Ultra-sensitive target nucleic acid enrichment detection method based on programmable nuclease

Abstract

The invention discloses an ultra-sensitive target nucleic acid enrichment detection method based on programmable nuclease, and belongs to the technical field of biology. According to the enrichment method disclosed by the invention, on the basis of specific cutting of programmable nuclease, wild type nucleic acid can be continuously removed while isothermal amplification is carried out, so that the number of mutant alleles in a sample is continuously and exponentially increased, and low-abundance mutant genes or methylated DNA are enriched or detected. According to the present invention, sgRNA, guide DNA or guide RNA are designed and optimized, the sgRNA, the guide DNA or the guide RNA and a Cas protein or an Ago protein are used to form a ribonucleoprotein complex, the isothermal amplification is performed while the specific cutting is performed on the target gene, the mutation-containing gene is not cut, and the low-abundance mutation gene is enriched;

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a super-sensitive target nucleic acid enrichment and detection method based on programmable nucleases. Background Art

[0002] Somatic mutations are closely related to tumorigenesis. Mutation detection is of great significance for early disease screening, precise treatment decision-making, and recurrence monitoring. In recent years, non-invasive diagnosis represented by liquid biopsy has become a trend. Liquid biopsy analyzes the genotype of tumors by detecting free nucleic acid fragments derived from tumors in body fluids, and has the advantages of non-invasiveness and easy implementation of dynamic monitoring. However, liquid biopsy faces the following problems: 1) Mutant nucleic acids have high sequence homology with wild-type nucleic acids, usually only differing by one or a few nucleotides, which poses a challenge to identifying low-abundance mutant alleles among a large number of free wild-type alleles; 2) The detection of low-abundance methylated genes in body fluids also faces the same problem. Methylated genes have the same sequence as non-methylated genes, only differing in base modification, which poses a challenge to identifying low-abundance methylated genes among a large number of free non-methylated genes.

[0003] Currently, high-sensitivity detection of mutant alleles usually uses next-generation sequencing (NGS) or brute-force counting relying on digital PCR to detect weak signals. Especially in the detection of minimal residual disease (MRD), for extremely low-abundance mutant genes, it mainly relies on ultra-deep (50000X) NGS sequencing, which has the problems of high cost, long time consumption, and difficulty in popularizing to the clinic. Therefore, there is an urgent need to develop a low-cost super-sensitive method for detecting extremely low-abundance mutant alleles to promote clinical applications.

[0004] In recent years, diagnostic technologies based on CRISPR-Cas programmable nucleases have become a research hotspot. The CRISPR-Cas system is an adaptive immune defense system formed by archaea and most bacteria during biological evolution to resist virus invasion. It consists of Cas effector proteins and guide RNAs. Under the guidance of guide RNAs, Cas proteins recognize and cleave target sequences containing 5'-end PAM sites. The low-abundance mutant allele detection method based on CRISPR-Cas aims to specifically cleave wild-type alleles by special guide RNA design, removing a large amount of wild-type nucleic acids and retaining mutant alleles to improve the sensitivity of downstream analysis. At the same time, some researchers have also established a similar low-abundance mutant allele detection method based on Argonaute protein (Ago) by forming a complex with guide DNA.

[0005] The cleavage of Cas proteins is restricted by PAM sites. When mutations lead to the destruction of PAM sites, in the same sample, Cas proteins target and cleave a large number of wild-type nucleic acids while retaining mutant nucleic acids. Researchers have developed low-abundance mutant allele detection methods such as DASH (Depletion of Abundant Sequences by Hybridization) and CUT-PCR for mutations located at PAM sites. Argonaute proteins are not restricted by PAM sites, and researchers have developed NAVIGATER (Nucleic Acid enrichment Via DNA Guided Argonaute from Thermusthermophilus) low-abundance mutant allele detection methods.

[0006] Although the DASH method and CUT-PCR have improved the sensitivity of downstream analysis to a certain extent, the effectiveness of existing programmable endonuclease-based detection methods is affected by ineffective binding events between the enzyme and the target. Since the dissociation efficiency of cas9 is very slow, some wild-type allele targets are protected from being cut, and non-specific off-target cutting will deplete extremely rare mutant alleles. NAVIGATER also has similar problems. To overcome these shortcomings, researchers used multiple rounds of selective cutting of wild-type alleles, followed by polymerase chain reaction, to enrich the fragments of mutant alleles by 10 times. Despite these improvements, the high sensitivity of mutant allele detection still requires the use of next generation sequencing (NGS) or relies on digital PCR, making these methods laborious, time-consuming and expensive.

[0007] For low-abundance methylated gene detection in liquid biopsy, the above technologies have similar problems and are difficult to meet the requirements. Summary of the invention

[0008] The purpose of the present invention is to provide an ultra-sensitive tumor-related gene enrichment method based on programmable nucleases. The method of the present invention can efficiently enrich low-abundance mutant genes and methylated genes, and the microfluidic chip technology is used to automate the method of the present invention.

[0009] In order to achieve the above-mentioned invention object, the following technical scheme is adopted: A ribonucleoprotein complex comprising: Component (a) comprises a nucleic acid region capable of complementary pairing with a target nucleic acid and a 0-4 bp mismatch fragment; or a nucleic acid region capable of complementary pairing with a target nucleic acid and an adjacent PAM including a mutation-prone site; Component (b), capable of binding to the target nucleic acid and cleaving the target nucleic acid strand; Wherein, component (a) is selected from guide DNA and / or guide RNA; component (b) includes Ago protein and / or Ago protein derivatives; components (a) and (b) can bind. Preferably, component (a) can carry a label, and the label includes streptavidin or biotin.

[0010] Preferably, the length of the mismatched nucleotide fragment is 0bp or 1bp or 2bp or 3bp or 4bp.

[0011] Preferably, component (a) carries a chemical modification, and the chemical modification includes sulfur substitution for oxygen or methoxy modification.

[0012] Preferably, the guide DNA or guide RNA in component (a) includes a mismatched nucleotide fragment. The mismatched nucleotide fragment designed in the present invention is beneficial to expanding the use range of guide DNA or guide RNA, and can enable guide DNA or guide RNA to recognize more mutations.

[0013] More preferably, the guide DNA sequence is as follows: Forward guide: p-TAGATTTCACTGTAGC-3’ (SEQ ID NO.43); Reverse guide: p-TTCTAGCTACAGTGAA -3’ (SEQ ID NO.44).

[0014] Preferably, component (b) includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

[0015] Preferably, in the ribonucleoprotein complex, the final concentration of component (a) is 0.1 - 2 μM.

[0016] Preferably, in the ribonucleoprotein complex, the final concentration of component (b) is 0.1 - 3 μM.

[0017] Preferably, the ribonucleoprotein complex further includes a hydrogen ion buffer.

[0018] More preferably, in the ribonucleoprotein complex, the final concentration of the hydrogen ion buffer is 1 mM - 2 M.

[0019] The present invention also discloses the use of the above ribonucleoprotein in enriching and / or detecting mutant genes.

[0020] The present invention also discloses the use of the above ribonucleoprotein in enriching and / or detecting methylated DNA.

[0021] Preferably, the gene includes at least one of the following: EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

[0022] The present invention also discloses a method for preparing a ribonucleoprotein complex, comprising: mixing and incubating Ago, guide DNA or RNA, and a hydrogen ion buffer.

[0023] Preferably, the hydrogen ion buffer includes HEPES.

[0024] Preferably, in the preparation of the ribonucleoprotein complex, the final concentration of HEPES used is 1 mM - 2 M.

[0025] Preferably, in the preparation of the ribonucleoprotein complex, the final concentration of HEPES used is 1 M.

[0026] Preferably, in the preparation of the ribonucleoprotein complex, the reaction temperature is 34 - 39 °C, and the reaction time is 3 - 18 min.

[0027] More preferably, in the preparation of the ribonucleoprotein complex, the reaction temperature is 37 °C, and the reaction time is 10 min.

[0028] The present invention also discloses a reaction system for enriching mutant genes for programmable enzymes and / or enriching methylated DNA, and the reaction system includes the above ribonucleoprotein complex.

[0029] Preferably, the ribonucleoprotein complex includes: Component (a), comprising a nucleic acid region capable of complementary pairing with a target nucleic acid and 0 - 4 bp mismatch fragments; Component (b), capable of binding to the target nucleic acid and cleaving the target nucleic acid strand; Wherein, component (a) is selected from guide DNA and / or guide RNA; component (b) includes Ago protein and / or Ago protein derivatives; components (a) and (b) can bind. Preferably, component (a) carries a label, and the label includes streptavidin or biotin.

[0030] Preferably, the length of the mismatched nucleotide fragment is 0 bp or 1 bp or 2 bp or 3 bp or 4 bp.

[0031] More preferably, component (a) carries a chemical modification, and the chemical modification includes sulfur substituting oxygen or methoxy modification.

[0032] More preferably, the guide DNA or guide RNA in component (a) includes a mismatched nucleotide fragment.

[0033] More preferably, the length of the spacer sequence of the guide DNA or guide RNA in component (a) is 16 - 22 nt.

[0034] More preferably, the guide DNA sequence is as follows: Forward guide: p-TAGATTTCACTGTAGC-3’ (SEQ ID NO.43); Reverse guide: p-TTCTAGCTACAGTGAA -3’ (SEQ ID NO.44).

[0035] More preferably, component (b) includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

[0036] More preferably, in the ribonucleoprotein complex, the final concentration of component (a) is 0.1 - 2 μM.

[0037] More preferably, in the ribonucleoprotein complex, the final concentration of component (b) is 0.1 - 3 μM.

[0038] More preferably, the ribonucleoprotein complex further includes a hydrogen ion buffer.

[0039] Even more preferably, in the ribonucleoprotein complex, the final concentration of the hydrogen ion buffer is 1 mM - 2 M.

[0040] Preferably, in the reaction system, the final concentration of the ribonucleoprotein complex is 0.1 - 2 μM.

[0041] Preferably, the reaction system further includes: primers, target genes, enzymes and chromophores.

[0042] Preferably, the reaction system further includes: dNTP, single-stranded binding protein.

[0043] More preferably, the target gene includes: genomic DNA or cell-free DNA.

[0044] Even more preferably, the target gene includes genomic DNA extracted from at least one of the following cell lines: EGFR 19del wild-type cell line; EGFR 19 E746_A750 del (2235-2249del) cell line; EGFR19 E746_A750 del (2236-2250del); BRAF V600E mutant; BRAF V600E wild-type cell line; B-CPAP cell line.

[0045] More preferably, the primer comprises a nucleotide sequence capable of binding to the target gene and guiding synthesis.

[0046] Even more preferably, the primer comprises at least one of the following sequences: GCATGTGGCACCATCTCACA (SEQ ID NO.15); AGAGCAGCTGCCAGACATGA (SEQ ID NO.16); CTACACCTCAGATATATTTC (SEQ ID NO.19); TGGATCCAGACAACTGT (SEQ ID NO.20); TACGTGATGGCCAGCGTGGA (SEQ ID NO.23); ACTGGGAGCCAATATTGT (SEQ ID NO.24); TCGTTAAATAGATACGTTACGC (SEQ ID NO.33); TAAAAACTAAAAACTTTCCGCG (SEQ ID NO.34); TCGTTAAATAGATACGTTACGC (SEQ ID NO.35); CAACGCCTCGAAACCTACG (SEQ ID NO.36).

[0047] CCCCCAGGATTCTTACAGAAAACAAGTGGT (SEQ ID NO.38); GCAAATACACAGAGGAAGCCTTCGCCTGTCCTC (SEQ ID NO.39); CAAGTGGTTATAGATGGTGA (SEQ ID NO.40); CGCCTGTCCTCATGTATTGG (SEQ ID NO.41).

[0048] More preferably, the enzyme comprises: DNA polymerase and / or recombinase.

[0049] More preferably, the auxochrome group includes MgOAc.

[0050] Preferably, the above reaction system can be used to enrich mutant alleles with MAF≥0.01%.

[0051] The present invention also discloses the uses of the above reaction system, including at least one of the following: (1) Targeted binding to a target nucleic acid fragment; (2) Targeted cleavage of a target nucleic acid fragment; (3) Enrichment of mutant genes; (4) Detection of mutant genes; (5) Enrichment of methylated DNA; or, (6) Detection of methylated DNA.

[0052] Preferably, the above enrichment includes automated enrichment; the above detection includes automated detection.

[0053] More preferably, the above automated enrichment includes enrichment using a microfluidic chip; the above automated detection includes detection using a microfluidic chip.

[0054] Even more preferably, the microfluidic chip is divided into three parts, consisting of a top encapsulation sheet, a bottom encapsulation sheet, and an intermediate reaction layer.

[0055] Even more preferably, the structure of the top encapsulation sheet includes: a microfluidic chip mounting hole; a microfluidic chip encapsulation positioning hole; a microfluidic chip injection hole.

[0056] Even more preferably, the structure of the intermediate reaction layer includes: a microfluidic chip encapsulation positioning hole; a microfluidic chip mounting hole; a pre-amplification reaction chamber; a siphon valve; a digestion reaction chamber; a pre-distribution chamber; a PCR reaction chamber; a waste liquid chamber; a capillary valve; 10: a gas passage.

[0057] Even more preferably, the structure of the bottom encapsulation sheet includes: a microfluidic chip mounting hole; a microfluidic chip encapsulation positioning hole; an RNaseA loading chamber; a ProteinaseK loading chamber.

[0058] Preferably, the mutant genes include cancer-related genes.

[0059] Preferably, the cancer-related genes include at least one of the following: EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

[0060] Preferably, the methylated DNA includes cancer-related methylated genes and / or their promoters.

[0061] Preferably, the cancer-related methylated genes include at least one of the following: PCDH-10, BRCA1, RASSF1A, ESR1, APC, p14ARF, p16INK4a, DAPK, CDH1, RUNX3, TFPI2, SFRP5, HIC1, PAX5, PGR, THBS1, ESR, COL23A1, C2CD4D, WNT6, OPCML, ZNF154, RARb2, ATM, MGMT, GSTP1, MIR129-2, LINC01158, CCDC181, PRKCB, TBR1, ZNF781, MARCH11, VWC2, SLC9A3, HOXA7, Septin9, IKZF1, BCAT1, hMLH1, WIF1, CDKN2A, SHOX2, 3OST2, ASSF1A, RARb, PITX2, NID2, NEUROG2 or HOXA1; The promoters include at least one of the promoters of the following genes: PCDH-10, BRCA1, RASSF1A, ESR1, APC, p14ARF, p16INK4a, DAPK, CDH1, RUNX3, TFPI2, SFRP5, HIC1, PAX5, PGR, THBS1, ESR, COL23A1, C2CD4D, WNT6, OPCML, ZNF154, RARb2, ATM, MGMT, GSTP1, MIR129-2, LINC01158, CCDC181, PRKCB, TBR1, ZNF781, MARCH11, VWC2, SLC9A3, HOXA7, Septin9, IKZF1, BCAT1, hMLH1, WIF1, CDKN2A, SHOX2, 3OST2, ASSF1A, RARb, PITX2, NID2, NEUROG2 or HOXA1.

[0062] The present invention also discloses the uses of the above ribonucleoprotein complex, including at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enriching methylated DNA; or, (4) Detecting methylated DNA.

[0063] Preferably, the genes include: EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

[0064] The present invention also discloses the uses of Cas protein, including at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enriching methylated DNA; or, (4) Detecting methylated DNA.

[0065] The present invention also discloses the uses of Ago protein, including at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enrich methylated DNA; or, (4) Detect methylated DNA.

[0066] Preferably, the gene includes at least one of the following: EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

[0067] Preferably, the Ago protein includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

[0068] The present invention also discloses a kit for enriching mutant genes of programmable enzymes, and the kit includes the above ribonucleoprotein complex.

[0069] Preferably, the ribonucleoprotein complex includes: Component (a), containing a nucleic acid region capable of complementary pairing with the target nucleic acid and a 0-4bp mismatch fragment; Component (b), capable of binding to the target nucleic acid and breaking the target nucleic acid strand; Wherein, component (a) is selected from guide DNA and / or guide RNA; component (b) includes Ago protein and / or Ago protein derivatives; components (a) and (b) can bind.

[0070] Preferably, the length of the mismatched nucleotide fragment is 0bp or 1bp or 2bp or 3bp or 4bp.

[0071] Preferably, component (a) carries a label, and the label includes streptavidin or biotin.

[0072] More preferably, component (a) carries a chemical modification, and the chemical modification includes sulfur substitution for oxygen or methoxy modification.

[0073] More preferably, the guide DNA sequence is as follows: Forward guide: p-TAGATTTCACTGTAGC-3’ (SEQ ID NO.43); Reverse guide: p-TTCTAGCTACAGTGAA-3’ (SEQ ID NO.44).

[0074] More preferably, component (b) includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

[0075] More preferably, in the ribonucleoprotein complex, the final concentration of component (a) is 0.1 - 2 μM.

[0076] More preferably, in the ribonucleoprotein complex, the final concentration of component (b) is 0.1 - 3 μM.

[0077] More preferably, the ribonucleoprotein complex further includes a hydrogen ion buffer.

[0078] Even more preferably, in the ribonucleoprotein complex, the final concentration of the hydrogen ion buffer is 1 mM - 2 M.

[0079] Preferably, the kit further includes a constant temperature cleavage - amplification reaction system.

[0080] Preferably, in the reaction system, the final concentration of the ribonucleoprotein complex is 0.1 - 2 μM.

[0081] Preferably, the reaction system further includes: primers, target gene, enzymes and chromogenic groups.

[0082] Preferably, the reaction system further includes: dNTP, single - strand binding protein.

[0083] More preferably, the target gene includes: genomic DNA or cell - free DNA.

[0084] Even more preferably, the target gene includes genomic DNA extracted from at least one of the following cell lines: EGFR 19del wild - type cell line; EGFR 19 E746_A750 del (2235 - 2249del) cell line; EGFR19 E746_A750 del (2236 - 2250del); BRAF V600E mutant; BRAF V600E wild - type cell line; B - CPAP cell line.

[0085] More preferably, the primers include nucleotide sequences that can bind to the target gene and guide synthesis.

[0086] Even more preferably, the primers include at least one of the following sequences: GCATGTGGCACCATCTCACA (SEQ ID NO.15); AGAGCAGCTGCCAGACATGA (SEQ ID NO.16); CTACACCTCAGATATATTTC (SEQ ID NO.19); TGGATCCAGACAACTGT (SEQ ID NO.20); TACGTGATGGCCAGCGTGGA (SEQ ID NO.23); ACTGGGAGCCAATATTGT (SEQ ID NO.24); TCGTTAAATAGATACGTTACGC (SEQ ID NO.33); TAAAAACTAAAAACTTTCCGCG (SEQ ID NO.34); TCGTTAAATAGATACGTTACGC (SEQ ID NO.35); CAACGCCTCGAAACCTACG (SEQ ID NO.36).

[0087] CCCCCAGGATTCTTACAGAAAACAAGTGGT (SEQ ID NO.38); GCAAATACACAGAGGAAGCCTTCGCCTGTCCTC (SEQ ID NO.39); CAAGTGGTTATAGATGGTGA (SEQ ID NO.40); or, CGCCTGTCCTCATGTATTGG (SEQ ID NO.41).

[0088] More preferably, the enzyme includes: DNA polymerase and / or recombinase.

[0089] More preferably, the chromophore group includes MgOAc.

[0090] Preferably, the above reaction system can be used to enrich mutant alleles with MAF ≥ 0.01%.

[0091] The present invention also discloses a method for detecting and / or enriching low-abundance mutant genes using the above kit, and the operation steps include: Collect samples; Prepare ribonucleoprotein complexes; Prepare the reaction system; Enrichment analysis.

[0092] Preferably, the step of collecting the sample includes extracting DNA and / or RNA in the sample using a nucleic acid extraction kit.

[0093] More preferably, the sample includes at least one of the following: blood, plasma / serum, cerebrospinal fluid, urine, saliva.

[0094] Even more preferably, the sample includes at least one of the following obtained from cancer patients: blood, plasma / serum, cerebrospinal fluid, urine, saliva.

[0095] Preferably, the hydrogen ion buffer includes HEPES.

[0096] Preferably, in the preparation of the ribonucleoprotein complex, the final concentration of HEPES used is 1 mM - 2 M.

[0097] More preferably, in the preparation of the ribonucleoprotein complex, the final concentration of HEPES used is 1 M.

[0098] Preferably, in the preparation of the ribonucleoprotein complex, the reaction temperature is 34 - 39 °C and the reaction time is 3 - 18 min.

[0099] More preferably, in the preparation of the ribonucleoprotein complex, the reaction temperature is 37 °C and the reaction time is 10 min.

[0100] Preferably, the step of preparing the reaction system includes preparing a constant temperature cleavage - amplification reaction system.

[0101] More preferably, in the reaction system, the final concentration of the ribonucleoprotein complex is 0.1 - 2 μM.

[0102] More preferably, the reaction system further includes: primers, target genes, enzymes, and chromogenic groups.

[0103] More preferably, the reaction system further includes: dNTP, single - strand binding protein.

[0104] Even more preferably, the target gene includes: genomic DNA.

[0105] Even more preferably, the target gene includes genomic DNA extracted from at least one of the following cell lines: EGFR 19del wild - type cell line; EGFR 19 E746_A750 del (2235 - 2249del) cell line; EGFR19 E746_A750 del (2236 - 2250del); BRAF V600E mutant; BRAF V600E wild - type cell line; B - CPAP cell line.

[0106] More preferably, the primer comprises a nucleotide sequence capable of binding to a target gene and guiding synthesis.

[0107] More preferably, the primer comprises at least one of the following sequences: GCATGTGGCACCATCTCACA (SEQ ID NO.15); AGAGCAGCTGCCAGACATGA (SEQ ID NO.16); CTACACCTCAGATATATTTC (SEQ ID NO.19); TGGATCCAGACAACTGT (SEQ ID NO.20); TACGTGATGGCCAGCGTGGA (SEQ ID NO.23); ACTGGGAGCCAATATTGT (SEQ ID NO.24); TCGTTAAATAGATACGTTACGC (SEQ ID NO.33); TAAAAACTAAAAACTTTCCGCG (SEQ ID NO.34); TCGTTAAATAGATACGTTACGC (SEQ ID NO.35); CAACGCCTCGAAACCTACG (SEQ ID NO.36).

[0108] CCCCCAGGATTCTTACAGAAAACAAGTGGT (SEQ ID NO.38); GCAAATACACAGAGGAAGCCTTCGCCTGTCCTC (SEQ ID NO.39); CAAGTGGTTATAGATGGTGA (SEQ ID NO.40); or, CGCCTGTCCTCATGTATTGG (SEQ ID NO.41).

[0109] More preferably, the enzyme comprises: DNA polymerase and / or recombinase.

[0110] More preferably, the chromophore group comprises MgOAc.

[0111] Preferably, the enrichment analysis step comprises QPCR analysis, sequencing, point-of-care testing (POCT), and the detection method for low-abundance mutant genes based on programmable nucleases as described above.

[0112] More preferably, the QPCR analysis step includes preparing a QPCR reaction system.

[0113] Even more preferably, the QPCR reaction system includes: Primers, chromogenic groups, dNTPs, enzymes.

[0114] Even more preferably, the primers include at least one of the following: TGTCATAGGGACTCTGGATCCCAGA (SEQ ID NO.17); GCAGAAACTCACATCGAGGATTTCCTTGT (SEQ ID NO.18); CCTCAGATATATTTCTTCATGA (SEQ ID NO.21); TGTTCAAACTGATGGGAC (SEQ ID NO.22); TGATGGCCAGCGTGGACAA (SEQ ID NO.25); or, TTGTGTTCCCGGACATAGTC (SEQ ID NO.26).

[0115] Even more preferably, the chromogenic group includes MgOAc.

[0116] Even more preferably, the enzyme includes DNA polymerase.

[0117] The present invention also discloses a guide DNA or guide RNA, characterized in that the guide DNA or guide RNA includes a specific recognition nucleotide fragment and a mismatched nucleotide fragment; wherein, the length of the mismatched nucleotide fragment is 0-4 bp.

[0118] Preferably, the length of the mismatched nucleotide fragment is 0 bp or 1 bp or 2 bp or 3 bp or 4 bp.

[0119] Preferably, the above-mentioned guide DNA includes the following sequences: SEQ ID NO.43: Forward guide: p-TAGATTTCACTGTAGC-3'; SEQ ID NO.44: Reverse guide: p-TTCTAGCTACAGTGAA-3'.

[0120] The present invention also discloses the use of the above-mentioned guide DNA or guide RNA, including at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enrich methylated DNA; or, (4) Detect methylated DNA.

[0121] The present invention also discloses a method for enriching mutant genes and / or methylated DNA based on programmable enzymes, which specifically cleaves wild-type alleles using the CRISPR system while amplifying mutant alleles; wherein, the CRISPR system includes: Component (a), comprising a nucleic acid region capable of complementary base pairing with the target nucleic acid and a 0-4bp mismatch fragment; Component (b), capable of binding to the target nucleic acid and breaking the target nucleic acid strand; Wherein, component (a) is selected from guide DNA and / or guide RNA; component (b) includes Ago protein and / or Ago protein derivatives; component (a) and (b) can bind. Preferably, component (a) carries a label, and the label includes streptavidin or biotin.

[0122] Preferably, the length of the mismatched nucleotide fragment is 0bp or 1bp or 2bp or 3bp or 4bp.

[0123] Preferably, component (a) carries a chemical modification, and the chemical modification includes sulfur substitution for oxygen or methoxy modification.

[0124] Preferably, the sgRNA in component (a) includes a mismatched nucleotide fragment. The mismatched nucleotide fragment designed in the present invention is beneficial to expanding the use range of sgRNA and enables sgRNA to recognize more mutations.

[0125] Preferably, the spacer sequence length of the sgRNA in component (a) is 16-22nt.

[0126] Preferably, component (b) includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

[0127] Preferably, in the CRISPR system, the final concentration of component (a) is 0.1-2μM.

[0128] Preferably, in the CRISPR system, the final concentration of component (b) is 0.1-3μM.

[0129] Preferably, in the CRISPR system, a hydrogen ion buffer is further included.

[0130] More preferably, in the CRISPR system, the hydrogen ion buffer includes: HEPES.

[0131] More preferably, in the CRISPR system, the final concentration of the hydrogen ion buffer is 1mM-2 M.

[0132] Preferably, the methods for amplifying mutant alleles include PCR, LAMP, and RPA.

[0133] More preferably, the reaction system for amplifying mutant alleles includes ribonucleoprotein complexes.

[0134] Preferably, in the reaction system, the final concentration of the ribonucleoprotein complex is 0.1 - 2 μM.

[0135] Preferably, the reaction system further includes: primers, target genes, enzymes, and chromogenic groups.

[0136] Preferably, the reaction system further includes: dNTP, single-strand binding protein.

[0137] More preferably, the target gene includes: genomic DNA.

[0138] Even more preferably, the target gene includes genomic DNA extracted from at least one of the following cell lines: EGFR 19del wild-type cell line; EGFR 19 E746_A750 del (2235 - 2249del) cell line; EGFR19 E746_A750 del (2236 - 2250del); BRAF V600E mutant; BRAF V600E wild-type cell line; B-CPAP cell line.

[0139] More preferably, the primers include nucleotide sequences capable of binding to the target gene and guiding synthesis.

[0140] Even more preferably, the primers include at least one of the following sequences: GCATGTGGCACCATCTCACA (SEQ ID NO.15); AGAGCAGCTGCCAGACATGA (SEQ ID NO.16); CTACACCTCAGATATATTTC (SEQ ID NO.19); TGGATCCAGACAACTGT (SEQ ID NO.20); TACGTGATGGCCAGCGTGGA (SEQ ID NO.23); ACTGGGAGCCAATATTGT (SEQ ID NO.24); TCGTTAAATAGATACGTTACGC (SEQ ID NO.33); TAAAAACTAAAAACTTTCCGCG (SEQ ID NO.34); TCGTTAAATAGATACGTTACGC (SEQ ID NO.35); CAACGCCTCGAAACCTACG (SEQ ID NO.36).

[0141] CCCCCAGGATTCTTACAGAAAACAAGTGGT (SEQ ID NO.38); GCAAATACACAGAGGAAGCCTTCGCCTGTCCTC (SEQ ID NO.39); CAAGTGGTTATAGATGGTGA (SEQ ID NO.40); or, CGCCTGTCCTCATGTATTGG (SEQ ID NO.41).

[0142] More preferably, the guide DNA sequence is as follows: Forward guide: p-TAGATTTCACTGTAGC-3’ (SEQ ID NO.43); Reverse guide: p-TTCTAGCTACAGTGAA-3’ (SEQ ID NO.44).

[0143] More preferably, the enzyme includes: DNA polymerase and / or recombinase.

[0144] More preferably, the chromophore group includes MgOAc.

[0145] Even more preferably, the ribonucleoprotein complex includes Cas9, sgRNA and a hydrogen ion buffer.

[0146] Even more preferably, the method for preparing the ribonucleoprotein complex includes: mixing and incubating Cas9, sgRNA and a hydrogen ion buffer.

[0147] Even more preferably, the hydrogen ion buffer includes HEPES.

[0148] The present invention also discloses a method for detecting low-abundance mutant genes and / or methylated DNA based on programmable nucleases, which specifically cleaves wild-type alleles using the above CRISPR system or Ago system, while amplifying mutant alleles; the method includes the following steps: Designing sgRNA; Obtaining the target gene; Amplification and cleavage; Detecting mutant genes.

[0149] Preferably, the sgRNA includes a mismatched nucleotide fragment.

[0150] Preferably, the length of the spacer sequence of the sgRNA is 16 - 22 nt.

[0151] Preferably, the target genes include EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

[0152] Preferably, the amplification methods include: PCR, LAMP and RPA.

[0153] Preferably, the method for detecting mutant genes includes Sanger sequencing.

[0154] Preferably, the reaction system used for amplification includes: target gene, ribonucleoprotein complex, MgOAc, primer, DNA polymerase, recombinase and single-stranded binding protein.

[0155] Preferably, the reaction system used for cleavage includes: target gene, ribonucleoprotein complex, MgOAc.

[0156] The present invention also discloses a microfluidic chip for automatically enriching and / or detecting mutant genes and / or methylated DNA.

[0157] Preferably, the microfluidic chip is divided into three parts, consisting of a top encapsulation sheet, a bottom encapsulation sheet and an intermediate reaction layer.

[0158] More preferably, the structure of the top encapsulation sheet includes: a microfluidic chip mounting hole; a microfluidic chip encapsulation positioning hole; a microfluidic chip injection hole.

[0159] More preferably, the structure of the intermediate reaction layer includes: a microfluidic chip encapsulation positioning hole; a microfluidic chip mounting hole; a pre-amplification reaction chamber; a siphon valve; a digestion reaction chamber; a pre-distribution chamber; a PCR reaction chamber; a waste liquid chamber; a capillary valve; 10: a gas passage.

[0160] More preferably, the bottom encapsulation sheet structure includes: a microfluidic chip mounting hole; a microfluidic chip encapsulation positioning hole; an RNaseA sample addition chamber; a ProteinaseK sample addition chamber.

[0161] The present invention also discloses a method for automatically enriching and / or detecting mutant genes and / or methylated DNA, comprising the following steps: 1) Sample addition: Add the pre-amplification system to the pre-amplification reaction chamber; add RNaseA to the RNaseA sample addition chamber; add ProteinaseK to the ProteinaseK sample addition chamber; add the qPCR system to the PCR reaction chamber; 2) Sealing; 3) Loading and completing the experiment: Load the sealed microfluidic chip onto the centrifugal microfluidic platform.

[0162] Compared with the prior art, the beneficial effects of the present invention are as follows: Based on the CRISPR system, programmable nucleases, and nucleic acid amplification technology, the present invention, while amplifying nucleic acids, uses programmable nucleases to specifically cleave wild-type nucleic acids, enabling the number of mutant alleles in the sample to continuously increase exponentially to a level detectable by inexpensive Sanger sequencing. It not only achieves detection sensitivity comparable to ultra-deep NGS sequencing but also has characteristics such as a short detection cycle and no dependence on large-scale instrument equipment, greatly reducing the detection cost and significantly promoting the clinical application of low-abundance mutant allele detection. The enrichment method of the present invention can be used to enrich mutant alleles with MAF ≥ 0.01%, and can significantly increase the frequency of mutant alleles. Description of the Drawings

[0163] Figure 1 For the comparison of the enrichment degree of 0.1% methylated DNA before and after enrichment treatment in Example 4; Figure 2 For the schematic diagram of the principle of enriching methylated DNA in the present invention; Figure 3 For the schematic diagram of the microfluidic chip structure; Figure 4 For the schematic diagram of the top encapsulation sheet structure; Figure 5 For the schematic diagram of the intermediate reaction layer structure; Figure 6 For the schematic diagram of the top encapsulation sheet structure; Figure 7 For the schematic diagram of the principle based on Ago cleavage in the present invention; Figure 8 For the comparison of MAF = 0.1% before and after PASEA treatment in Example 7.

[0164] Reference numerals in the drawings: 1 - top encapsulation sheet; 11 - Microfluidic chip mounting hole; 12 - Microfluidic chip encapsulation positioning hole; 13 - Microfluidic chip sampling hole; 2 - Intermediate reaction layer; 21 - Microfluidic chip encapsulation positioning hole; 22 - Microfluidic chip mounting hole; 23 - Pre - amplification reaction chamber; 24 - Siphon valve; 25 - Digestion reaction chamber; 26 - Pre - distribution chamber; 27 - PCR reaction chamber; 28 - Waste liquid chamber; 29 - Capillary valve; 210 - Gas passage; 3 - Bottom encapsulation sheet; 31 - Microfluidic chip mounting hole; 32 - Microfluidic chip encapsulation positioning hole; 33 - RNaseA loading chamber; 34 - ProteinaseK loading chamber. Specific implementation mode

[0165] Here, the exemplary embodiments will be described in detail. The implementation manners described in the following exemplary embodiments do not represent all implementation manners consistent with the present disclosure. On the contrary, they are merely examples of methods consistent with some aspects of the present disclosure.

[0166] In the following embodiments, the experimental methods, unless otherwise specified, are all conventional methods or are carried out according to the conditions recommended by the manufacturers. The materials, reagents, etc. used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0167] The primers used for sequencing in the following embodiments are the same as the qPCR primers.

[0168] Example 4 Enrichment and detection of PCDH10 gene methylation 1. Design primers Obtain the human PCDH10 gene sequence from the NCBI database, and design primers according to this sequence as follows: Pre - amplification F primer: TCGTTAAATAGATACGTTACGC (SEQ ID NO.33); Pre - amplification R primer: TAAAAACTAAAAACTTTCCGCG (SEQ ID NO.34); qPCR F primer: TCGTTAAATAGATACGTTACGC (SEQ ID NO.35); qPCR R primer: CAACGCCTCGAAACCTACG (SEQ ID NO.36).

[0169] 2. Design sgRNA Design sgRNA sequences with a length of 17 - 20 nt and capable of complete pairing with the wild - type allele sequence, as shown in SEQ ID NO.37: guide: AAUUUUUGUUUGAGUGGUUG (SEQ ID NO.37); 3. Acquisition of genomic DNA A549 is a PCDH10 non - methylated cell line, purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd. Genomic DNA was extracted using the QIAGEN DNeasy Blood & Tissue Kit. Methylated Human Control was purchased from promega. Templates with methylation ratios MAF = 5%, 1%, 0.5%, 0.1%, and 0.01% were prepared.

[0170] 4. Enrichment and detection of methylated DNA a) Pre - amplification: The formation of ribonucleoprotein complex, see Table 16.

[0171] Table 16 Composition of ribonucleoprotein complex Final concentration Cas9 1 μM sgRNA 1 μM HEPES 1M Incubate at 37°C for 10 min to obtain the ribonucleoprotein complex; Prepare the pre - amplification system, see Table 17.

[0172] Table 17 Pre - amplification system Final concentration Ribonucleoprotein complex 1 μM Pre-amplification F primer 0.5 μM Pre-amplification R primer 0.5 μM MgOAc 14 mM dNTP 0.45 mM DNA polymerase Recombinase SSB Template 60 ng React at 37°C for 20 min; then terminate the reaction at 95°C for 10 min; Digestion: Add 1 μl RNaseA (10 mg / ml), place at room temperature for 10 min; add 1 μl ProteinaseK (20 mg / ml), incubate at 56°C for 30 min; then incubate at 95°C for 10 min; Prepare the qPCR system, see Table 18.

[0173] Table 18 qPCR system Final concentration qPCR F primer 1 μM qPCR R primer 1 μM MgOAc 14 mM dNTP 0.45 mM DNA polymerase Reaction procedure: Pre - denaturation: 95°C, 5 min; 30 cycles; 95°C, 10 s; 60°C, 30 s; 72°C, 30 s.

[0174] After amplification, the amplified product was subjected to Sanger sequencing. The sequencing results are as Figure 1 shown. To avoid redundancy, only the enrichment results of samples with MAF = 0.1% are shown; as Figure 1 can be seen, the methylated DAN increased significantly after enrichment. This indicates that the enrichment method of the present invention can effectively enrich methylated DAN.

[0175] Example 6 PASEA automation In the above examples, the experimental operations of enrichment and detection can be automated using a microfluidic chip. The microfluidic chip structure (see Figure 3 ) is divided into three parts, consisting of a top encapsulation sheet 1, a bottom encapsulation sheet 3, and a middle reaction layer 2 in between; The top encapsulation sheet 1 (see Figure 4 ) has the following structure: a microfluidic chip mounting hole 11; a microfluidic chip encapsulation positioning hole 12; a microfluidic chip injection hole 13; The middle reaction layer 2 (see Figure 5 ) has the following structure: a microfluidic chip encapsulation positioning hole 21; a microfluidic chip mounting hole 22; a pre-amplification reaction chamber 23; a siphon valve 24; a digestion reaction chamber 25; a pre-distribution chamber 26; a PCR reaction chamber 27; a waste liquid chamber 28; a capillary valve 29; a gas passage 210.

[0176] The bottom encapsulation sheet 3 (see Figure 6 ) has the following structure: a microfluidic chip mounting hole 31; a microfluidic chip encapsulation positioning hole 32; an RNaseA loading chamber 33; a ProteinaseK loading chamber 34.

[0177] The specific operation steps are as follows: 1) Loading: Add the pre-amplification system to the pre-amplification reaction chamber; add 5 μl of RNaseA (10 mg / ml) to the RNaseA loading chamber; add 5 μl of ProteinaseK (20 mg / ml) to the ProteinaseK loading chamber; add the qPCR system to the PCR reaction chamber.

[0178] 2) Sealing: Seal the injection port with a suitable sealing aluminum foil pressure-sensitive film.

[0179] 3) Loading and completing the experiment: Load the sealed microfluidic chip onto a centrifugal microfluidic platform.

[0180] Set the process: a: Incubate at 37 °C for 20 min (pre-amplification); b: Rotate at 3000 rpm for 1 min (when rotating, centrifuge the pre-amplified solution to the digestion chamber, and open the siphon valve when stopping); c: Incubate without heating for 10 min (RNase A digestion); d: Incubate at 56 °C for 30 min (Proteinase K digestion); e: Centrifuge at 1000 rpm for 1 min (pre - aliquoting); f: Centrifuge at 3000 rpm for 2 min (centrifuge the quantified digested pre - amplification solution into the PCR chamber); g: 95 °C, 5 min; 45 cycles: 95 °C, 10 s 60 °C, 30 s (PCR reaction).

[0181] Example 7 Enrichment and Detection of BRAF V600E Mutation Based on Ago Protein 1. Primer Design Obtain the human BRAF gene sequence from the NCBI database and design primers according to this sequence as follows: Pre - amplification F primer: CTACACCTCAGATATATTTC (SEQ ID NO.19); Pre - amplification R primer: TGGATCCAGACAACTGT (SEQ ID NO.20); qPCR F primer: CCTCAGATATATTTCTTCATGA (SEQ ID NO.21); qPCR R primer: TGTTCAAACTGATGGGAC (SEQ ID NO.22).

[0182] 2. Guide DNA Design Design guide DNA sequences with a length of 16 - 20 nt that can fully pair with the wild - type allele sequence, as shown in SEQ ID NO.43 - 44: Forward guide: p - TAGATTTCACTGTAGC - 3’ (SEQ ID NO.43); Reverse guide: p - TTCTAGCTACAGTGAA - 3’ (SEQ ID NO.44); Use the guide DNA to direct the Ago protein to bind to the wild - type allele and specifically cleave the wild - type allele without cleaving the mutant allele. The principle is as Figure 6 shown.

[0183] 3. Genomic DNA Obtaining The BRAF V600E mutant and wild-type alleles were derived from the B-CPAP and HCC827 cell lines (purchased from Shanghai Zhongqiao Xinzhou Biotechnology Co., Ltd.), respectively. The genomic DNA of the two cell lines was extracted using the QIAGEN DNeasy Blood&Tissue Kit according to the instructions, and the two DNAs were formulated into templates with mutant ratios of MAF = 5%, 1%, 0.5%, 0.1%, and 0.01% for the enrichment and detection of mutations.

[0184] 5. Enrichment and detection of mutant alleles a) Pre-amplification: The formation of the Ago-Guide DNA complex is shown in Table 22.

[0185] Table 22 Composition of the Ago-Guide DNA complex Final concentration Ago 1 μM GuideDNA 10 μM HEPES 1M Incubate at a constant temperature of 37°C for 10 min to obtain the ribonucleoprotein complex. Prepare the pre-amplification system as shown in Table 23.

[0186] Table 23 Pre-amplification system Final concentration Ribonucleoprotein complex 1 μM Pre-amplification F primer 0.5 μM Pre-amplification R primer 0.5 μM MgOAc 14 mM dNTP 0.45 mM DNA polymerase Recombinase SSB Template 60 ng Here, Ago includes one of CbAgo, TtAgo, KmAgo, and KpAgo. React at a constant temperature of 37°C for 20 min; then terminate the reaction at 95°C for 10 min. Digestion: Add 1 μl of RNaseA (10 mg / ml) and incubate at room temperature for 10 min; add 1 μl of Proteinase K (20 mg / ml) and incubate at a constant temperature of 56°C for 30 min; then incubate at 95°C for 10 min. Prepare the qPCR system as shown in Table 24.

[0187] Table 24 qPCR system Final concentration qPCR F primer 1 μM qPCR R primer 1 μM MgOAc 14 mM dNTP 0.45 mM DNA polymerase Reaction procedure: Pre-denaturation: 95°C for 5 min. 45 cycles. 95°C for 10 s. 60°C for 30 s. After amplification, perform Sanger sequencing on the amplified product. The sequencing results are as Figure 8 shown. To avoid redundancy, only the enrichment results of the sample with MAF = 0.1% are presented; from Figure 8It can be seen that the wild-type alleles are significantly increased after enrichment. This indicates that the enrichment method of the present invention based on the specific cleavage of Ago protein can also effectively enrich mutant alleles.

[0188] The conventional operations in the operation steps of the present invention are well-known to those skilled in the art and will not be elaborated herein.

[0189] The above-described embodiments have described the technical solutions of the present invention in detail. It should be understood that the above is only the specific embodiments of the present invention and is not used to limit the present invention. Any modification, supplement, or substitution in a similar manner within the principle scope of the present invention shall be included within the protection scope of the present invention.

Claims

1. A kit for enrichment of mutant genes based on programmable enzymes, comprising: A ribonucleoprotein complex, said ribonucleoprotein complex comprising component (a) and component (b): Component (a), said component (a) comprising: a nucleic acid region capable of complementary base pairing with a target nucleic acid and a 0-4 bp mismatch fragment; Component (b), capable of binding to a target nucleic acid and cleaving the target nucleic acid strand; Wherein, said component (a) is selected from guide DNA and / or guide RNA; said component (b) comprises an Ago protein and / or an Ago protein derivative; components (a) and (b) are capable of binding.

2. The kit according to claim 1, wherein The spacer sequence length of the guide DNA or guide RNA in said component (a) is 16-22 nt.

3. The kit according to claim 1, wherein Said component (b) comprises at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo or KpAgo.

4. The kit according to claim 1, wherein, Said mutant gene comprises at least one of the following: EGFR, BRAF, PIK3CA, TP53, LRP1B, APC, CYP1A1, NP01, EPHX1, KRAS, BRCA1, BRCA2, MET, MLH1, MSH2, MSH3, MSH6, PALB2, BMPR1A, SMAD4, STK11, PTEN, AXIN2, BLM, BUB1B, CDH1, CEP57, CHEK2, ENG, EPCAM, FLCN, GALNTI2, GREM1, FAT4, KMT2D, KMT2C, ARID1A, FAT1, PTEN, ATM, ZFHX3, CREBBP, GRIN2A, NRAS or NF1.

5. The kit according to claim 1, wherein Said kit further comprises an isothermal cleavage-amplification reaction system, said isothermal cleavage-amplification reaction system comprising: primers, a target gene, an enzyme and a chromogenic group.

6. The kit according to claim 1, wherein Said enrichment comprises automated enrichment; said detection comprises automated detection, said automated enrichment comprises enrichment using a microfluidic chip; Said automated detection comprises detection using a microfluidic chip..

7. The kit according to claim 1, wherein Said guide DNA comprises the following sequences: SEQ ID NO.43: Forward guide: p-TAGATTTCACTGTAGC-3’; SEQ ID NO.44: Reverse guide: p-TTCTAGCTACAGTGAA-3’.

8. The kit according to claim 7, wherein The use of said guide DNA comprises at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enriching methylated DNA; or, (4) Detecting methylated DNA.

9. A method for enriching mutant genes using the kit according to claim 1, comprising the following steps: Collecting a sample; Preparing a ribonucleoprotein complex; Formulating a reaction system; Enrichment analysis.

10. The use of an Ago protein comprises at least one of the following: (1) Enriching gene mutations; (2) Detecting gene mutations; (3) Enriching methylated DNA; or, (4) Detecting methylated DNA; Among them, The Ago protein includes at least one of the following: CbAgo, TtAgo, PfAgo, KmAgo, or KpAgo.

Images