Escherichia coli for producing glutamic acid amino acids as well as construction method and application of escherichia coli

Abstract

The invention belongs to the technical field of microbial engineering and genetic engineering, and discloses escherichia coli for producing glutamic acid amino acids and a construction method and application thereof. The escherichia coli contains a growth dependent promoter PprpB of a methyl isocitrate lyase gene prpB and / or a stable phase dependent promoter PydgI of an ornithine reverse transport protein / lysine permease gene ydgI. According to the Escherichia coli for producing glutamic acid family amino acids, the expression of alpha-ketoglutarate dehydrogenase subunits is regulated by using a growth dependent promoter, and the expression of glutamate synthetase is regulated by using a stable phase dependent promoter, so that the cell growth and energy supply of thalli in a logarithmic phase can be realized; the stable phase glutamic acid group amino acid biosynthesis is required, so that the equilibrium distribution of metabolic flux between the growth of microbial cell factories and the synthesis of target products is effectively balanced.

Description

Technical Field

[0001] This invention relates to the fields of microbial engineering and genetic engineering technology, specifically to an Escherichia coli that produces glutamic acid amino acids, its construction method, and its applications. Background Technology

[0002] Glutamic acid group amino acids have wide applications in medicine, industry, food, cosmetics, animal husbandry and other fields, and have important economic and social value.

[0003] Currently, there are three main methods for producing glutamic acid group amino acids: microbial fermentation, chemical synthesis, and enzymatic catalysis. Among them, microbial fermentation has advantages such as a wide range of raw material sources, relatively simple production process, relatively small environmental impact, and high product purity, and has now become the mainstream method for producing glutamic acid group amino acids.

[0004] Improving the production performance of glutamate-related amino acids in chassis microorganisms is a sustainable goal of rational metabolic engineering breeding. In the process of systematically reconstructing the metabolic network of chassis microorganisms, enhancing or weakening the expression intensity of target genes is a common strategy to improve L-amino acid production performance. For example, increasing the expression of key enzymes in the target product synthesis pathway, increasing the expression of target product efflux membrane proteins, and increasing the expression of key enzymes in the target product precursor synthesis pathway have significant beneficial effects on improving L-amino acid production in chassis microorganisms. Furthermore, dynamic regulation of key metabolic targets in the target L-amino acid synthesis pathway can further balance cell growth and cell production, promoting the efficient synthesis of L-amino acids in microbial cell factories.

[0005] To achieve the optimal rate of target product synthesis, extensive trial-and-error experiments are often required to determine the appropriate target gene expression dose. Based on controlling the appropriate gene dose, regulating the expression intensity of target genes in the genome is an effective strategy for further optimizing the metabolic flux of the synthetic pathway. Gene expression regulation is a complex process involving the coordinated action of multiple expression regulatory elements. Promoter engineering can precisely control the transcription of target genes to address the challenge of multi-gene coordinated expression regulation in the target product synthesis metabolic network. Therefore, using promoter engineering to modify microbial genes shows promise. Summary of the Invention

[0006] The purpose of this invention is to address the problems of complex processes, high trial-and-error costs, and high operational difficulty in obtaining the optimal target product synthesis rate through gene expression regulation in existing technologies. This invention provides an *E. coli* strain that produces glutamate amino acids, its construction method, and its applications. This *E. coli* strain that produces glutamate amino acids utilizes growth-dependent promoters to regulate the expression of α-ketoglutarate dehydrogenase subunits and / or stationary-phase-dependent promoters to regulate glutamate synthase expression. This allows for the balance of cell growth and energy supply during the logarithmic growth phase and the biosynthesis of glutamate amino acids during the stationary phase, thereby effectively balancing the metabolic flux distribution between microbial cell factory cell growth and target product synthesis.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows: In a first aspect, the present invention provides an *Escherichia coli* strain that produces glutamate amino acids, said *Escherichia coli* containing a methyl isocitrate lyase gene. prpB growth-dependent promoter P prpB and / or ornithine reverse transporter / lysine permease gene ydgI The stable-period-dependent promoter P ydgI ;in, The methylisocitrate lyase gene prpB growth-dependent promoter P prpB The base sequence is shown in SEQ ID NO:1; and / or The ornithine reverse transporter / lysine permease gene ydgI The stable-period-dependent promoter P ydgI The base sequence is shown in SEQ ID NO:2.

[0008] In a second aspect, the present invention provides the application of Escherichia coli as described in the first aspect in the production of glutamate amino acids.

[0009] Thirdly, the present invention provides a method for producing glutamic acid family amino acids, the method comprising: culturing a bacterial strain on an agar slant, seed culture, inoculating onto a glucose fermentation medium, shaking culture, and, after the base sugar is depleted, adding glucose containing betaine; wherein... The bacterial strain is the *Escherichia coli* described in the first aspect.

[0010] In the above technical solution, the inventors discovered two dynamically regulated promoters triggered by betaine during the research process: one based on the growth-dependent promoter P. prpB (Growth phase-dependent promoter, GPP), stationary phase-dependent promoter P ydgI(Stationary phase-dependent promoter, SPP) is a gene dynamic regulatory element. Therefore, this invention employs two regulatory mechanisms to target the α-ketoglutarate node α-ketoglutarate dehydrogenase subunit (composed of…) in the tricarboxylic acid cycle (TCA). sucA The gene encodes (NCBI-GeneID:945303, EC:1.2.4.2) and glutamate dehydrogenase (produced by...). gdhA The gene (NCBI-GeneID:946802, EC:1.4.1.4) is used to dynamically regulate the promoter for fine-tuning of redirected carbon flux distribution.

[0011] Furthermore, the specific procedure involves removing E. coli... sucA The original promoter of the gene is replaced with a growth-dependent promoter P. prpB To achieve the logarithmic growth phase of cells sucA Gene expression is normal and transcribed expression is normal. gdhA Low transcriptional expression of the gene ensures sufficient metabolic flux in the TCA cycle for the synthesis of energy ATP and various primary metabolites, and maintains normal cell growth; gdhA The original promoter of the gene is replaced with a stationary-dependent promoter P. ydgI To achieve P when microbial cells are in a stable growth phase ydgI Regulation gdhA Gene expression automatically switches to high transcriptional expression while P prpB Automatic control sucA The gene is expressed at low levels to redirect more metabolic flux to the synthesis of L-glutamate amino acids. Sufficient metabolic flux of the tricarboxylic acid cycle is achieved during the logarithmic growth phase by adding betaine fermentation to meet the energy requirements of the strain growth and the synthesis of various primary metabolites. When the strain reaches the stationary phase, more metabolic flux is directed to the synthesis of L-glutamate amino acids, thereby improving the synthesis efficiency of target amino acids.

[0012] The Escherichia coli for producing glutamate amino acids provided by this invention can dynamically regulate the carbon flux orientation of the α-ketoglutarate metabolic node according to the needs of different fermentation stages, thereby improving the synthesis efficiency of glutamate amino acids.

[0013] Other features and advantages of the present invention will be described in detail in the following detailed description section. Attached Figure Description

[0014] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used together with the following detailed description to explain the invention, but do not constitute a limitation thereof. In the drawings: Figure 1 This is a schematic diagram illustrating the dynamic regulation of α-ketoglutarate metabolic flux distribution in Escherichia coli that produces glutamate amino acids according to the present invention. Figure 2 pGRB plasmid map; Figure 3 This is a map of the pREDCas9 plasmid. Detailed Implementation

[0015] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the invention. The scope and nature of the invention are defined solely by the claims. Unless otherwise specified, the technical means used in this invention are methods well-known to those skilled in the art. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments, without departing from the scope and nature of the invention, are also within the protection scope of this invention.

[0016] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0017] In this invention, the glutamic acid group amino acids can be L-glutamic acid, L-theanine, L-arginine, L-ornithine, or L-citrulline.

[0018] In a first aspect, the present invention provides an *Escherichia coli* strain that produces glutamate amino acids, said *Escherichia coli* containing a methyl isocitrate lyase gene. prpB growth-dependent promoter P prpB and / or ornithine reverse transporter / lysine permease gene ydgI The stable-period-dependent promoter P ydgI ;in, The methylisocitrate lyase gene prpB growth-dependent promoter P prpB The base sequence is shown in SEQ ID NO:1; The ornithine reverse transporter / lysine permease gene ydgI The stable-period-dependent promoter P ydgI The base sequence is shown in SEQ ID NO:2.

[0019] SEQ ID NO:1 TGAAATTAAACATTTAATTTTATTAAGGCAATTGTGGCACACCCCTTGCTTTGTCTTTATCAACGCAAATAACAAGTTGATAGGAAACAGACC SEQ ID NO:2 CTCCTATCAGGTTGCGAAACGTGCCGCGAAGAAAGGTGCTAAGTATTACCACATCACCCGCCAGTGGCAGGAACGTGGTAATAACCTGACCGTCAGCGCAGATCTGTATAAATAACTATTCAGTTACTCCTATAAGGCGGCTTGATGCCG CCTTTCGCATTTTTAGTCACAAATTTCCCCGCGACCATTGCATGCAGACACATCTCTTCGTAAAATCCCGCGCTTCAGTGGCAAACTCCATTTTTATGCGTTTTGCCCTAATATTTATTCTTCTTATCACGTTTTAATCACTGGATATCG In a preferred embodiment of the present invention, the α-ketoglutarate dehydrogenase subunit gene of *E. coli* is described. sucA The original promoter P sucA Replace with a growth-dependent promoter P whose base sequence is shown in SEQ ID NO:1. prpB .

[0020] In a preferred embodiment of the present invention, the *E. coli* glutamate synthase gene gdhA The original promoter P gdhA Replace with a stability-dependent promoter P as shown in SEQ ID NO:2 ydgI .

[0021] In a preferred embodiment of the present invention, the α-ketoglutarate dehydrogenase subunit gene of *E. coli* is described. sucA The original promoter P sucA Replace with a growth-dependent promoter P whose base sequence is shown in SEQ ID NO:1. prpB and / or glutamate synthase gene gdhA The original promoter P gdhA Replace with a stability-dependent promoter P as shown in SEQ ID NO:2 ydgI .

[0022] In a second aspect, the present invention provides the application of Escherichia coli as described in the first aspect in the production of glutamate amino acids.

[0023] Thirdly, the present invention provides a method for producing glutamic acid family amino acids, the method comprising: culturing a bacterial strain on an agar slant, seed culture, inoculating onto a glucose fermentation medium, shaking culture, and, after the base sugar is depleted, adding glucose containing betaine; wherein... The bacterial strain is the *Escherichia coli* described in the first aspect.

[0024] In a preferred embodiment of the present invention, the slant culture step includes: streaking the -80℃ preserved strain onto the activated slant, culturing at 37℃ for 12 h, and subculturing once to obtain slant seed.

[0025] In a preferred embodiment of the present invention, the seed culture step includes: scraping a ring of the slanted seeds with an inoculation loop and inoculating them into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, sealing the flask with nine layers of gauze, and culturing at 37°C and 200 rpm for 7-10 h to obtain the seed culture solution.

[0026] In a preferred embodiment of the present invention, the conditions for the shaking culture include: inoculating the seed culture liquid at a rate of 10% of the volume into a 500 mL Erlenmeyer flask containing fermentation medium, sealing the flask with nine layers of gauze, operating at 37°C, 200 r / min, with a pH of 7.0-7.2, a fermentation period of 26-30 h, and dissolved oxygen of 30%-40%.

[0027] In a preferred embodiment of the present invention, the final volume of the fermentation medium after inoculation is 30 mL.

[0028] In a preferred embodiment of the present invention, the betaine concentration in the betaine-containing glucose is 1 g / L, and the glucose mass fraction is 60%.

[0029] In a preferred embodiment of the present invention, the mass concentration of glucose in the shaking culture is <5 g / L.

[0030] The present invention will be described in more detail below through embodiments.

[0031] (1) Methods and apparatus used in the embodiments Unless otherwise specified, the experimental methods and equipment described in the following embodiments are conventional methods and equipment.

[0032] (2) Culture media, bacterial cells and enzymes used in the examples Slant culture medium: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast extract 1-5 g / L, NaCl 1-2.5 g / L, agar 15-20 g / L, the remainder being water, pH 7.0-7.2.

[0033] Seed culture medium: glucose 20-40 g / L, yeast extract 2-5 g / L, peptone 2-4 g / L, K₂HPO₄ 1-3 g / L, MgSO₄·7H₂O 1-2 g / L, FeSO₄·7H₂O 15-20 mg / L, MnSO₄·3H₂O 15-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 1-3 mg / L, the remainder being water, pH 7.0-7.2.

[0034] Fermentation medium: glucose 20-40 g / L, yeast extract 1-3 g / L, peptone 2-3 g / L, K₂HPO₄ 3-6 g / L, MgSO₄·7H₂O 1-2 g / L, FeSO₄·7H₂O 15-20 mg / L, MnSO₄·3H₂O 15-20 mg / L, V B1 V B3 V B5 V B12 V H Each component is 1-3 mg / L, the remainder is water, pH 7.0-7.2.

[0035] All recombinant enzymes used were from the ClonExpress® II One Step Cloning Kit series.

[0036] The HS enzyme was purchased from Takara Bio's PrimeSTAR.

[0037] (3) Sequence The primer sequences used in the examples are shown in Table 1: Table 1

[0038] (4) Reaction system and reaction conditions The annealing system and reaction conditions are shown in Table 2: Table 2

[0039] The recombination system and reaction conditions are shown in Table 3: Table 3

[0040] The PCR amplification system is shown in Table 4: Table 4

[0041] The overlapping PCR amplification system is shown in Table 5: Table 5

[0042] Note: The template consists of equimolar amounts of amplified fragments from upstream and downstream homologous arms and the target gene, and the total amount does not exceed 10 ng.

[0043] The reaction conditions for the PCR amplification system and the overlap PCR amplification system are shown in Table 6: Table 6

[0044] Note: Tm value is the melting temperature of DNA, and in this invention, it refers to the melting temperature values ​​of the indicator and the product.

[0045] (5) Gene editing methods The gene editing method used in this invention is based on the literature (Li Y, Lin Z, Huang C, et al Metabolic engineering of Escherichia coli The procedure was performed using CRISPR-Cas9 meditated genome editing. Metabolic Engineering, 2015, 31: 13-21. The two plasmid maps used in this method are shown in [link to article]. Figure 2 The pREDCas9 plasmid carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system. It is resistant to zirconia (working concentration: 100 mg / L) and cultured at 32℃. pGRB uses pUC18 as its backbone and includes the promoter J23100, the gRNA-Cas9 binding region sequence, and the terminator sequence. It is resistant to ampicillin (working concentration: 100 mg / L) and cultured at 37℃.

[0046] Example 1: This embodiment illustrates the construction of the *Escherichia coli* strain for producing glutamic acid amino acids according to the present invention. Specifically, it can be the construction of genetically engineered bacteria HCBGLU1, HCBTHE4, HCBARG1, HCBORN5, or HCBCIT4.

[0047] Using the Escherichia coli genome as a template, based on its sucA Design upstream homologous arm primers based on upstream and downstream sequences of the gene (NCBI GeneID: 945303). sucA -UPS, sucA - prpB -UP-A) and downstream homologous arm primers ( prpB - sucA -DN-S、 sucA -DN-A), where the upstream and downstream homologous arms contain prpB The promoter sequence was determined, and its upstream and downstream homologous arm fragments were amplified by PCR. These fragments were then fused using overlap PCR to obtain P. sucA ::P prpB Promoter replacement fragment (upstream homologous arm - downstream homologous arm). Construct pGRB- sucA The DNA fragment containing the target sequence used is transmitted via primer gRNA- sucA -S and gRNA- sucA -A is obtained by annealing. According to its gdhA Design upstream homologous arm primers based on upstream and downstream sequences of the gene (NCBI GeneID: 946802). gdh -UPS, gdh - ydgI -UP-A), ydgI promoter primers ( ydgI -S、 ydgI -A) and downstream homologous arm primers ( ydgI - gdh -DN-S、 gdh -DN-A), where the upstream and downstream homologous arms contain ydgI The promoter sequence was determined, and its upstream and downstream homologous arm fragments were amplified by PCR. These fragments were then fused using overlap PCR to obtain P. gdhA ::P ydgI Promoter replacement fragment (upstream homologous arm - downstream homologous arm). Construct pGRB- gdhA The DNA fragment containing the target sequence used is transmitted via primer gRNA- gdh -S and gRNA- gdh -A is obtained by annealing.

[0048] Prepare separately Escherichia coli Competent cells of strains MG1655, HCBTHE3, HCBARG0, HCBORN4, or HCBCIT3 were constructed iteratively according to steps (3) and (4) below, sequentially constructing cells with P... sucA ::P prpB and P gdhA ::P ydgI Engineered strains with regulated gene expression include HCBGLU1, HCBTHE4, HCBARG1, HCBORN5, or HCBCIT4. Among them, engineered strain HCBTHE3 is derived from wild-type Escherichia coli. E. coli Starting with MG1655, methyl-eating bacteria were introduced. Methylovorus mays Source: γ-glutamylcarbamate synthase gene gmasThe recombinant strain (GenBank: AB333782.1); the engineered strain HCBARG0 is... E. coli Starting with MG1655, knock out genes encoding repression factors in the genome. argR Genes were introduced from Corynebacterium glutamicum. Corynebacterium glutamicum ATCC 13032 argC - argJ - argB - argD - argF and argG - argH L-arginine synthesis operon gene (NCBI-GeneID: argC :1019370 argJ :1019371、 argB :1019372、 argD :1019373、 argF :1019374、 argG :1019376、 argH The recombinant strain HCBORN4 (1019377) is an engineered strain. E. coli Starting with MG1655, the encoded repression factors are knocked out sequentially. argR Gene, encoding ornithine decarboxylase speC and speF Genes, and the source of introduction C. glutamicum ATCC 13032 argC - argJ - argB - argD Recombinant strains of the L-ornithine synthesis operon gene; engineered strain HCBCIT3 is... E. coli Starting with MG1655, knock out the encoded repression factor. argR Genes, and the source of introduction C. glutamicum ATCC 13032 argC - argJ - argB - argD - argF The L-citrulline synthesis operon gene was enhanced, and the anti-feedback acetylglutamate kinase encoded by E. coli was strengthened. argB Recombinant strains of genes.

[0049] The sources and descriptions of the genetically engineered bacteria in this embodiment are summarized in Table 7: Table 7

[0050] (1) Construction of pGRB plasmid: The purpose of constructing pGRB plasmid is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and to achieve double-strand breaks in the target DNA by recognizing the target gene site through base pairing and PAM. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment, and the specific steps are as described in step af below.

[0051] a. Target sequence design: The target sequence (PAM: 5'-NGG-3') was designed using CRISPR RGEN Tools; b. Preparation of DNA fragments containing the target sequence: Design primers: 5'-linearized vector terminal sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector terminal sequence (15 bp)-3' and its reverse complementary primers, and prepare DNA fragments containing the target sequence by annealing single-stranded DNA. c. Preparation of linear vectors: The vectors were linearized using reverse PCR amplification. d. Recombination reaction; e. Plasmid transformation: Take 10 μL of reaction solution and add it to 100 mL of DH5α-transformed competent cells. Gently mix and incubate on ice for 20 min. Heat shock at 42℃ for 45-90 s, then immediately incubate on ice for 2-3 min. Add 900 μL of SOC and incubate at 37℃ for 1 h. Centrifuge at 8000 rpm for 2 min, discard part of the supernatant, and resuspend the bacterial cells in about 200 μL. Spread the resuspended cells onto a plate containing 100 mg / L ampicillin. Invert the plate and incubate overnight at 37℃. After single cells grow on the plate, identify them by colony PCR and select positive recombinants. f. Cloning identification: PCR-positive colonies were inoculated into LB medium containing 100 mg / L ampicillin and cultured overnight. Plasmids were then extracted and identified by enzyme digestion.

[0052] (2) Preparation of recombinant DNA fragments: The recombinant fragments used for promoter replacement are prepared by... sucA and gdhA The gene's upstream and downstream homologous arms are composed (upstream homologous arm - downstream homologous arm). Primer design software Primer5 was used to... sucA and gdhA Using the upstream and downstream sequences of the gene as templates, primers for upstream and downstream homologous arms (approximately 400-500 bp in length) were designed. The upstream and downstream homologous arms and the target gene fragment were amplified separately by PCR, followed by overlap PCR to prepare the recombinant fragment. The PCR system and method are shown in the table below: (3) Transformation of plasmids and recombinant DNA fragments a. Transformation of pREDCas9: The pREDCas9 plasmid was electroporated into the electrocompetent cells of the starting strain. After cell resuscitation and culture, the cells were plated on LB agar plates containing zizomycin and incubated overnight at 32°C. Single colonies growing on the resistant plates were subjected to colony PCR using identification primers to screen for positive recombinants. b. Preparation of electroconversion competent cells of the target strain containing pREDCas9: cultured at 32℃ until OD 600 When the concentration reaches 0.1–0.2, add 0.1 M IPTG (to bring the final concentration to 0.1 mM) and continue culturing until OD reaches 0.2. 600 Competent cells were prepared when the pH was 0.6–0.7. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process for competent cells followed standard operating procedures. c. Transformation of pGRB and recombinant DNA fragment: pGRB and donor DNA fragment were simultaneously electroporated into electrocompetent cells containing pREDCas9. The revived cells after electroporation were plated on LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Colony PCR was performed using specially designed identification primers to verify the colonies, screen for positive recombinants, and maintain the cells. (4) Plasmid elimination a. Elimination of pGRB: Positive recombinants were incubated overnight in LB medium containing 0.2% arabinose. After appropriate dilution, they were spread onto LB plates containing zirconia-resistant bacteria and incubated overnight at 32°C. Single colonies that did not grow on ampicillin-resistant plates but grew on zirconia-resistant plates were selected and preserved.

[0053] b. Elimination of pREDCas9 plasmid: The positive recombinant was transferred to antibiotic-free LB liquid medium and incubated overnight at 42°C. After appropriate dilution, it was plated onto antibiotic-free LB plates and incubated overnight at 37°C. Single colonies that did not grow on bilirubin-resistant plates and grew on antibiotic-free plates were selected for preservation.

[0054] Example 2: This embodiment is used to illustrate the use of P sucA ::P prpB and P gdhA ::P ydgI A method for producing L-amino acids by fermentation of Escherichia coli with regulated gene expression.

[0055] (1) Slant culture: Take the -80℃ preserved strain and streak it onto the activated slant, incubate at 37℃ for 12 h, and subculture once; (2) Shake flask seed culture: Use an inoculation loop to scrape a loop of slanted seeds and inoculate them into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. Seal the flask with nine layers of gauze and culture at 37℃ and 200 rpm for 7-10 h. (3) Shake flask fermentation culture: Inoculate 10% of the seed culture liquid volume into a 500 mL Erlenmeyer flask containing fermentation medium (final volume is 30 mL), seal with nine layers of gauze, and culture at 37℃ and 200 r / min with shaking. During fermentation, the pH is maintained at 7.0-7.2 by adding ammonia water; 60% (m / v) glucose solution is added to maintain fermentation; the fermentation cycle is 26-30 h; during fermentation, the pH is adjusted to 6.8-7.2 by ammonia water, and the DO is controlled at 30%-40%. When the bottom sugar is exhausted, 60% glucose containing 1 g / L betaine is added. The glucose concentration is controlled below 5 g / L throughout the fermentation process.

[0056] Example 3: Promoter modification P sucA ::P prpB and P gdhA ::P ydgI The engineered strain HCBGLU1 and the originating strain E. coli Differences in L-glutamic acid production performance in MG1655.

[0057] The culture method described in Example 2 was used to culture HCBGLU1 and the starting strain. E. coli MG1655 was used for shake-flask fermentation. The concentration of L-glutamate in the fermentation supernatant was measured, and the results are shown in Table 8.

[0058] Table 8

[0059] As shown in Table 8, the promoter modifies P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; however, it increased the L-glutamate concentration in HCBGLU1 from 1.90 g / L to 2.14 g / L, and increased the L-glutamate yield by 12.6%. The results showed that it had a significant effect on the growth of *E. coli*. sucA as well as gdhA Dynamic regulation of the betaine response by the promoter can significantly improve the L-glutamic acid production performance of engineered strains.

[0060] Example 4: Promoter modification P sucA ::P prpB and P gdhA ::PydgI The difference in L-theanine production performance between the engineered strain HCBTHE4 and the original strain HCBTHE3.

[0061] The culture method described in Example 2 was used to culture HCBTHE4 and the starting strain HCBTHE3 in shake flasks. The concentration of L-theanine in the fermentation supernatant was measured, and the results are shown in Table 9.

[0062] Table 9

[0063] As shown in Table 9, the promoter modifies P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; however, it increased the L-theanine concentration in HCBTHE4 from 2.96 g / L to 3.38 g / L, and increased the L-theanine yield by 14.2%. The results showed that it had a significant effect on the growth of *E. coli*. sucA as well as gdhA Dynamic regulation of the betaine response by the promoter can significantly improve the L-theanine production performance of engineered strains.

[0064] Example 5: Promoter modification P sucA ::P prpB and P gdhA ::P ydgI The difference in L-arginine production performance between the engineered strain HCBARG1 and the original strain HCBARG0.

[0065] The engineered strain HCBARG1 and the starting strain HCBARG0 were cultured in shake flasks using the culture method described in Example 2. The concentration of L-arginine in the fermentation supernatant was measured, and the results are shown in Table 10.

[0066] Table 10

[0067] As shown in Table 10, the promoter modifies P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; however, it increased the L-arginine concentration in HCBARG1 from 6.58 g / L to 7.24 g / L, and increased the L-arginine yield by 10.1%. The results showed that it had a significant effect on the growth of *E. coli*. sucA as well as gdhA Dynamic regulation of the betaine response by the promoter can significantly improve the L-arginine production performance of engineered strains.

[0068] Example 6: Promoter modification P sucA ::P prpB and P gdhA ::P ydgI The difference in L-ornithine production performance between the engineered strain HCBORN5 and the original strain HCBORN4.

[0069] The culture method described in Example 2 was used to perform shake-flask fermentation of the starting strain HCBORN5 and the initiating strain HCBORN4. The concentration of L-ornithine in the fermentation supernatant was measured, and the results are shown in Table 11.

[0070] Table 11

[0071] As shown in Table 11, the promoter modifies P sucA ::P prpB and P gdhA ::P ydgI It did not significantly affect the growth of the engineered strain; however, it increased the L-ornithine concentration in HCBORN5 from 4.72 g / L to 5.47 g / L, and increased the L-ornithine yield by 15.8%. The results showed that it had a significant effect on the growth of *E. coli*. sucA as well as gdhA Dynamic regulation of the betaine response by the promoter can improve the L-ornithine production performance of engineered strains.

[0072] Example 7: Promoter modification P sucA ::P prpB and P gdhA ::P ydgI The difference in L-citrulline production performance between the engineered strain HCBCIT4 and the original strain HCBCIT3.

[0073] The engineered strain HCBCIT4 and the starting strain HCBCIT3 were cultured in shake flasks using the culture method described in Example 2. The concentration of L-citrulline in the fermentation supernatant was measured, and the results are shown in Table 12.

[0074] Table 12

[0075] As shown in Table 12, the promoter modifies P sucA ::P prpB and P gdhA ::P ydgIIt did not significantly affect the growth of the engineered strain; however, it increased the L-citrulline concentration in the engineered strain HCBCIT4 from 9.54 g / L to 10.44 g / L, and increased the L-citrulline yield by 9.5%. The results showed that it had a significant effect on the growth of *E. coli*. sucA as well as gdhA Dynamic regulation of the betaine response by the promoter can significantly improve the L-citrulline production performance of engineered strains.

[0076] As can be seen from the above embodiments, wild-type Escherichia coli Escherichia coli MG1655 is the starting strain, regulated by two different types of promoters. sucA and gdhA Gene expression increased the L-glutamate concentration in this strain from 1.90 g / L to 2.14 g / L, resulting in a 12.6% increase in L-glutamate production. Using an HCBTHE3 strain capable of L-theanine synthesis as the starting strain, the expression was regulated by two different types of promoters. sucA and gdhA Gene expression increased the concentration of L-theanine in this strain from 2.96 g / L to 3.38 g / L, resulting in a 14.2% increase in L-theanine production. Using an HCBARG0 strain capable of L-arginine synthesis as the starting strain, the expression was regulated by two different types of promoters. sucA and gdhA Gene expression increased the L-arginine concentration in this strain from 6.58 g / L to 7.24 g / L, resulting in a 10.1% increase in L-arginine production. Using an engineered strain HCBORN4 with L-ornithine synthesis capabilities as the starting strain, two different types of promoters were used to regulate... sucA and gdhA Gene expression increased the L-ornithine accumulation concentration in this strain from 4.72 g / L to 5.47 g / L, resulting in a 15.8% increase in L-ornithine production. Using an HCBCIT3 strain capable of L-citrulline synthesis as the starting strain, the expression was regulated by two different types of promoters. sucA and gdhA Gene expression increased the concentration of L-citrulline accumulation in this strain from 9.54 g / L to 10.44 g / L, and increased L-citrulline production by 9.5%.

[0077] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0078] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

[0079] Furthermore, various different embodiments of the present invention can be combined in any way, as long as they do not violate the spirit of the present invention, they should also be regarded as the content disclosed by the present invention.

Claims

1. An Escherichia coli that produces glutamic acid group amino acids, characterized in that, The *E. coli* contains a growth-dependent promoter P with the base sequence shown in SEQ ID NO:

1. prpB and / or a stationary-dependent promoter P with a base sequence as shown in SEQ ID NO:2 ydgI .

2. The *Escherichia coli* according to claim 1, characterized in that, The α-ketoglutarate dehydrogenase subunit gene of *E. coli* sucA The original promoter P sucA Replace with a growth-dependent promoter P whose base sequence is shown in SEQ ID NO:

1. prpB ; and / or the glutamate synthase gene of the *E. coli*. gdhA The original promoter P gdhA Replace with a stability-dependent promoter P as shown in SEQ ID NO:2 ydgI .

3. The application of Escherichia coli as described in claim 1 or 2 in the production of glutamic acid amino acids.

4. A method for producing glutamic acid family amino acids, characterized in that, The method includes: culturing the bacterial strain on an agar slant, seed culture, inoculating it onto a glucose fermentation medium, shaking culture, and adding glucose containing betaine after the base sugar is depleted; wherein the bacterial strain is Escherichia coli as described in claim 1 or 2.

5. The method according to claim 4, characterized in that, The steps of the slant culture include: streaking the -80℃ preserved strain onto the activated slant, culturing at 37℃ for 12 h, and subculturing once to obtain slant seed.

6. The method according to claim 5, characterized in that, The seed culture steps include: scraping a loop of the slanted seeds with an inoculation loop and inoculating them into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, sealing the flask with nine layers of gauze, and culturing at 37℃ and 200 rpm for 7-10 h to obtain the seed culture solution.

7. The method according to claim 6, characterized in that, The conditions for the shaking culture include: inoculating 10% of the seed culture volume into a 500 mL Erlenmeyer flask containing fermentation medium, sealing with nine layers of gauze, 37℃, 200 r / min, pH 7.0-7.2, fermentation cycle of 26-30 h, and dissolved oxygen of 30%-40%.

8. The method according to claim 7, characterized in that, The final volume of the fermentation medium after inoculation is 30 mL.

9. The method according to any one of claims 4-8, characterized in that, The betaine in the glucose containing betaine has a mass concentration of 1 g / L and a glucose mass fraction of 60%.

10. The method according to any one of claims 4-9, characterized in that, The glucose concentration in the shaking culture was <5 g / L.

Images