Whole genome continuous mutation system based on base deaminase and application

Abstract

The invention discloses a whole genome continuous mutation system based on base deaminase and application. The whole genome continuous mutation system comprises a MutaGB-A system and a MutaGB-B system. The MutaGB-A system is a series of plasmids for coding'DNA replication protein-base deaminase 'fusion protein, and whole genome continuous mutation can be formed after report strains are converted; the MutaGB-B system is a series of plasmids for coding'DNA replication protein-base deaminase-phase separation element 'fusion protein, after a strain containing'DNA replication / repair protein-phase separation element' fusion protein is converted, whole genome continuous mutation can be more efficiently introduced, and the mutation type is expanded to cover all SNP (Single Nucleotide Polymorphism) types. The whole genome continuous mutation system can improve the mutation rate of yeast strains by more than ten thousand times, is controllable and continuous, and is suitable for different biological species. By combining with a corresponding screening method, the method can be used for rapidly obtaining a target strain with specific characters.

Description

Technical Field

[0001] This application relates to the field of gene editing, and mainly relates to a genome-wide continuous mutation system based on base deaminase and its application. Background Art

[0002] Mutation is the raw material for genomic basic and applied research. However, existing mutation methods have problems of insufficient depth and breadth, and cannot rapidly and controllably generate the required mutations across the entire genome. Single nucleotide polymorphisms (SNPs) refer to the changes in single nucleotide bases, including transitions, transversions, insertions, and deletions, resulting in polymorphisms of nucleic acid sequences. Currently, there is no evolutionary tool that can achieve full coverage of SNPs mutation types across the entire genome.

[0003] Traditional physical and chemical mutagenesis is one of the methods to obtain genetic diversity. However, this method requires multiple rounds of in vitro mutagenesis and screening carried out step by step, and heavily relies on human resources and the development of efficient large-scale screening technologies. Laboratory adaptive evolution promotes the adaptive evolution of organisms by imposing artificial interference and controlling the growth environment, generating tolerance to special environments. However, due to the limitation of the low mutation rate and the rarity of beneficial mutations, this evolutionary method still has not broken through the bottleneck of dependence on large population sizes and efficient screening methods. Therefore, using this method to improve biological chassis is still time-consuming and inefficient. Directed evolution uses molecular biology techniques to construct various mutation tools to increase the mutation rate to achieve the evolution of the chassis, quickly and efficiently constructing excellent chassis. Targeted continuous evolution technology establishes a high mutation system in vivo by using the error-prone replication system of Escherichia coli or introducing error-prone DNA polymerases, base deaminases, etc., and continuously and selectively performs base-level transitions, insertions, and deletions on single or multiple genes of interest in cells during cell replication, greatly accelerating the evolutionary process. However, this is a semi-rational evolutionary technology that specifically mutates single or multiple specific targets, still needs to be based on a certain understanding of the mechanism, and targeted evolution technology cannot achieve small fragment Indels across the entire genome.

[0004] In 2016, the team of David R. Liu performed point mutations on Cas9 amino acids (Asp10Ala and His840Ala). By fusing the catalytically inactive dCas9 with the highly active rat cytidine deaminase rAPOBEC1 that only acts on single-stranded DNA, the mutation from C.G to T.A was achieved, and for the first time, the cytosine base editor (CBE) that precisely modifies DNA and RNA at single-base resolution was developed. Subsequently, the adenine base editor (ABE), the glycosylase base editor (GBE), and the adenine transversion base editor (AYBE) were derived. CBE and ABE achieve point mutations through deamination, while GBE and AYBE introduce target mutations by generating AP sites. Based on the development of base deaminases, many base editing technologies have emerged. For example, the first random base editing technology, Helicase-AID, was formed by fusing the DNA helicase (DnaB, Mcm2-7 complex) and the cytidine deaminase AID to form DnaB-AID and Mcm5-AID, which increased the genomic mutation rate in Escherichia coli and Saccharomyces cerevisiae. However, the editing can only occur in the leading strand during DNA replication in the form of C to T and G to A. Additionally, the team of Jiazhang Lian developed the rBE tool by combining DNA replication-related proteins, including the single-stranded DNA-binding protein (replication factor A subunits RFA1, RFA2, RFA3), DNA primase PRI1, DNA helicase HCS1, and topoisomerase TOP1 with APOBEC, which can perform continuous evolution of the entire yeast genome. However, rBE can only introduce mutations from C to T and G to A in the whole genome. GBE and AYBE can utilize the DNA damage repair mechanism to achieve the mutual replacement of C and G and the precise editing from A to T and A to C in mammals, respectively. However, the precise editing of GBE and AYBE has different preferences in different species, and the current editing directions are only applicable to mammals, Escherichia coli, and plants.

[0005] In summary, there are still many deficiencies in the current gene mutation technologies. Therefore, it is of great significance to develop a series of whole-genome continuous mutation systems that can achieve precise and efficient mutations of various base types across the entire genome. Summary of the Invention

[0006] Aiming at the technical problems existing in the prior art, this application proposes a whole-genome continuous mutation system based on base deaminases and its applications.

[0007] According to one aspect of the present application, a genome-wide continuous mutation system based on base deaminase is proposed, including the MutaGB-A system capable of achieving genome-wide single-base continuous mutation and the MutaGB-B system based on phase separation technology to further improve the mutation rate and expand the mutation types; the MutaGB-A system is a series of plasmids encoding "DNA replication protein-base deaminase" fusion proteins, which can form genome-wide continuous mutations after being transformed into reporter strains; the MutaGB-B system is a series of plasmids encoding "DNA replication protein-base deaminase-phase separation element" fusion proteins. After being transformed into strains containing "DNA replication / repair protein-phase separation element" fusion proteins, it can more efficiently introduce genome-wide continuous mutations and expand the mutation types to cover all SNP types (single nucleotide polymorphism, including single-base mutations and small-scale nucleotide insertions and deletions).

[0008] The MutaGB-A system mainly includes two components: different types of genome replication-related proteins and different types of base deaminases, while the MutaGB-B system also includes a phase separation element and DNA replication / repair proteins coupled through phase separation. Through the effective use of the MutaGB-A system and the MutaGB-B system, genome-wide, continuous, and non-rational high-efficiency mutations can be achieved.

[0009] Preferably, the specific operation steps of the MutaGB-A system are as follows:

[0010] S1. Select genome-wide DNA replication-related proteins;

[0011] S2. Select the base deaminase corresponding to the desired mutation type;

[0012] S3. Connect the CDS sequences of the genome-wide DNA replication protein and the base deaminase through a Linker to construct the "DNA replication protein-base deaminase" plasmid;

[0013] S4. Transform the "DNA replication protein-base deaminase" plasmid in wild-type host cells, MAG1 knockout cells, or UNG1 knockout cells.

[0014] In a specific embodiment, knocking out the MAG1 or UNG1 gene locus can further improve the mutation rate of the MutaGB-A system.

[0015] Further preferably, the specific operation steps of the MutaGB-B system are as follows:

[0016] A1. Select a suitable phase separation element;

[0017] A2. Integrate the phase separation element into the "DNA replication protein - base deaminase" plasmid to construct the plasmid encoding the "DNA replication protein - base deaminase - phase separation element" fusion protein;

[0018] A3. Integrate the phase separation element into the strain genome to form a strain encoding the "DNA replication / repair protein - phase separation element" fusion protein;

[0019] A4. Transform the plasmid encoding the "DNA replication protein - base deaminase - phase separation element" fusion protein into the strain encoding the "DNA replication / repair protein - phase separation element" fusion protein.

[0020] Further preferably, it also includes A5: Repeat S1 - S4 and A1 - A4 to construct the MutaGB - A system and the MutaGB - B system of different species, and perform screening and culturing to verify the species universality of the whole - genome continuous mutation system.

[0021] Further preferably, the whole - genome DNA replication - related proteins include single - strand DNA - binding protein, topoisomerase, helicase, DNA polymerase α, DNA polymerase β, DNA polymerase γ, DNA polymerase δ or DNA polymerase ε. The above proteins all play a core role in the DNA replication process and are highly conserved among different species. In particular, SSB can bind to both the leading strand and the lagging strand simultaneously to achieve unbiased mutation of the DNA double - strand.

[0022] Further preferably, the base deaminase includes ABE8e F148A 、evoFERNY, ABE8e N46L or ABE8e. The above base deaminases have a low off - target rate and a high editing efficiency.

[0023] Further preferably, the MutaGB - B system utilizes the phase separation principle to form a specific DNA repair pathway after DNA deamination locally, thereby achieving different types of mutations.

[0024] Further preferably, the phase separation element includes FUS N -Cry2 or RGG. The nucleotide sequence of FUS N -Cry2 is shown in SEQ ID NO.1. FUS N -Cry2 is a phase separation element of a photosensitive protein, which has excellent flexibility, controllability and high specificity, and can selectively induce phase separation through light, thereby reducing the impact on cell function.

[0025] According to a second aspect of the present application, there is provided an application of a genome-wide continuous mutation system based on base deaminase in genome-wide continuous mutation of bacteria, fungi, plants and mammals. The DNA replication / repair protein is highly conserved, and the base deaminase is active in multiple species.

[0026] In a specific embodiment, genes encoding the corresponding SSB protein in Schizosaccharomyces pombe, cyanobacteria, and HEK293T cells are screened, the base deaminase corresponding to the required mutation type is selected, linked by a linker, driven by its own promoter and terminator for expression, placed into the corresponding plasmid backbone, a plasmid encoding "DNA replication protein-base deaminase" is constructed, and the corresponding host cells are transformed. The species universality of the genome-wide continuous mutation system based on base deaminase is demonstrated by 5-FOA counterselection, double resistance screening, and dual fluorescence system screening respectively.

[0027] Compared with the prior art, the beneficial effects of the present application are as follows:

[0028] (1) Compared with physical and chemical mutagenesis, the mutations mediated by the genome-wide continuous mutation tool generated in the present application occur naturally during cell division, so in vivo in-situ evolution can be achieved.

[0029] (2) Compared with laboratory adaptive evolution, the present application uses base deaminase to achieve genome-wide mutations while increasing the mutation rate, greatly accelerating the process of evolution.

[0030] (3) Compared with targeted evolution, in the case of unclear mechanism, the present application can perform non-rational mutations on the genome, which is very beneficial for exploring the relationship between genotype and phenotype.

[0031] (4) Compared with other genome-wide mutation tools, the present application introduces various types of single nucleotide polymorphisms (SNPs), including transitions, transversions, insertions and deletions, into the entire yeast genome, generating the required mutations controllably and rapidly.

[0032] (5) The mutation tool generated in the present application has no preference for the leading strand and the lagging strand during the replication process, and the universality of the system has been actually verified.

[0033] (6) The present application improves the accuracy of ABE8e N46L and the accuracy of ABE8e in mutating different species, avoiding the preference that only occurs in mammals. Description of the Drawings

[0034] The accompanying drawings are included to provide a further understanding of the embodiments and are incorporated into and constitute a part of this specification. The drawings illustrate the embodiments and, together with the description, are used to explain the principles of the invention. Other embodiments and many of the intended advantages of the embodiments will be readily apparent, as they become better understood by reference to the following detailed description. The elements of the drawings are not necessarily to scale with each other. Like reference numerals refer to corresponding like parts.

[0035] Figure 1 The flowchart of the base deaminase-based genome-wide continuous mutagenesis system according to a specific embodiment of the present application is shown;

[0036] Figure 2 The schematic diagram of the composition of the MutaGB-A system according to a specific embodiment of the present application is shown;

[0037] Figure 3 The schematic diagram of the composition of the MutaGB-B system according to a specific embodiment of the present application is shown;

[0038] Figure 4 The working mechanism diagram of the MutaGB-B system according to a specific embodiment of the present application is shown;

[0039] Figure 5 The principle of improving the mutation rate by knocking out the MAG1 and UNG1 genes according to a specific embodiment of the present application is shown;

[0040] Figure 6 The mutation rate detection result diagram and the statistical chart of base mutation types caused by the genome-wide continuous mutagenesis system MutaGB-A according to a specific embodiment of the present application are shown. Detailed Embodiments

[0041] The present application will be further described in detail below with reference to the accompanying drawings and embodiments. It can be understood that the specific embodiments described herein are only used to explain the related invention and not to limit the invention. Additionally, it should be noted that for the convenience of description, only the parts related to the relevant invention are shown in the drawings.

[0042] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments can be combined with each other. The present application will be described in detail below with reference to the drawings and embodiments.

[0043] Figure 1 The flowchart of a base deaminase-based genome-wide continuous mutagenesis system is shown. Refer to Figure 1 , the specific operation of a yeast genome-wide continuous mutagenesis system based on base deaminase includes the following steps:

[0044] (1) Construct the "DNA replication protein - base deaminase" plasmid to form the MutaGB-A system.

[0045] a. Fragment amplification. Design primers to PCR amplify the promoter sequence, CDS sequence, and terminator sequence of the RFA1, RFA2, and RFA3 genes encoding the SSB protein from the yeast genome respectively; the base deaminases ABE8e, evoFERNY sequences, and Linker are synthesized by Tsingke Biotechnology Co., Ltd. and delivered in the form of plasmids. Design primers to amplify evoFERNY, ABE8e F148A 、ABE8e N46L and the ABE8e sequence (the ABE8e F148A 、ABE8e N46L fragments are generated by modification based on ABE8e); achieve ABE8e F148A 、ABE8e N46L .

[0046] ABE8e(F148A):

[0047] Primer 1: GTGCGATGCCTATCGGATGCCTAGACAGGTG

[0048] Primer 2: GCATCCGATAGGCATCGCACAGCAGGGCGGCAC

[0049] ABE8e(N46L):

[0050] Primer 1: GAGGGCTGGCTGAGAGCCATCGGCCTGCACGA

[0051] Primer 2: ATGGCTCTCAGCCAGCCCTCGCCGATCACTC

[0052] Design primers to amplify the backbone fragments from the pRS423, pRS425, and NAT marker plasmid with the modified pRS425 backbone respectively.

[0053] The nucleotide sequences of evoFERNY and ABE8e are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively, and the nucleotide sequence of Linker is shown in SEQ ID NO.4.

[0054] The above fragments are respectively used for subsequent plasmid construction, as Figure 2 shown, including the 2μ-RFA1-evoFERNY plasmid, 2μ-RFA2-ABE8e N46L plasmid, 2μ-RFA2-ABE8e plasmid, and 2μ-RFA3-ABE8eF148A Plasmid.

[0055] b. Complement the URA3 gene at the original URA3 locus in the genome of BY4741 (leu2Δ0ura3Δ0his3Δ1met15Δ0) to construct the reporter strain A.

[0056] c. Transform the obtained series of plasmids into the reporter strain A to form the MutaGB-A system.

[0057] d. Use URA3 to knockout the MAG1 / UNG1 gene loci in the BY4741 genome respectively to construct the reporter strains B / C. Transform the obtained series of plasmids into the reporter strains B / C to further improve the mutation rate of the MutaGB-A system.

[0058] (2) Construct a "DNA replication protein - base deaminase - phase separation element" fusion protein plasmid to form the MutaGB-B system.

[0059] a. Select the phase separation element FUS N -Cry2.

[0060] b. Integrate FUS N -Cry2 into the end of the CDS sequence of the "DNA replication protein - base deaminase" plasmid, as Figure 3 shown, to construct the 2μ-RFA2-Deaminase-FUS N -Cry2 mutant plasmid of the MutaGB-B system.

[0061] c. Integrate FUS N -Cry2 into the end of the CDS of the genome encoding the DNA replication / repair protein of the strain respectively, and screen with the URA3 marker to form the reporter strain D encoding the "DNA replication / repair protein - phase separation element" fusion protein.

[0062] d. Transform the plasmid encoding the "DNA replication protein - base deaminase - phase separation element" fusion protein into the reporter strain encoding the "DNA replication / repair protein - phase separation element" fusion protein.

[0063] Utilize the phase separation principle to form a specific DNA repair pathway after DNA deamination locally, and then achieve different types of mutations. The working mechanism diagram is as Figure 4 shown.

[0064] Regarding the problem that precise mutations of GBE and AYBE only occur in mammals, Escherichia coli, and plants, this base deaminase-based genome-wide continuous mutation system improves the precision of mutations by using phase separation elements to couple base deaminases and UNG1 / MAG1, translesion synthesis pathway TLS-related proteins, and proteins related to the generation of AP sites.

[0065] In a specific embodiment, when MAG1 is present, hypoxanthine I is excised to generate an AP site. Through the translesion synthesis pathway TLS-related enzymes, different bases will be introduced opposite the AP site, thereby generating different mutations from A to G, A to T, and A to C. When UNG1 is present, uracil U is excised to generate an AP site. Through the translesion synthesis pathway TLS-related enzymes, different bases will be introduced opposite the AP site, thereby generating different mutations from C to T, C to G, and C to A. Therefore, when MAG1 and UNG1 are knocked out, the mutation rates of A to G and C to T will be increased. The principle is as Figure 5 shown.

[0066] In a specific embodiment, after the phase separation element couples the base deaminase and UNG1 / MAG1, in addition to coupling proteins related to the AP site, it can also bind proteins related to non-homologous end joining (NHEJ). After the AP site is generated, there is a chance to generate a double-strand break through AP endonuclease or AP hydrolase, and then through the NHEJ-related enzyme repair pathway, Indels can be introduced into the genome, thereby achieving full coverage of SNPs mutation types within the entire genome.

[0067] (3) Detection, calculation of the mutation rate of mutant strains, and confirmation of mutation types.

[0068] a. Use the 5-FOA screening method to back-screen URA3 mutant strains. By comparing the colony counts on 5-FOA plates and single-deficient medium plates, the mutation rate characterized by URA3 is obtained.

[0069] b. Pick a certain number of monoclonal colonies from the monoclonal colonies grown on the 5-FOA plate respectively for sequencing to confirm that their mutation types are the mutation types caused by the corresponding base deaminase plasmid.

[0070] In a specific embodiment, RFA1 and RFA3 are selected as candidate DNA replication proteins, and evoFERNY and ABE8e F148A base deaminases are selected as mutation machines to construct a yeast-based RFA1-evoFERNY genome-wide continuous mutation system and an RFA3-ABE8e F148A genome-wide continuous mutation system. The tested mutation rate can reach up to 3×10 -5Sequencing was performed by amplifying genomic fragments to determine that the type of base mutation caused was the editing type of the corresponding mutation tool. The detection results are as Figure 6 shown.

[0071] (4) Verify the species universality of the whole-genome continuous mutation system.

[0072] Screen the genes encoding the corresponding SSB proteins in Schizosaccharomyces pombe, cyanobacteria, and HEK293T cells. Select the base deaminase corresponding to the required mutation type, connect it through a Linker, drive the expression by its own promoter and terminator, and place it into the corresponding plasmid backbone to construct a plasmid encoding "DNA replication protein-base deaminase". Transform the corresponding host cells, and prove the species universality of the whole-genome continuous mutation method based on base deaminase through different screening methods.

[0073] In a specific embodiment, Schizosaccharomyces pombe was complemented with URA3 in situ in the host cell, and reverse screening was performed with 5-FOA. By comparing the colony counts on the 5-FOA plate and the single-deficient medium plate, the mutation rate characterized by URA3 was obtained.

[0074] In a specific embodiment, cyanobacteria were screened through inactivated kana. When the start codon ATG of kana mutates to ACG, the strain cannot survive on the kana-resistant plate. If the deaminase of the C-to-T mutation type works, mutant strains can be screened out on the kana-resistant plate; when the codon encoding trp at position 28 of kana mutates from TGG to TGA, the strain cannot survive on the kana-resistant plate. If the deaminase of the A-to-G mutation type works, mutant strains can be screened out on the kana plate.

[0075] In a specific embodiment, HEK293T cells successfully transformed were screened through red fluorescence, and a green fluorescent tag was inserted after the red fluorescent protein. Using flow cytometry screening, if the deaminase of the C-to-T mutation type works, it may mutate into a stop codon, inactivate the green fluorescent protein, and the cells do not emit green light; if the deaminase of the A-to-G mutation type works, the green fluorescent protein inactivated by mutation to produce a stop codon resumes fluorescence, and the cells emit green light. The mutation rate was characterized by the expression of the green fluorescent protein.

[0076] The specific implementation manners of the present application have been described above, but the protection scope of the present application is not limited thereto. Any person skilled in the art can easily think of changes or substitutions within the technical scope disclosed by the present application, and all of them should be covered within the protection scope of the present application. Therefore, the protection scope of the present application should be subject to the protection scope of the claims.

[0077] In the description of the present application, it should be understood that the term "comprising" does not exclude the presence of elements or steps not listed in the claims. The articles "a" or "an" preceding an element do not exclude the presence of a plurality of such elements. The mere fact that certain measures are recited in mutually different dependent claims does not indicate that a combination of these measures cannot be used to advantage. Any reference signs in the claims should not be construed as limiting the scope.

Claims

1. A genome-wide continuous mutation system based on base deaminase, characterized in that It includes the MutaGB-A system and the MutaGB-B system; the MutaGB-A system is a series of plasmids encoding a "DNA replication protein-base deaminase" fusion protein; the MutaGB-B system is a series of plasmids encoding a "DNA replication protein-base deaminase-phase separation element" fusion protein.

2. The genome-wide continuous mutation system based on base deaminase according to claim 1, wherein The specific operation steps of the MutaGB-A system are as follows: S1. Select the whole-genome DNA replication-related proteins; S2. Select the base deaminase corresponding to the required mutation type; S3. Connect the CDS sequences of the whole-genome DNA replication protein and the base deaminase through a Linker to construct the "DNA replication protein-base deaminase" plasmid; S4. Transform the "DNA replication protein-base deaminase" plasmid in wild-type host cells, MAG1 knockout cells or UNG1 knockout cells.

3. The genome-wide continuous mutation system based on base deaminase according to claim 2, characterized in that, The specific operation steps of the MutaGB-B system are as follows: A1. Select a suitable phase separation element; A2. Integrate the phase separation element into the "DNA replication protein-base deaminase" plasmid to construct a plasmid encoding a "DNA replication protein-base deaminase-phase separation element" fusion protein; A3. Integrate the phase separation element into the strain genome to form a strain encoding a "DNA replication / repair protein-phase separation element" fusion protein; A4. Transform the plasmid encoding the "DNA replication protein-base deaminase-phase separation element" fusion protein into the strain encoding the "DNA replication / repair protein-phase separation element" fusion protein.

4. The genome-wide continuous mutagenesis system based on base deaminase according to claim 3, wherein It also includes A5: Repeat the S1-S4 and the A1-A4 to construct the MutaGB-A system and the MutaGB-B system of different species, and perform screening, cultivation, and verify the species universality of the whole-genome continuous mutation system.

5. The genome-wide continuous mutagenesis system based on a base deaminase according to claim 2, wherein, The whole-genome DNA replication-related proteins include single-stranded DNA-binding protein, topoisomerase, helicase, DNA polymerase α, DNA polymerase β, DNA polymerase γ, DNA polymerase δ or DNA polymerase ε.

6. The genome-wide continuous mutagenesis system based on base deaminase according to claim 2, wherein The base deaminase includes ABE8e F148A , evoFERNY, ABE8e N46L or ABE8e.

7. The genome-wide continuous mutation system based on base deaminase according to claim 3, wherein The MutaGB-B system uses the principle of phase separation to form a specific DNA repair pathway after DNA deamination locally.

8. The genome-wide continuous mutagenesis system based on base deaminase according to claim 3, wherein The phase separation element includes FUS N -Cry2 or RGG.

9. Use of a base deaminase-based genome-wide continuous mutagenesis system according to any one of claims 1-8 in genome-wide continuous mutagenesis of bacteria, fungi, plants and mammals, characterized in that, The DNA replication / repair proteins are highly conserved, and the base deaminases are active in multiple species.

Images