T vector plasmid fused with Lacz gene and applicable to blue-white spot screening and preparation of T vector plasmid
By fusing the Lacz gene at the XcmI enzyme cleavage site in the Puc19 plasmid, the T vector plasmid was constructed, and the problem of high cost of commercial T vectors was solved, efficient and low-cost cloning screening and sequencing were achieved, reducing the conversion cost of gene synthesis companies.
Patent Information
- Application Number
- CN202510626216.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-15
- Publication Date
- 2025-07-25
AI Technical Summary
Commercial T carriers are costly, the preparation process is complex and the effect is not ideal, making it difficult to effectively reduce the conversion costs of gene synthesis-related companies.
A T vector plasmid was prepared for blue and white spot screening in the Lacz gene. By fusing gene fragments of two XcmI enzyme cleavage sites in the Puc19 plasmid, the T vector plasmid was constructed. After XcmI enzyme cleavage treatment, it was specifically linked to the PCR product with A prominent end at the 3' end, and the empty vector was screened with blue and white spot screening technology.
The preparation cost of a single conversion vector is significantly reduced to 0.15 yuan/time, and the yield and operation ease of positive clones are improved. Almost all clones are positive clones, with extremely low background of empty vectors, which reduces the conversion cost of enterprises.
Smart Images

Figure CN120366353A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of cloning vectors, and particularly relates to a T-vector plasmid fused with the Lacz gene suitable for blue-white screening and a preparation method thereof. Background Art
[0002] Currently, there are roughly two types of amplification enzymes. One is the amplification enzyme with an A at the 3′ end of the amplified product, such as Taq enzyme, and the other is the amplification enzyme with a blunt end at the end of the amplified product, such as Pfu enzyme. In natural science research, a large number of known or unknown fragments need to be amplified by PCR, then sequenced to verify the obtained DNA sequence, and then a series of subsequent functional analyses or other studies are carried out. In the case where the template sequence is unknown or the template is a mixture, it is usually not possible to directly sequence the PCR product. The main consideration is that when the template is impure, the PCR product is very likely to be purified into a mixture, not a single sequence. After sequencing, it is a multi-peak overlapping peak result, making it difficult to analyze an accurate result. Therefore, in practical applications, a verification method of first cloning the PCR product (based on the principle of plasmid incompatibility, only one plasmid with resistance can survive in a cell) and then sequencing the corresponding positive clone is often adopted, which can determine the accurate result of the unknown sequence with 100%. This involves the problem of selecting a cloning vector. According to the characteristics of different PCR products, different cloning vectors are selected for cloning and screening. For common blunt-end products, the Puc57 vector with the Lacz gene blue-white screening function is usually used, and for genes with an A at the 3′ end, the T-vector is usually used.
[0003] Commercially available T-vectors on the market are relatively mature in application, convenient to use, and have a high positive rate, but the purchase cost is relatively high. The single-transformation vector cost of some manufacturers is 20 yuan per time. For experiments that require screening a large number of fragments, this cost is obviously too high. Currently, T-vectors are all prepared by first linearizing the cloning vector with a blunt-end enzyme and then performing a T-adding treatment at the end. The preparation process is relatively complex, and the final yield and use effect of self-preparation in a conventional laboratory are not ideal. Summary of the Invention
[0004] In view of the technical problems existing in the background art, the present invention provides a T-vector plasmid fused with the Lacz gene suitable for blue-white screening, a preparation method thereof, and an application, aiming to solve the problem of the high cost of commercially available T-vectors.
[0005] In the first aspect, the present invention provides a preparation method of a T-vector plasmid fused with the Lacz gene suitable for blue-white screening, specifically: using a plasmid containing the Lacz gene as the starting plasmid, and fusing a gene fragment with two XcmI restriction sites into the Lacz gene to obtain the T-vector plasmid.
[0006] Preferably, in the above preparation method, the nucleotide sequence of the Lacz gene incorporating two XcmI restriction sites is as shown in SEQ ID NO.1.
[0007] More preferably, in the above preparation method, two primers with sequences as shown in SEQ ID NO.3 - 4 are used to incorporate the XcmI restriction sites into the Lacz gene.
[0008] Preferably, in the above preparation method, the starting plasmid is the Puc19 plasmid.
[0009] In some embodiments of the present invention, the T - vector plasmid is specifically prepared through the following steps: S1. The starting plasmid is linearized using XbaI and SalI enzymes, and two primers with sequences as shown in SEQ ID NO.3 - 4 are annealed. S2. After ligating the linearized vector obtained in step S1 with the annealed product, it is transformed into competent cells, cultured, and blue - colony clones are picked and the plasmids are extracted to obtain the T - vector plasmid.
[0010] Among them, the annealing conditions for step S1 can be: incubating at 96°C for 10 minutes and then naturally cooling to room temperature; in step S2, T4 ligase can be used to ligate the linearized vector and the annealed product.
[0011] The T - vector plasmid incorporating the Lacz gene constructed based on the above preparation method and applicable to blue - white screening also belongs to the protection scope of the present invention.
[0012] In the second aspect, the present invention provides the application of the above - mentioned T - vector plasmid incorporating the Lacz gene and applicable to blue - white screening in the sequencing of PCR products with an A - overhang at the 3′ - end. The application method includes the following: first, the T - vector plasmid is linearized using XcmI enzyme, then the linearized vector is ligated with the PCR product with an A - overhang at the 3′ - end, transformed into competent cells, cultured, and finally white - colony clones are picked for colony PCR and / or sequencing.
[0013] The principle of screening and sequencing the PCR products with an A - overhang at the 3′ - end using the T - vector plasmid constructed by the present invention is as follows: after fusing two gene fragments with XcmI restriction sites into the Lacz gene of the starting plasmid, the resulting T - vector plasmid will have a T - overhang at each end after being treated with XcmI enzyme. Under the action of ligase, it can specifically ligate with the product with an A - overhang at the 3′ - end. At the same time, the empty vector that has not been cut by XcmI enzyme or the self - ligated empty vector will show as a blue colony due to the presence of the Lacz gene and will be excluded during screening.
[0014] Compared with the prior art, the beneficial effects of the present invention are: The T-vector plasmid provided by the present invention is extremely convenient to use. Almost all the clones grown are positive clones. With the conditions of blue-white screening, the background of empty vectors can be completely eliminated. Moreover, this T-vector plasmid is compatible with all commercially available competent cells. When in use, it only needs to be digested with XcmI enzyme, and there is no need for subsequent addition of T treatment. Therefore, compared with traditional T-vectors, it has the characteristics of fewer operation steps, higher yield, and higher positive transformation rate.
[0015] The preparation cost of the single transformation vector in the present invention can be reduced to 0.15 yuan per time, which is much lower than the current commercial T-vector (20 yuan per time), effectively reducing the transformation cost of gene synthesis-related enterprises. Therefore, it has excellent application prospects. Brief Description of the Drawings
[0016] In order to more clearly illustrate the technical solutions of the present invention, the drawings used in the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0017] Figure 1 It is a schematic design diagram of the T-vector plasmid in Example 1 of the present invention; Figure 2 It is a sequencing alignment result diagram of positive clones in Example 1 of the present invention; Figure 3 It is a map of the JKR-19T plasmid in Example 1 of the present invention; Figure 4 It is a comparison of the plaque formation situations of different experimental groups in Example 2 of the present invention; Figure 5 It is a gel electrophoresis diagram of colony PCR in Example 2 of the present invention. Detailed Embodiments
[0018] The embodiments of the technical solutions of the present invention will be described in detail below with reference to the drawings. The following embodiments are only used to more clearly illustrate the technical solutions of the present invention, so they are only examples and cannot be used to limit the protection scope of the present invention.
[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field of the present invention; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention; the terms "including" and "having" and any variations thereof herein are intended to cover non-exclusive inclusion.
[0020] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as a limitation to the present invention. For those embodiments where specific technologies or conditions are not indicated, the technologies or conditions described in the literature in the art or according to the product instructions are followed. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0021] Example 1 This example provides a T-vector plasmid that integrates the Lacz gene and is suitable for blue-white screening, where Figure 1 is the design schematic diagram of the T-vector plasmid, and the full sequence of the Lacz gene in the T-vector plasmid is shown in SEQ ID NO.1.
[0022] The construction method of the above T-vector plasmid includes the following steps: (1)Linearization of the vector.
[0023] In this example, the standard Puc19 plasmid is used as the starting plasmid, and its full plasmid sequence is shown in SEQ ID NO.2.
[0024] The Puc19 plasmid is digested and linearized with XbaI enzyme and SalI enzyme. After preparing the digestion system according to Table 1 and mixing evenly, it is placed in a 37°C water bath for 1 h. After the reaction is completed, gel electrophoresis is carried out for gel purification, and 40 μL is eluted for standby.
[0025] Table 1 Linearization digestion system
[0026] (2)Preparation of the annealing product.
[0027] Synthesize the following two primers: JKR19T-THPF: ctagaccccagtagtcccctggttcccacgaaaggtctggag (SEQ ID NO.3); JKR19T-THPR: tcgactccagacctttcgtgggaaccaggggactactggggt (SEQ ID NO.4).
[0028] First dissolve the primers JKR19T-THPF and JKR19T-THPR, and the final concentration of the primers after dissolution is 50 pmol / μL. Anneal the two primers. Specifically: Prepare according to the reaction system shown in Table 2 in a PCR tube, place the PCR tube in a PCR instrument at 96°C for 10 minutes, and naturally cool to room temperature.
[0029] Table 2 Annealing reaction system
[0030] (3)Ligation and transformation.
[0031] After preparing the reaction system according to Table 3, place it at room temperature (22 °C) for 30 min of ligation, then add 50 μL of competent top10 cells, place it on ice for 10 min, then perform heat shock at 42 °C for 90 s. After that, place it in an ice bath on ice for 3 min, add 200 μL of LB medium, and recover at 37 °C on a shaker for 1 h. After the recovery is complete, spread all the bacterial liquid onto an Amp+X-Gal+IPTG resistant petri dish and incubate at a constant temperature of 37 °C for 8 - 10 h.
[0032] Table 3 Ligation reaction system
[0033] (4)Positive clone screening. Observe the colony growth on the petri dish cultured in step (3), and pick multiple blue colony colonies for colony PCR verification.
[0034] Single colony picking: Pour LB medium into the multi-channel pipette trough, then use the multi-channel pipette to add 500 μL of LB medium to a 48-well deep well plate. Use forceps to pick a sterilized small pipette tip to pick a single colony on the plate and place it in the 48-well deep well plate. At the same time, make records on the 48-well deep well plate and the 96-well screening form. Cover the picked 48-well deep well plate with a sealing film and make corresponding marks (date, plate number, etc.). Use a needle to punch holes in the sealing film and place it on a shaker at 37 °C for 2 hours.
[0035] Colony PCR reaction: Prepare the reaction system according to Table 4, add the prepared reaction solution to a 96-well reaction plate, use the multi-channel pipette to add 2.0 μL of bacterial liquid to it (note to make marks on the 96-well reaction plate), cover the 96-well reaction plate with a rubber pad on the PCR instrument (note that the lid of the PCR instrument must be tightened), and set the reaction program according to the PCR reaction conditions shown in Table 5.
[0036] Table 4 Colony PCR reaction system
[0037] Table 5 Colony PCR reaction program
[0038] Agarose gel electrophoresis: Prepare an agarose gel (i.e., weigh 1.2 g of agarose and add 100 mL of TAE), add 0.5 μL of bromophenol blue to each tube in the 96-well reaction plate, shake well, and then load the samples; Take a photo of the electrophoresed agarose gel and name and save it.
[0039] Identify positive clones and send them for sequencing: ① For JKR-19T, amplify using M13-F and M13-R. The theoretical size is 170 bp, and identify positive clones based on the agarose gel electrophoresis pattern; ② Refer to the 96-well screening table and 48-well deep well plate, aspirate the positive clone bacterial solution, transfer it to a 1.5 mL EP tube, and label the tube; ③ Verify the corresponding bacterial solution of the positive clone by sequencing.
[0040] Figure 2 The comparison results of three of the clones are shown. The sequencing of the three clones was compared with the standard sequence (SEQ ID NO.1). The peak pattern was completely accurate and the sequence was correct, indicating that the JKR-19T plasmid construction was successful. The correctly constructed T-vector plasmid verified by sequencing was prepared in large quantities, and the bacterial solution was extracted using Axygen's plasmid miniprep kit for subsequent verification.
[0041] Name the T-vector plasmid prepared in this example as the JKR-19T plasmid. Its map is as Figure 3 shown, and the complete plasmid sequence is as shown in SEQ ID NO.5.
[0042] Example 2 Using the JKR-19T plasmid prepared in Example 1, in this example, PCR products with an A-overhang at the 3′ end were screened and sequenced. At the same time, aspects such as the ligation efficiency between the plasmid digested with XcmI and the PCR products with an A-overhang at the 3′ end and the amount of empty vector background were verified. The specific operations are as follows: Linearize JKR-19T using XcmI to digest the vector. Prepare the reaction system according to Table 6, mix well, and incubate in a 37 °C water bath for 1 h. After the reaction, perform gel electrophoresis, cut the gel for purification, and elute 40 μL for use. Table 6 JKR-19T plasmid digestion reaction system
[0043] Preparation of PCR products with an A-overhang at the 3′ end: Amplify a template with a known sequence using Taq enzyme, cut the gel for purification to obtain a 500 bp fragment for use.
[0044] Set up three groups of control experiments, A, B, and C, according to Table 7. The ligation and transformation process refer to Example 1. After culturing for 8 - 10 h, observe the colony growth of the three groups of controls, A, B, and C, and perform colony PCR verification on the white colonies (theoretical positive clone colonies).
[0045] Table 7 Experimental setup
[0046] The theoretical results are as follows: A) A large number of white colonies, very few blue colonies, and the white colonies were all verified as positive by colony PCR and sequencing; B) Very few blue colonies and no white colonies; C) Very few blue colonies and no white colonies.
[0047] The actual results are shown in Table 8, and the spots on the control culture dishes of groups A, B, and C are shown in Figure 4 .
[0048] Table 8 Statistics of spots in different experimental groups
[0049] Eight clones were randomly selected from group A for colony PCR verification and all were positive (positive size 670 bp), see Figure 4 ; Then, 3 samples were randomly selected for sequencing verification, and the sequences were all correct.
[0050] It can be seen that almost all clones that grew are positive clones, and the empty background is extremely low. Combined with the blue-white screening conditions, the empty background of less than 1% can be completely eliminated. In addition, the JKR-19T plasmid is treated with XcmI enzyme digestion and the plasmid can be used in the transformation experiment after gel excision and recovery. The operation process is simple and the vector preparation rate is high.
[0051] In summary, the T vector plasmid provided by the present invention is extremely easy to use. When using this plasmid for T vector cloning construction, it is only necessary to select white colonies for PCR verification to screen a large number of positive clones; and after calculation, the preparation cost of a single transformation vector can be reduced to 0.15 yuan / time, which greatly reduces the transformation cost of the enterprise compared with the commercialized T vectors (20 yuan / time) of other companies. It can be seen that the T vector plasmid provided by the present invention has extremely high commercial value.
[0052] It should be noted that the present invention is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present invention are all included in the technical scope of the present invention. In addition, without departing from the scope of the main purpose of the present invention, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present invention.
Claims
1. A method for preparing a T-vector plasmid incorporating the Lacz gene for blue-white screening, characterized in that, Using the plasmid containing the Lacz gene as the starting plasmid, a gene fragment with two XcmI restriction sites was fused into the Lacz gene to obtain the T-vector plasmid.
2. The preparation method according to claim 1, characterized in that, The nucleotide sequence of the Lacz gene fused with two XcmI restriction sites is shown in SEQ ID NO.
1.
3. The preparation method according to claim 2, characterized in that, Two primers with sequences shown in SEQ ID NO.3 - 4 were used to fuse the XcmI restriction sites into the Lacz gene.
4. The preparation method according to claim 3, wherein The starting plasmid is the Puc19 plasmid.
5. The preparation method according to claim 4, characterized in that, It includes the following steps: S1. The starting plasmid was linearized using XbaI and SalI enzymes, and two primers with sequences shown in SEQ ID NO.3 - 4 were annealed. S2. After ligating the linearized vector obtained in step S1 with the annealing product, it was transformed into competent cells, cultured, blue colonies were picked and plasmids were extracted to obtain the T-vector plasmid.
6. The preparation method according to claim 5, characterized in that, In step S2, T4 ligase was used to ligate the linearized vector with the annealing product.
7. The preparation method according to claim 5, characterized in that, The conditions for the annealing treatment were: incubate at 96°C for 10 minutes and then cool naturally to room temperature.
8. A T-vector plasmid with a fused Lacz gene prepared according to any one of claims 1 - 7 and suitable for blue-white screening.
9. The application of the T-vector plasmid with a fused Lacz gene prepared according to claim 8 and suitable for blue-white screening in the sequencing of PCR products with an A overhang at the 3′ end.
10. The application according to claim 9, wherein The T-vector plasmid was linearized using XcmI, the linearized vector was ligated with the PCR product with an A overhang at the 3′ end, then transformed into competent cells, cultured, and white colonies were picked for colony PCR and / or sequencing.