glutamine.
[0005] The technical solution adopted by the present invention to solve its technical problems is as follows:
[0006] A genetically engineered strain for improving the fermentation yield and conversion rate of L-glutamine, which is based on Corynebacterium glutamicum T-5 with high production of L-glutamine, lacks the glutamate transporter gene cgl1221, and uses the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129, and the genetically engineered bacterium T-5-2 is constructed, that is, the genetically engineered strain for improving the fermentation yield and conversion rate of L-glutamine.
[0007] Further, the gene cgl1221 is from Corynebacterium glutamicum, is a wild gene, or is a mutant encoding the corresponding protein or a gene modified artificially, including substitution, deletion or insertion of one or more amino acid residues at one or more sites, and the protein encoded by the mutant or the artificially modified gene has the corresponding activity and no functional defects.
[0008] Furthermore, the Corynebacterium glutamicum T-5 with high-yield L-glutamine was obtained by knocking out the glutamate synthase gene ncg10181 on the genome of Corynebacterium glutamicum TCCC11822 (CGMCC No. 1.16145), blocking the formation of two molecules of glutamate from L-glutamine and α-ketoglutarate; knocking out the glutaminase gene ncg12395 to block the formation of L-glutamate from L-glutamine; and integrating one copy of the glutamine synthetase gene glnA from Bacillus subtilis bsu and one copy of the glutamine synthetase gene glnA from Lactobacillus acidophilus lcb , enhancing the conversion of L-glutamate to L-glutamine. The Corynebacterium glutamicum T-5 with high-yield L-glutamine has been disclosed in the patent publication CN113913356A.
[0009] The construction method of the above-mentioned genetically engineered strain is obtained by gradually modifying T-5 using a gene editing technology that constructs pK18mobsacB for exchange. The steps are as follows:
[0010] (1) Knock out the glutamate transporter encoding gene cgl1221;
[0011] (2) Use the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129. The operation order of steps (1) to (2) in the above steps is not limited and can be carried out in any order that can be implemented by those skilled in the art. Preferably, the order is carried out sequentially as in steps (1) to (2).
[0012] Furthermore, the gene sequence of the glutamate transporter gene cgl1221 is SEQ ID NO.1;
[0013] the gene sequence of the growth-coupled promoter P CP-2836 is SEQ ID NO.2;
[0014] the gene sequence of the α-ketoglutarate dehydrogenase gene cgl1129 is SEQ ID NO.3;
[0015] Alternatively, the gene editing technology mediated by the pK18mobsacB plasmid includes constructing a plasmid related to pK18mobsacB, electrotransforming the constructed plasmid into electrocompetent cells, and performing two-step exchange to finally obtain a recombinant genetically engineered strain; the gene sequence of the pK18mobsacB plasmid is SEQ ID NO.4.
[0016] Furthermore, the construction of the plasmid containing the pK18mobsacB-related gene includes: constructing the DNA recombinant fragment for integration, and recombining the DNA recombinant fragment for integration with the linear vector fragment of pK18mobsacB; preferably, the restriction enzyme sites used for recombination are XbaI and KpnI.
[0017] The construction of the recombinant fragment includes constructing the recombinant fragment for gene integration or the recombinant fragment for gene knockout; among them, the steps for constructing the recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.
[0018] Application of the above-mentioned genetically engineered strain in the fermentation production of L-glutamine.
[0019] A method for fermenting and producing L-glutamine using the above-mentioned genetically engineered strain, comprising the following steps: contacting the genetically engineered strain with a fermentation medium, performing fermentation culture, and preparing L-glutamine.
[0020] Furthermore, the specific steps are as follows:
[0021] 1) Inoculate the genetically engineered strain from a 20% glycerol preservation tube at -80 °C into a slant for activation culture, and the culture conditions are 32 °C for 12 h;
[0022] 2) In three 1 L first-stage seed shake flasks, make up the volume of the seed medium to 100 mL, culture at 32 °C, pH 7.0, 220 r / min on a shaker for 10 h;
[0023] 3) Perform secondary seed culture in a 5 L fermenter. Transfer all the first-stage seed liquid into the 5 L fermenter for secondary seed culture. Make up the volume of the medium to 2 L, culture at 34 °C, pH 7.0, and the dissolved oxygen is 30 - 50%, and culture until the OD 600 reaches 40;
[0024] 4) Perform fermentation culture in a 5 L fermenter, with an inoculation amount of 20%, make up the volume of the medium to 3 L, culture at 34 °C, and the dissolved oxygen is 30 - 50%, and the fermentation culture time is 36 - 40 h;
[0025] The formula of the seed medium is: glucose 25 g / L, corn steep liquor dry powder 15 g / L, soybean protein concentrate 15 mL / L, K2HPO4·3H2O 1 g / L, MgSO4·7H2O 1 g / L.
[0026] The formula of the fermentation medium is: K2HPO4·3H2O 1.8 g / L, V B0.1 mg / L, 10 mL / L of soy protein concentrate, 4 g / L of corn steep liquor powder, 10 mg / L of MnSO4·H2O, 10 mg / L of FeSO4, 5 mg / L of ZnSO4, 1 g / L of MgSO4·7H2O, 60 g / L of (NH4)2SO4.
[0027] The advantages and positive effects achieved by the present invention are as follows:
[0028] 1. To solve the problem of a large amount of by-product L-glutamic acid during the L-glutamine fermentation process, the present invention knocked out the glutamate transporter gene cgl1221 of T-5, reducing the secretion of L-glutamic acid to the extracellular space, and at the same time providing more precursors for L-glutamine synthesis. The production of by-product L-glutamic acid by the obtained engineered strain T-5-1 decreased by 54.8%, and the production of L-glutamine increased by 17.1%.
[0029] 2. To solve the problem of plasmid-carrying in the L-glutamine fermentation strain, the present invention replaced the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129 with the growth-dependent promoter P CP_2836 , and by means of dynamic regulation, the expression level of α-ketoglutarate dehydrogenase was relatively high in the early stage of fermentation to ensure the normal growth of the bacteria, and the expression level decreased during the stable fermentation period, i.e., the acid production period, so that more α-ketoglutarate metabolism flowed towards L-glutamine synthesis rather than the TCA cycle. The L-glutamine production of the obtained plasmid-free engineered strain T-5-2 reached 89.5 g / L, and the sugar-acid conversion rate reached 38.9%. The L-glutamine production of the plasmid-carrying strain T-6 reported in Patent CN113913356A was 84.3 g / L, and the sugar-acid conversion rate was 37.1%. It can be seen from this that through the dynamic regulation of the metabolic strategy, the L-glutamine fermentation level of T-5-2 is superior to that of the plasmid-carrying strain T-6. The plasmid-free strain has higher stability during large-scale industrial fermentation, no antibiotic residue, and a broader application prospect.
[0030] 3. The present invention improved the L-glutamine production and sugar-acid conversion rate by reducing the secretion of by-product L-glutamic acid and dynamically regulating the expression level of the key metabolic node α-ketoglutarate dehydrogenase. The finally obtained engineered strain does not need to carry a plasmid, no antibiotics need to be added during the fermentation process, the production stability is higher, and the application is more extensive. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] Figure 1 It is a schematic diagram of the metabolic transformation of the L-glutamine strain in the present invention;
[0032] Figure 2 It is the map of pK18mobsacB – △cgl1221 in the present invention;
[0033] Figure 3 For pK18mobsacB – P in the present invention CP_2836 cgl1129 gene map;
[0034] Figure 4 PCR verification map for gene knockout of cgl1221 in the present invention; wherein, M: Marker; 1: Upstream homologous arm fragment of △cgl1221; 2: Downstream homologous arm fragment of △cgl1221; 3: Overlapping fragment of △cgl1221; 4: Successfully ligated fragment of pK18mobsacB plasmid; 5: PCR fragment of successful single crossover of the modified strain; 6: PCR fragment of successful double crossover of the modified strain;
[0035] Figure 5 PCR verification map for promoter replacement of cgl1129 gene in the present invention; wherein, M: Marker; 1: P CP- 2836 Upstream homologous arm fragment of cgl1129; 2: P CP-2836 Downstream homologous arm fragment of cgl1129; 3: P CP-2836 Overlapping fragment of cgl1129; 4: Successfully ligated fragment of pK18mobsacB plasmid; 5: PCR fragment of successful single crossover of the modified strain; 6: PCR fragment of successful double crossover of the modified strain. Detailed implementation manners
[0036] The present invention will be further described below in conjunction with embodiments. The following embodiments are narrative and not restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.
[0037] All kinds of experimental operations involved in the specific embodiments are conventional techniques in the art. For parts not specifically annotated herein, those of ordinary skill in the art can refer to various commonly used reference books, scientific and technological literatures, or relevant specifications, manuals, etc. before the application date of the present invention for implementation.
[0038] A genetically engineered strain for improving the fermentation yield and conversion rate of L-glutamine. The genetically engineered strain is based on Corynebacterium glutamicum T-5 with high yield of L-glutamine, lacking the glutamate transporter gene cgl1221, and using the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129, and a genetically engineered bacterium T-5-2, namely a genetically engineered strain for improving the fermentation yield and conversion rate of L-glutamine, is constructed. As Figure 1 shown.
[0039] Preferably, the gene cgl1221 is from Corynebacterium glutamicum, which is a wild-type gene, or a mutant encoding the corresponding protein or a gene modified artificially, including substitution, deletion or insertion of one or more amino acid residues at one or more sites. The protein encoded by the mutant or artificially modified gene has the corresponding activity and no functional defects.
[0040] Preferably, the Corynebacterium glutamicum T-5 with high-yield L-glutamine has the gene glutamate synthase ncg10181 knocked out on the genome of Corynebacterium glutamicum TCCC 11822 (CGMCC No. 1.16145), blocking the generation of two molecules of glutamate from glutamine and α-ketoglutarate; the gene glutaminase ncg12395 is knocked out, blocking the generation of glutamate from glutamine; and one copy of the gene glutamine synthetase glnA from Bacillus subtilis is integrated bsu and one copy of the glutamine synthetase gene glnA from Lactobacillus acidophilus lcb , enhancing the conversion of L-glutamate to L-glutamine. The Corynebacterium glutamicum T-5 with high-yield L-glutamine has been disclosed in the patent publication CN113913356A.
[0041] For the construction method of the genetic engineering strain as described above, the method is obtained by gradually modifying T-5 using the gene editing technology of exchange through constructing pK18mobsacB, and the steps are as follows:
[0042] (1) Knock out the gene cgl1221 encoding the glutamate transporter;
[0043] (2) Use the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129. The operation sequence of steps (1) to (2) in the above steps is not limited and can be carried out in any order that can be implemented by those skilled in the art. Preferably, it is carried out in the order of steps (1) to (2) in sequence.
[0044] Preferably, the gene sequence of the gene cgl1221 encoding the glutamate transporter is SEQ ID NO.1;
[0045] The gene sequence of the growth-coupled promoter P CP-2836 is SEQ ID NO.2;
[0046] The gene sequence of the α-ketoglutarate dehydrogenase gene cgl1129 is SEQ ID NO.3;
[0047] Alternatively, the pK18mobsacB plasmid-mediated gene editing technology includes constructing a plasmid of pK18mobsacB-related genes, electrotransforming the constructed plasmid into electrotransformation-competent cells, performing two-step exchange, and finally obtaining a recombinant genetically engineered strain; the gene sequence of the pK18mobsacB plasmid is SEQ ID NO.4.
[0048] Preferably, the construction of the plasmid of pK18mobsacB-related genes includes: constructing a DNA recombinant fragment for integration, and recombining the DNA recombinant fragment for integration with a pK18mobsacB linear vector fragment; preferably, the restriction enzyme sites used for recombination are XbaI and KpnI.
[0049] The construction of the recombinant fragment includes constructing a recombinant fragment for gene integration or a recombinant fragment for gene knockout; among them, the steps for constructing a recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the target gene insertion site, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.
[0050] Application of the genetically engineered strain as described above in the fermentation production of L-glutamine.
[0051] A method for fermenting and producing L-glutamine using the genetically engineered strain as described above, comprising the following steps: contacting the genetically engineered strain with a fermentation medium, performing fermentation culture, and preparing L-glutamine.
[0052] Preferably, the specific steps are as follows:
[0053] 1) Inoculate the genetically engineered strain from a 20% glycerol preservation tube at -80 °C into a slant for activation culture, and the culture conditions are 32 °C and 12 h;
[0054] 2) Three 1 L first-stage seed shake flasks, with the seed medium fixed at 100 mL, 32 °C, pH 7.0, 220 r / min, and shake flask culture for 10 h;
[0055] 3) Second-stage seed culture in a 5 L fermenter, inoculate all the first-stage seed liquid into the 5 L fermenter for second-stage seed culture, with the medium fixed at 2 L, 34 °C, pH 7.0, dissolved oxygen 30 - 50%, and culture until OD 600 reaches 40;
[0056] 4) Fermentation culture in a 5 L fermenter, with an inoculation amount of 20%, the medium fixed at 3 L, 34 °C, dissolved oxygen 30 - 50%, and the fermentation culture time is 36 - 40 h;
[0057] The formula of the seed culture medium is as follows: glucose 25 g / L, corn steep powder dry 15 g / L, soy protein concentrate 15 mL / L, K2HPO4·3H2O 1 g / L, MgSO4·7H2O 1 g / L.
[0058] The formula of the fermentation culture medium is as follows: K2HPO4·3H2O 1.8 g / L, V B 0.1 mg / L, soy protein concentrate 10 mL / L, corn steep powder dry 4 g / L, MnSO4·H2O 10 mg / L, FeSO4, 10 mg / L, ZnSO4 5 mg / L, MgSO4·7H2O 1 g / L, (NH4)2SO4 60 g / L.
[0059] Specifically, the related preparation and detection are as follows:
[0060] Example 1
[0061] Knockout of the cgl1221 gene:
[0062] 1. Construction of the pK18mobsacB – △cgl1221 vector
[0063] (1) Using the Corynebacterium glutamicum TCCC 11822 genome as a template, and using the cgl1221 gene upstream homologous arm amplification primers cgl1221-up-S and cgl1221-up-A, and the downstream homologous arm amplification primers cgl1221-down-S and cgl1221-down-A as amplification primers (where the 5' ends of cgl1221-up-S and cgl1221-down-A are respectively added with the linear vector homologous sequences of restriction endonucleases XbaI and KpnI, and cgl1221-up-A and cgl1221-down-S have homologous sequences), the upstream and downstream homologous arm fragments are amplified and recovered.
[0064] (2) Using the amplified upstream and downstream homologous arms as templates, and using cgl1221-up-S and cgl1221-down-A as primers, overlap PCR is carried out to obtain the overlapping fragment △cgl1221 with the middle part of the cgl1221 gene deleted.
[0065] (3) The pK18mobsacB plasmid is double digested with XbaI and KpnI, recombined with the overlapping fragment △cgl1221, and transformed into Escherichia coli DH5α competent cells, and spread on a kanamycin-resistant LB plate with a concentration of 0.05 mg / mL for verification, and single colonies carrying the plasmid are screened out. The cells are cultured in a shaking tube of LB medium, and the plasmid pK18mobsacB - △cgl1221 is extracted. As Figure 2 shown.
[0066] 2. cgl1221 gene knockout operation
[0067] (1) The constructed plasmid pK18mobsacB - △cgl1221 was electrotransformed into the competent cells of Corynebacterium glutamicum T-5 with high-yield L-glutamine (Corynebacterium glutamicum T-5 with high-yield L-glutamine has been disclosed in the patent publication CN113913356A). It was spread on a kanamycin-resistant LB plate with a concentration of 0.01 mg / mL and cultured at 32 °C for 24 h. Single colonies were selected for PCR, and the PCR fragments were examined by agarose gel electrophoresis. The length was the sum of the length of the recombinant fragment △cgl1221 and the length of the pK18mobsacB identification primer M13-47 (a gene sequence on pK18mobsacB used to identify whether homologous recombination occurred), which was 857 bp, and they were single colonies with single crossover.
[0068] (2) The single colonies with single crossover were inoculated into BHI shake tubes and cultured at 32 °C. 50 μL of the fermentation broth was spread on BHI plates containing 15% sucrose at 2 h, 4 h, and 6 h respectively and cultured at 32 °C for 24 h. The single colonies were spotted on BHI plates containing 15% sucrose and kanamycin LB plates with a concentration of 0.01 mg / mL. Single colonies that grew on the BHI plate containing 15% sucrose and did not grow on the kanamycin-resistant plate with a concentration of 0.01 mg / mL were selected, and colony PCR was performed using primers JD-cgl1221-up and JD-cgl1221-down. Detection by agarose gel electrophoresis showed a length of 1148 bp, which were single colonies with double crossover, i.e., successful knockout. The obtained strain was named T-5-1. As Figure 4 shown.
[0069] Example 2
[0070] Using the growth-coupled promoter P CP_2836 to replace the natural promoter of the cgl1129 gene:
[0071] 1. Construction of the pK18mobsacB – P CP2836 cgl1129 vector
[0072] (1) Using the genome of Corynebacterium glutamicum TCCC 11822 as a template, with the upstream homologous arm amplification primers cgl1129-up-S and cgl1129-up-A of the cgl1129 gene, the downstream homologous arm cgl1129-down-S and cgl1129-down-A, and the promoter P CP_2836Amplification primers CP-up-S and CP-down-A (where the 5' ends of cgl1129-up-S and cgl1129-down-A are respectively added with the linear vector homologous sequences of restriction endonucleases XbaI and KpnI, and cgl1129-up-A and cgl1129-down-S have homologous sequences), and the upstream and downstream homologous arm fragments are amplified and recovered.
[0073] (2)Using the amplified upstream and downstream homologous arms as templates and cgl1129-up-S and cgl1129-down-A as primers, overlap PCR is carried out to obtain the cgl1129 fragment CP-cgl1129 with P CP_2836 as the promoter.
[0074] (3)The plasmid pK18mobsacB is double digested with XbaI and KpnI, recombined with the overlapping fragment CP-cgl1129, transformed into competent Escherichia coli DH5α cells, and spread on a kanamycin-resistant LB plate with a concentration of 0.05 mg / mL for verification, and single colonies carrying the plasmid are screened out. Cultured in a BHI medium shake tube, and the plasmid pK18mobsacB – P CP2836 cgl1129 is obtained. As Figure 3 shown.
[0075] 2. Integration of the P CP-2836 cgl1129 gene
[0076] (1)The constructed plasmid pK18mobsacB – P CP2836 cgl1129 is electrotransformed into competent T-5-1 cells, spread on a kanamycin-resistant LB plate with a concentration of 0.01 mg / mL, and cultured at 32 °C for 24 h. Single colonies are selected for PCR, and the PCR fragments are examined by agarose gel electrophoresis. The length is the length of the recombinant fragment P CP-2836 cgl1129 plus the length of the pK18mobsacB identification primer M13-47 (a gene sequence on pK18mobsacB used to identify whether homologous recombination has occurred), which is 1056 bp, and it is a single colony with single crossover.
[0077] (2) Inoculate the single colonies that have undergone single crossover into BHI shake tubes and culture them at 32 °C. Take 50 μL of the fermentation broth at 2 h, 4 h, and 6 h respectively and spread it on BHI plates containing 15% sucrose, and culture at 32 °C for 24 h. Spot the single colonies onto BHI plates containing 15% sucrose and kanamycin LB plates with a concentration of 0.01 mg / mL. Pick the single colonies that grow on the BHI plates with 15% sucrose but do not grow on the kanamycin-resistant plates with a concentration of 0.01 mg / mL, and perform colony PCR using primers JD-cgl1129-up and JD-cgl1129-down. Detect by agarose gel electrophoresis, with a length of 1769 bp, which is the single colony with successful double crossover and knockout. The obtained strain is named T-5-2. As Figure 5 shown.
[0078] The primer sequences used for constructing the strains in the above examples are shown in Table 1.
[0079] The strains and plasmids in the above examples are shown in Table 2.
[0080] The results of fermenting glutamine by the strains in the above examples are shown in Table 3.
[0081] Table 1 Primer sequences for constructing strains
[0082]
[0083] Table 2 Strains and plasmids
[0084]
[0085] Table 3 Results of fermenting L-glutamine by each strain
[0086]
[0087] The genes involved in gene modification in the above examples are shown in the following table:
[0088] Table 4 Gene sequences involved in the present invention
[0089]
[0090] The specific steps of the fermentation production method of the above glutamine engineering strain are as follows:
[0091] 1) Inoculate the genetic engineering strain from a 20% glycerol preservation tube at -80 °C into a slant for activation culture, and the culture conditions are 32 °C and 12 h;
[0092] 2) Three 1 L first-stage seed shake flasks, with the seed medium fixed at 100 ml, at 32 °C, pH 7.0, and shake culture at 220 r / min for 10 h;
[0093] 3) Secondary seed culture in a 5 L fermenter. All of the primary seed liquid was inoculated into the 5 L fermenter for secondary seed culture. The culture medium was made up to 2 L, at 34 °C, pH 7.0, dissolved oxygen 30 - 50%, and cultured until OD 600 reached 40;
[0094] 4) Fermentation culture in a 5 L fermenter, inoculation amount 20%, culture medium made up to 3 L, at 34 °C, dissolved oxygen 30 - 50%, fermentation culture time 36 - 40 h;
[0095] The formula of the seed culture medium was: glucose 25 g / L, corn steep liquor dry powder 15 g / L, soy protein concentrate 15 mL / L, K2HPO4·3H2O 1 g / L, MgSO4·7H2O 1 g / L.
[0096] The formula of the fermentation culture medium was: K2HPO4·3H2O 1.8 g / L, V B 0.1 mg / L, soy protein concentrate 10 mL / L, corn steep liquor dry powder 4 g / L, MnSO4·H2O 10 mg / L, FeSO4, 10 mg / L, ZnSO4 5 mg / L, MgSO4·7H2O 1 g / L, (NH4)2SO4 60 g / L.
[0097] In the present invention, the glutamate transporter gene cgl1221 was knocked out, reducing the secretion of L-glutamate to the extracellular space, and at the same time providing more precursors for L-glutamine synthesis. The by-product L-glutamate production of the obtained engineered strain T-5-1 decreased by 54.8%, and the L-glutamine production increased by 17.1%; the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129 was replaced with the growth-dependent promoter P CP_2836 , and by means of dynamic regulation, the expression level of α-ketoglutarate dehydrogenase was relatively high in the early stage of fermentation to ensure the normal growth of the bacteria, and the expression level decreased during the stable fermentation stage, i.e., the acid production stage, so that more α-ketoglutarate metabolism flowed towards L-glutamine synthesis rather than the TCA cycle. The L-glutamine production of the obtained plasmid-free engineered strain T-5-2 reached 89.5 g / L, and the sugar-acid conversion rate reached 38.9%. The L-glutamine production of the plasmid-carrying strain T-6 reported in the Chinese patent publication CN113913356A was 84.3 g / L, and the sugar-acid conversion rate was 37.1%. It can be seen from this that through the dynamic regulation of the metabolic strategy, the L-glutamine fermentation level of T-5-2 is better than that of the plasmid-carrying strain T-6. The plasmid-free strain has higher stability in the industrial large-scale fermentation process, no antibiotic residue, and a broader application prospect.
[0098] The gene sequences in the present invention:
[0099] SEQ ID NO.1 cgl1221:
[0100] ATGACTACAACCTTGACTCGCCCCAAAATCGCGCTGCCCGCGCGCATCTATTCACCGCTTGCGGTGCTTGTTTTCTGGCAGCTCGGCTCGAGCCTGGGCGCCATCCCGGAGCGGATTCTGCCGGCACCAACCACGATCTTGGCCGCCAGCTGGGAGGTCGCCACAAATGGCACGCTTCTCGACGCCCTCCTCGTCTCAAGCCAACGCGTCCTTCTAGGCTTCGCCCTCGGTGCTGTCCTAGGCATTTCCCTAGGTGTATTGACAGGCATGTCCAGATTTGCAGACACCGCCGTTGATCCGCTCATTCAAGCTGCCCGCGCGCTGCCTCACCTGGGTCTTGTGCCGCTGTTTATCATCTGGTTCGGTATCGGTGAGCTGCCGAAAGTACTGATTATTAGCCTCGGCGTGCTGTATCCGCTGTACCTCAACACCGCCAGCGGGTTCAGGCAAATTGATCCAAAGCTTCTGGAAGCCGGCCACGTGATGGGCTTCGGATTTTTCCAGAGGTTGCGGACCATCATCATTCCTTCTGCCGCGCCGCAACTTTTTGTCGGCCTGCGCCAAGCAAGTGCGGCCGCCTGGCTCTCACTGATCGTGGCGGAACAGGTCAACGCCCGCGAAGGACTCGGCTTCCTCATCAACAATGCGCGCGATTTTTACCGCACCGACCTCGTTATTTTCGGCCTCATTGTCTACGCCAGCCTCGGTCTGCTGTCTGAAGCGCTGATCAGAGCTTGGGAACGTCACACCTTCCGCTACCGAAACGCATAA
[0101] SEQ ID NO.2 P CP2836 :
[0102] AAACATGCTTGTCGACGCCACTTTCTAGCAAATTAAGCGGGCACCTCCATTTATCTTTTGGAGGTGCCCGTTTCGTGCTTTCGCCAATTAGATACATGTATAACCACCCGAACAGGGGTAATAACTTTTGAAAGGCTTTCGGCGTTGAGCTGCGAGAATTTTGAGAAAAGGGGGTGAATTTAACGGGGGTTCTAGCGCGGATTGATTTTCGTGAATATGGTGGCTGCTAAGCGTGCGAATGTGCGCGTTGTCACAATCGTTGACCAAGTGTCACCTGACGCACAGGTAGTGCTCAGGTGGAGGTGGCCCAAAGGAGACCCA
[0103] SEQ ID NO.3 cgl1129:
[0104]
[0105] SEQ ID NO.4 pK18mobsacB plasmid:
[0106]
[0107] Although embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, changes, and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the content disclosed in the embodiments.
Claims
1. A genetically engineered strain for improving the fermentation yield and conversion rate of L-glutamine, characterized in that: The genetically engineered strain is based on Corynebacterium glutamicum T-5 with high-yield L-glutamine production, lacking the glutamate transporter gene cgl1221, and using the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129, and the genetically engineered bacterium T-5-2 is constructed, which is a genetically engineered strain that improves the fermentation yield and conversion rate of L-glutamine.
2. The genetically engineered strain according to claim 1, wherein: The gene cgl1221 is from Corynebacterium glutamicum, which is a wild gene, or a mutant encoding the corresponding protein or a gene modified artificially, including substitution, deletion or insertion of one or more amino acid residues at one or more sites. The protein encoded by the mutant or artificially modified gene has the corresponding activity and no functional defect.
3. The genetically engineered strain according to claim 1, wherein: The Corynebacterium glutamicum T-5 with high L-glutamine productivity was obtained by knocking out the glutamate synthase gene ncg10181 on the genome of Corynebacterium glutamicum TCCC 11822, i.e., CGMCC No. 1.16145, which blocked the formation of two molecules of L-glutamate from L-glutamine and α-ketoglutarate; knocking out the glutaminase gene ncg12395 to block the formation of L-glutamate from L-glutamine; and integrating one copy of the glutamine synthetase gene glnA from Bacillus subtilis bsu and one copy of the glutamine synthetase gene glnA from Lactobacillus acidophilus lcb , thereby enhancing the conversion of L-glutamate to L-glutamine.
4. The method for constructing a genetically engineered strain according to any one of claims 1 to 3, characterized in that: The method is obtained by gradually modifying T-5 using a gene editing technique that exchanges through the construction of pK18mobsacB. The steps are as follows: (1) Knock out the glutamate transporter-encoding gene cgl1221; (2) Use the growth-coupled promoter P CP-2836 to replace the natural promoter of the α-ketoglutarate dehydrogenase gene cgl1129; the operation order of steps (1) to (2) in the above steps is not limited and can be carried out in any order that can be implemented by those skilled in the art.
5. The construction method according to claim 4, characterized in that: The gene sequence of the glutamate transporter gene cgl1221 is SEQ ID NO.1; The growth-coupled promoter P CP-2836 has a gene sequence of SEQ ID NO.2; The gene sequence of the α-ketoglutarate dehydrogenase gene cgl1129 is SEQ ID NO.3; Alternatively, the gene editing technique includes constructing a plasmid related to pK18mobsacB, electrotransforming the constructed plasmid into electrotransformation-competent cells, and performing two-step exchange to finally obtain a recombinant genetic engineering strain; the gene sequence of the pK18mobsacB plasmid is SEQ ID NO.
4.
6. The construction method according to claim 5, characterized in that: The construction of the plasmid related to pK18mobsacB includes: constructing a DNA recombinant fragment for integration, and recombining the DNA recombinant fragment for integration with the linear vector fragment of pK18mobsacB; The construction of the recombinant fragment includes constructing a recombinant fragment for gene integration or constructing a recombinant fragment for gene knockout; among them, the steps for constructing a recombinant fragment for gene integration include: using the genome of the starting strain as a template, designing upstream and downstream homologous arm primers according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome, amplifying the target gene fragment, and then obtaining the recombinant fragment through PCR overlap technology.
7. Use of the genetic engineering strain according to any one of claims 1 to 3 in the fermentation production of L-glutamine.
8. A method for fermenting and producing L-glutamine using the genetically engineered strain according to any one of claims 1 to 3, characterized in that: It includes the following steps: contacting the genetic engineering strain with a fermentation medium and performing fermentation culture to prepare L-glutamine.
9. The method according to claim 8, wherein: The specific steps are as follows: 1) Inoculate the genetic engineering strain from a 20% glycerol preservation tube at -80 °C into a slant for activation culture, and the culture conditions are 32 °C for 12 h; 2) For three 1 L first-stage seed shake flasks, make up the volume of the seed medium to 100 mL, culture at 32 °C, pH 7.0, 220 r / min on a shaker for 10 h; 3) Secondary seed culture in a 5 L fermenter. All of the primary seed liquid is transferred into the 5 L fermenter for secondary seed culture. The culture medium is made up to 2 L, at 34 °C, pH 7.0, dissolved oxygen 30 - 50%, and cultured until OD 600 reaches 40; 4) Fermentation culture in a 5 L fermenter, with an inoculation amount of 20%, make up the volume of the medium to 3 L, at 34 °C, with a dissolved oxygen of 30 - 50%, and the fermentation culture time is 36 - 40 h; The formula of the seed medium is: glucose 25 g / L, corn steep liquor dry powder 15 g / L, soy protein concentrate 15 mL / L, K2HPO4·3H2O 1 g / L, MgSO4·7H2O 1 g / L; The formula of the fermentation medium is as follows: K2HPO4·3H2O 1.8 g / L, V B 0.1 mg / L, soybean protein concentrate 10 mL / L, corn steep liquor dry powder 4 g / L, MnSO4·H2O 10 mg / L, FeSO4 10 mg / L, ZnSO4 5 mg / L, MgSO4·7H2O 1g / L, (NH4)2SO4 60 g / L.
Citation Information
Patent Citations
Corynebacterium glutamicum strain for high yield of L-glutamine as well as construction method and application of corynebacterium glutamicum strain
CN113913356A