Soybean cyst nematode gene Hg-tax-2 and application thereof in nematode control

Abstract

The invention discloses a soybean cyst nematode gene Hg-tax-2 and application thereof in nematode control, and relates to a soybean cyst nematode gene and application thereof. The invention solves the problems that the existing chemical prevention and control method of soybean cyst nematode causes environmental pollution and the crop rotation method is very easy to lose resistance, and the Hg-tax-2 nucleotide sequence is shown as SEQ ID NO: 1 in a sequence table. The amino acid sequence is shown in a sequence table SEQ ID NO: 2. The dsRNA sequence of the Hg-tax-2 is as shown in SEQ ID NO: 3 in the sequence table, and the nucleotide sequence of the dsRNA-Hg-tax-2 is as shown in SEQ ID NO: 3 in the sequence table. After the soybean cyst nematode gene Hg-tax-2 is treated by a double-stranded RNA fragment dsRNA-Hg-tax-2, the expression of the gene Hg-tax-2 is obviously inhibited, and the number of second-stage larvae infected into roots and the number of female larvae infected for 35 days are obviously reduced. Results show that the gene plays a key role in regulation and control of soybean cyst nematode infected hosts and in the development process, and can be used as a target gene for nematicide development.

Description

Technical Field

[0001] The present invention relates to a soybean cyst nematode gene and its application. Background Art

[0002] Soybean is an important crop for both food and oil. Soybean cyst nematode disease is one of the important soil-borne diseases caused by the root-settling soybean cyst nematode (SCN) infecting soybeans. Soybean cyst nematode disease occurs in soybean-producing areas in China, resulting in an annual economic loss of up to 600 million yuan. After SCN invades the roots, it is easy to cause the host roots to develop slowly and the leaves to turn yellow, generally reducing production by 30-50%. In severe cases, it leads to a complete crop failure. Due to the change of China's industrial structure, the soybean planting area has increased year by year, and this disease has become more and more serious. In addition, the wounds caused by soybean cyst nematode infection can induce secondary diseases, such as sudden death syndrome of soybean, Phytophthora sojae, soybean stem rot, etc.

[0003] Although the current chemical control of soybean cyst nematode disease is effective, it has great destructiveness to the environmental ecology and the safety of humans, livestock and poultry; the combination of disease-resistant varieties and non-host rotation is also an effective control strategy, but the resistance sources are single, there are multiple physiological races in the field and they are easy to mutate, resulting in the easy loss of resistance; the limited arable land resources limit rotation.

[0004] Based on the above problems, it is urgent to establish a new control strategy. At present, developing efficient, non-toxic and broad-spectrum new biogenic nematicides from the interaction mechanism between nematodes and plants is the top priority in nematology research. Exploring and screening new genes of soybean cyst nematode, analyzing their functions in the infection and development process of soybean cyst nematode, and further developing new biogenic nematicides with them as targets have important theoretical guiding significance and practical application value for the green and sustainable control of soybean cyst nematode. Summary of the Invention

[0005] In order to solve the problems that the existing chemical control method of soybean cyst nematode causes environmental pollution and the rotation method is prone to loss of resistance, the present invention provides a soybean cyst nematode gene Hg-tax-2 and its application in nematode control.

[0006] The nucleotide sequence of the soybean cyst nematode gene Hg-tax-2 of the present invention is as shown in SEQ ID NO: 1 in the sequence listing.

[0007] Furthermore, the amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-2 is as shown in SEQ ID NO: 2 in the sequence listing.

[0008] Furthermore, the dsRNA sequence dsRNA-Hg-tax-2 of the soybean cyst nematode gene Hg-tax-2, and the nucleotide sequence of dsRNA-Hg-tax-2 is as shown in SEQ ID NO: 3 in the sequence listing.

[0009] Use of the dsRNA of the soybean cyst nematode gene Hg-tax-2 of the present invention in controlling nematodes.

[0010] Furthermore, the specific method for controlling nematodes is: soaking the second-stage larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-2, and incubating with shaking in the dark at room temperature.

[0011] Beneficial effects of the present invention:

[0012] The gene Hg-tax-2 of the present invention is derived from the cyclic nucleotide-gated ion channel subunit of soybean cyst nematodes, and the experimental results show that this gene is expressed in the amphids of the second-stage larvae.

[0013] For the base sequence of the gene Hg-tax-2, specific functional regions are screened to synthesize dsRNA. For the soybean cyst nematode gene Hg-tax-2 of the present invention, specific functional regions are screened to synthesize the double-stranded RNA fragment dsRNA-Hg-tax-2. By in vitro interfering with soybean cyst nematodes, it can significantly inhibit the expression of the soybean cyst nematode gene Hg-tax-2, that is, by in vitro interference, the infectivity of nematodes to hosts and their fecundity after dsRNA treatment are measured to determine that the gene Hg-tax-2 is involved in regulating the pre-parasitic and parasitic processes of nematodes.

[0014] After being treated with the double-stranded RNA fragment dsRNA-Hg-tax-2, the soybean cyst nematode gene Hg-tax-2 of the present invention significantly inhibits the expression of the gene Hg-tax-2, and the number of second-stage larvae invading the roots and the number of female worms 35 days after infection both decrease very significantly. The results show that this gene plays a key role in regulating the infection of soybean cyst nematodes to hosts and the development process, and can be used as a target gene for the development of nematicides.

[0015] The soybean cyst nematode gene Hg-tax-2 of the present invention is involved in regulating the infection and reproduction of soybean cyst nematodes to hosts, and can be used as a target gene for the development of drugs for controlling soybean cyst nematodes. The present invention solves the problem of environmental pollution in the existing chemical control methods for soybean cyst nematodes, and there is no problem of loss of resistance throughout the process. The present invention also reports for the first time the cloning and functional analysis of the gene encoding the cyclic nucleotide-gated ion channel in plant parasitic nematodes.

[0016] The present invention has great application value for the research on the pathogenic mechanism of soybean cyst nematodes and nematode control. Description of the drawings

[0017] Figure 1 It is for cloning a partial fragment of the gene Hg-tax-2 of soybean cyst nematode by RT-PCR in Example 1;

[0018] Figure 2 It is for in situ hybridization to localize the expression of the gene Hg-tax-2 in the amphidial sensilla cells of the second-stage larvae of soybean cyst nematode in Example 2;

[0019] Figure 3 It is the fluorescence micrograph of the second-stage larvae in treatment solution 1 group in Example 3;

[0020] Figure 4 It is the effect of exogenous dsRNA treatment on the expression level of Hg-tax-2 in the second-stage larvae in Example 3;

[0021] Figure 5 It is the number of J2 in the roots of soybean after 48 h of J2 of the second-stage larvae in the treatment group (dsRNA-Hg-tax-2) and the control group (dsRNA-GFP) infecting the soybean roots in Example 3;

[0022] Figure 6 It is the number of female adults on the root surface of soybean 35 days after inoculating J2 of the second-stage larvae in the treatment group (dsRNA-Hg-tax-2) and the control group (dsRNA-GFP) in Example 3. Detailed implementation manners

[0023] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts belong to the scope of protection of the present invention.

[0024] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments may be combined with each other.

[0025] Detailed implementation manner 1: The nucleotide sequence of the gene Hg-tax-2 of soybean cyst nematode in this implementation manner is as shown in SEQ ID NO: 1 in the sequence listing.

[0026] Detailed implementation manner 2: The amino acid sequence of the protein encoded by the gene Hg-tax-2 of soybean cyst nematode in this implementation manner is as shown in SEQ ID NO: 2 in the sequence listing.

[0027] Specific Embodiment 3: The dsRNA sequence dsRNA-Hg-tax-2 of the soybean cyst nematode gene Hg-tax-2. The nucleotide sequence of dsRNA-Hg-tax-2 is shown as SEQ ID NO: 3 in the sequence listing.

[0028] Specific Embodiment 4: Application of the dsRNA of the soybean cyst nematode gene Hg-tax-2 described in Specific Embodiment 1 in controlling nematodes.

[0029] Specific Embodiment 5: The difference between this embodiment and Specific Embodiment 4 is that: the specific method for controlling nematodes is: soaking the second-stage larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-2, and incubating with shaking in the dark at room temperature. Others are the same as Specific Embodiment 4.

[0030] Specific Embodiment 6: The difference between this embodiment and Specific Embodiment 5 is that: incubate with shaking in the dark at room temperature for 40 - 50 h. Other steps and parameters are the same as Specific Embodiment 5.

[0031] Example 1 Cloning of the cyclic nucleotide-gated ion channel gene Hg-tax-2 of soybean cyst nematode

[0032] 1. Collect freshly hatched second-stage larvae of soybean cyst nematodes, put them into a biological freezing grinder, add an appropriate amount of liquid nitrogen and quickly grind. After grinding, transfer the nematode powder to a 1.5 mL centrifuge tube, add 1 mL of Trizol, and shake well to extract the total RNA of the nematodes.

[0033] 2. Using the total RNA in step 1 as a template, use One-Step gDNA Removal and cDNA Synthesis SuperMix kit to synthesize nematode cDNA, and store the synthesized cDNA in a -80 °C refrigerator for later use.

[0034] 3. Using the cDNA synthesized in step 2 as a template, perform PCR amplification of the gene Hg-tax-2 with upstream and downstream primers.

[0035] The upstream and downstream primers of the gene Hg-tax-2 are as follows:

[0036] Hg-tax-2-F: 5’-AGTTCCCGCCATCACACGGACACCGC-3’

[0037] Hg-tax-2-R: 5’-AAGCGACCAGCACAAAGGAAAGCCAT-3’

[0038] Amplification reaction system: 2×Phanta Master Mix, 5 μL, cDNA template, 0.2 μL, upstream primer, 0.4 μL, downstream primer, 0.4 μL, RNase-free Water, 4 μL, total reaction system 10 μL.

[0039] Reaction conditions: Denaturation at 95°C for 3 min, 95°C for 15 s, 50 - 65°C for 15 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 5 min, store at 4°C. The PCR products were separated and identified by 1% agarose gel electrophoresis, and the results were as Figure 1 shown, Figure 1 to RT-PCR clone a partial fragment of the soybean cyst nematode gene Hg-tax-2.

[0040] 4. Sequence the PCR amplification in step 3. The sequencing results showed that the amplified product contained the gene fragment shown in SEQ ID NO: 1 in the sequence listing, encoding the protein shown in SEQ ID NO: 2 in the sequence listing. The protein with the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing was named protein Hg-TAX-2, and the encoding gene was named Hg-tax-2.

[0041] Example 2 Tissue localization analysis of gene Hg-tax-2

[0042] Perform gene tissue localization analysis on the second-stage larvae of soybean cyst nematode according to the method of DIG High Prime DNA Labeling and Detection Starter Kit Ι.

[0043] 1. Based on the Hg-tax-2 gene sequence cloned in Example 1, apply asymmetric PCR to synthesize digoxigenin (DIG)-labeled sense strand probe and antisense strand probe.

[0044] Using the gene fragment recovered in step 1 of this example as a template to label DIG, a sense strand probe and an antisense strand probe with a length of 334 bp were obtained.

[0045] 2. Perform in situ hybridization, Figure 2 for in situ hybridization to localize the expression of gene Hg-tax-2 in the amphidial sensory cells of the second-stage larvae of soybean cyst nematode;

[0046] From Figure 2 it can be seen that after treatment with Hg-tax-2 labeled with the antisense strand probe, chromogenic reactions occurred in the tissue cells of the nematode amphidial sensory organs. The results showed that Hg-tax-2 was mainly expressed in the amphidial sensory tissue of the second-stage larvae of soybean cyst nematode, and the amphidial sensory organ is an important organ for nematode allelopathic regulation.

[0047] Example 3 Verification of the Function of Hg-tax-2 by in vitro RNAi Interference Assay

[0048] 1. Synthesis of dsRNA: Based on the Hg-tax-2 gene fragment cloned in Example 1, specific primers were designed:

[0049] Hg-TAX-2-si-T7F:

[0050] 5’-TAATACGACTCACTATAGGGAGAGTTCCCGCCATCACACGGACACCGC-3’

[0051] Hg-TAX-2-si-R:

[0052] 5’-AAGCGACCAGCACAAAGGAAAGCCAT-3’

[0053] Hg-TAX-2-si-F:

[0054] 5’-AGTTCCCGCCATCACACGGACACCGC-3’

[0055] Hg-TAX-2-si-T7R:

[0056] 5’-TAATACGACTCACTATAGGGAGAAGCGACCAGCACAAAGGAAAGCCAT-3’

[0057] The T7 promoter sequence TAATACGACTCACTATAGGGAG was introduced at the 5’ end of the specific primers. Using the Hg-tax-2 gene fragment as a template, the gene fragment template required for dsRNA synthesis was amplified by PCR, purified, and used for the next experiment.

[0058] 2. Synthesize dsRNA according to the MEGAscript TM RNAi Kit instruction manual

[0059] Reaction system: 1 μg of the recovered gene fragment template, 2 μL of 10×T7 reaction buffer, 2 μL of ATP, 2 μL of CTP, 2 μL of GTP, 2 μL of UTP, 2 μL of T7 Enzyme Mix, made up to 20 μL with nuclease-free water, incubated at 37 °C in the dark for 4 h, and placed at -20 °C overnight. The product was identified by 1% agarose gel electrophoresis, and the concentration of dsRNA was detected at a wavelength of 260 nm. The synthesized dsRNA was stored at -80 °C. The dsRNA sequence is shown as SEQ ID NO: 3 in the sequence listing.

[0060] 3. Collect freshly hatched second-stage juveniles (J2) of soybean cyst nematode. After washing them three times with 1 / 4 M9 buffer, reserve them for later use.

[0061] 4. The in vitro RNA interference of J2 of soybean cyst nematode refers to the method in the article (Urwin PE, Lilley CJ, Atkinson HJ. Molecular Plant-Microbe Interactions, 2002, 15: 747-752.). Take 500 J2 collected in step 3 of this example and soak them separately in treatment solution 1, treatment solution 2, and treatment solution 3, 500 per sample, with each treatment repeated three times. Incubate them with shaking in the dark at room temperature for 48 h.

[0062] Treatment solution 1 contains 50 mM (mol / L) octopamine, 3 mM (mol / L) spermidine, 0.05% gelatin, 1.5 mg / mL dsRNA, and 0.1 mg / mL FITC.

[0063] Treatment solution 2 (control group) contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, and 1.5 mg / mL dsRNA-GFP (the sequence is shown in SEQ ID NO: 4).

[0064] Treatment solution 3 (treatment group) contains 50 mM octopamine, 3 mM spermidine, 0.05% gelatin, and 1.5 mg / mL dsRNA-Hg-tax-2.

[0065] 5. Use a pipette to pick up several J2 in the treatment solution 1 group and detect whether green fluorescence is visible in the nematodes using a fluorescence microscope at a wavelength of 488 - 525 nm. Figure 3 is the fluorescence micrograph of J2 in the treatment solution 1 group. From Figure 3 it can be seen that dsRNA is successfully ingested into the J2, achieving silencing of the target gene Hg-tax-2 expression, and ultimately inhibiting the infectivity and reproductive ability of the nematodes.

[0066] 6. Extract the total RNA of soybean cyst nematode soaked in treatment solution 2 and treatment solution 3 and reverse transcribe it into cDNA. Apply fluorescence quantitative PCR to detect the expression level of gene Hg-tax-2 (using the actin gene as an internal reference). The results are as Figure 4 , Figure 4 is the effect of exogenous dsRNA treatment on the expression level of Hg-tax-2 in J2; from Figure 4 it can be seen that after treatment with dsRNA of Hg-tax-2, the expression level of Hg-tax-2 in soybean cyst nematode is significantly reduced.

[0067] Primers for fluorescence quantitative PCR detection:

[0068] Hg-tax-2F: 5'-GTCACTGATCGGACTGCACC-3'

[0069] Hg-tax-2R: 5'-AAGCGACCAGCACAAAGGAA-3'

[0070] Hg-actin F: 5'-GCGTGGTTACTCCTTCGTG-3'

[0071] Hg-actin R: 5'-CGGGCAGTTCGTAGCTCTTC-3'

[0072] 7. 250 second-instar larvae treated with treatment solution 2 and treatment solution 3 were inoculated onto soybean seedlings. After culturing in the dark for 24 h, the infection rate was detected by the fuchsin method. The above-ground parts of the soybeans were removed, and the soybean roots were rinsed clean with water and then soaked in a 1.5% sodium hypochlorite solution for 3 min. The soybean roots were taken out, and the sodium hypochlorite was thoroughly washed off with sterile water. The washed soybean roots were soaked in the fuchsin solution and heated until the solution boiled. After boiling for 30 s, it was left at room temperature until the fuchsin solution cooled to room temperature. One soybean root was taken, the surface fuchsin was washed with water, and then a slide was made. The number of nematodes invading the roots was counted under a stereomicroscope.

[0073] 8. The number of female worms on the root surface was counted 35 days after inoculation.

[0074] The effects of exogenous dsRNA-Hg-tax-2 treatment on the infectivity and fecundity of second-instar larvae of soybean cyst nematode are as Figure 5 and 6 shown. Among them, Figure 5 is the number of J2 in the roots 48 h after second-instar larvae J2 of the treatment group (dsRNA-Hg-tax-2) and the control group (dsRNA-GFP) invaded the soybean roots; Figure 6 is the number of female worms on the root surface 35 days after second-instar larvae J2 of the treatment group (dsRNA-Hg-tax-2) and the control group (dsRNA-GFP) were inoculated onto soybeans.

[0075] From Figures 4 - 6 it can be seen that after gene interference, the expression level of Hg-tax-2 decreased by 54.5%, and the number of nematodes invading the host roots and the number of female worms decreased by 47.7% and 39.98% respectively. The results show that dsRNA can interfere with the expression of Hg-tax-2, and the invasion and development of nematodes are affected after Hg-tax-2 silencing. It can be used as a target gene for nematicidal drugs for nematode control.

Claims

1. A soybean cyst nematode gene Hg-tax-2, characterized in that The nucleotide sequence of the soybean cyst nematode gene Hg-tax-2 is shown as SEQ ID NO: 1 in the sequence listing.

2. The protein encoded by the soybean cyst nematode gene Hg-tax-2 as described in claim 1, characterized in that The amino acid sequence of the protein encoded by the soybean cyst nematode gene Hg-tax-2 is shown as SEQ ID NO: 2 in the sequence listing.

3. The dsRNA of the soybean cyst nematode gene Hg-tax-2 according to claim 1, characterized in that The dsRNA sequence of the soybean cyst nematode gene Hg-tax-2, dsRNA-Hg-tax-2, and the nucleotide sequence of dsRNA-Hg-tax-2 are shown as SEQ ID NO: 3 in the sequence listing.

4. Use of the dsRNA of the soybean cyst nematode gene Hg-tax-2 as claimed in claim 1 in controlling nematodes.

5. The application according to claim 4, characterized in that, The specific method for controlling nematodes is as follows: Soak the second-stage larvae of soybean cyst nematodes with a treatment solution containing dsRNA of the soybean cyst nematode gene Hg-tax-2, and incubate with shaking in the dark at room temperature.

6. The application according to claim 5, characterized in that Incubate with shaking in the dark at room temperature for 40 - 50 h.

Images