Application of BnKIN10 gene in regulation and control of oil content of rapeseed grains
By inhibiting the expression of BnKIN10 gene in rapeseed and building an efficient genetic transformation system, the problem of gaps in the gene function of the SnRK1 family was solved, and the regulation of rapeseed grain oil synthesis was achieved, providing theoretical basis and breeding ideas for the improvement of rapeseed varieties.
Patent Information
- Application Number
- CN202510589221.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-07-25
AI Technical Summary
In rapeseed, the role of the SnRK1 family gene, especially KIN10, in oil and fat anabolic metabolism has not been fully studied, which has affected the regulation of oil content of rapeseed grains.
By inhibiting the expression of the BnKIN10 gene in rapeseed, the BnKIN10-RNAi interference vector was transferred to rapeseed by Agrobacterium mediating method to construct an efficient genetic transformation system, which significantly reduced the expression level of the BnKIN10 gene.
The regulatory role of the BnKIN10 gene in rapeseed grain oil synthesis is clarified, and technical support for improving rapeseed quality is provided, which provides new ideas for molecular design and breeding of rapeseed varieties, reducing the oil content of the grain.
Smart Images

Figure CN120366370A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of the BnKIN10 gene in regulating the oil content of rapeseed grains. Background Art
[0002] Rapeseed grains are rich in vegetable oil and are one of the main sources of products such as human daily edible oil, industrial lubricants, and biodiesel. With the continuous improvement of consumers' requirements for the quality of vegetable oil, developing rapeseed varieties with high oil content and high quality has become one of the core objectives of modern rapeseed breeding. As a key trait determining the oil production level per unit area, the formation of seed oil content is closely related to multiple metabolic pathways and is co-regulated by multiple structural genes and regulatory factors.
[0003] Existing molecular breeding strategies for increasing rapeseed seed oil content mainly focus on enhancing the oil synthesis pathway or inhibiting the oil degradation process. By overexpressing key enzymes or transcription factors such as BnaWRI1, BnaDGAT1, and BnaFAE1, the fatty acid synthesis efficiency and oil accumulation level can be significantly improved. In addition, regulating carbon source transport-related genes such as SUC1 and GPT1 has also been proven to help increase the proportion of carbon flow to lipid synthesis. On the other hand, reducing the expression of esterase and lipase (such as BnSFAR) in the lipid degradation pathway can also reduce the loss of oil in mature seeds. Through these "increase synthesis + reduce decomposition" strategies, multiple studies have reported a steady increase in rapeseed grain oil content.
[0004] In terms of transcriptional regulation, multiple transcription factors closely related to fatty acid synthesis and oil accumulation have been identified. For example, WRI1 (WRINKLED1) is a key activator regulating fatty acid synthesis; seed-specific B3 domain transcription factors such as LEC1, LEC2, and FUS3 play a coordinating role in seed maturation, carbon flux distribution, and oil synthesis. These genes also have multiple homologous copies in rapeseed and show certain functional conservation, demonstrating certain application potential in genetic improvement practices. In addition to transcription factors, protein kinases also play important roles in regulating plant metabolism and development. For example, the rapeseed kinase BnCIPK9 regulates seed oil content by integrating sugar and ABA signal transduction. In addition, in Arabidopsis thaliana, SnRK1 (SNF1-related kinase 1), as an energy sensor, has extensive regulatory functions in carbon metabolism, lipid metabolism, stress response, etc. Existing studies have shown that in Arabidopsis thaliana, SnRK1 can regulate the expression of genes related to oil synthesis such as WRI1 and DGAT1, thereby affecting the accumulation of seed oil. However, in rapeseed, there is still a lack of functional verification studies on SnRK1 family members, especially its catalytic subunit such as KIN10. Although some kinase genes are actively expressed during seed development, their specific roles in oil synthesis metabolism are still unclear, and relevant functional studies are scarce. Summary of the Invention
[0005] The object of the present invention is to provide the application of the BnKIN10 gene in regulating the oil content of rapeseed seeds to solve the problems existing in the above-mentioned prior art. The present invention first clarifies the regulatory role of the BnKIN10 gene in rapeseed seed oil synthesis, filling the gap in the functional research of SnRK1 family genes in rapeseed.
[0006] To solve the above problems, the present invention provides the following solutions:
[0007] Technical solution 1: The application of the BnKIN10 gene in regulating the oil content of rapeseed seeds, wherein the nucleotide sequence of the BnKIN10 gene is as shown in SEQ ID NO.3.
[0008] Furthermore, the regulation includes: when the BnKIN10 gene is inhibited in rapeseed, the oil content of the rapeseed seeds can be reduced.
[0009] Furthermore, the method of inhibition includes the following steps: constructing a recombinant plasmid by combining the BnKIN10 gene with an expression vector; transferring the recombinant plasmid into rapeseed by Agrobacterium-mediated transformation to inhibit the BnKIN10 gene.
[0010] Furthermore, when transforming rapeseed by Agrobacterium-mediated transformation, the infection site of Agrobacterium is the hypocotyl of rapeseed.
[0011] Technical solution 2: A method for cultivating rapeseed varieties, comprising the steps of inhibiting the BnKIN10 gene in rapeseed to obtain a rapeseed variety with stable inheritance of BnKIN10 gene inhibition; the nucleotide sequence of the BnKIN10 gene is as shown in SEQ ID NO.3.
[0012] The present invention discloses the following technical effects:
[0013] The present invention has first clearly defined the regulatory role of the BnKIN10 gene in rapeseed seed oil synthesis, filling the gap in the functional research of the SnRK1 family genes in rapeseed. The present invention has constructed an efficient BnKIN10-RNAi interference vector and genetic transformation system, significantly reducing the expression level of the target gene, providing a reliable tool for gene function research. And the oil content of seeds is measured by near-infrared spectroscopy, providing technical support for rapeseed quality improvement. The present invention reveals the regulatory strategy of the BnKIN10 gene, providing a new idea for the molecular design breeding of rapeseed varieties. In summary, the present invention reveals the regulatory role of BnKIN10 in rapeseed seed oil synthesis, providing an important theoretical basis and gene resources for in-depth analysis of the oil metabolism network and carrying out molecular design breeding of rapeseed quality traits. Description of the Drawings
[0014] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0015] Figure 1 It is the electrophoresis diagram of the PCR amplification product of the BnKIN10 interference target sequence;
[0016] Figure 2 It is the structural schematic diagram of the pCAMBIA1304-BnKIN10-RNAi construct;
[0017] Figure 3 It is the phenotype diagram of BnKIN10-RNAi transgenic positive plants (#1 and #2) and wild-type plants (WT);
[0018] Figure 4 It is the analysis diagram of the expression level of the BnKIN10 gene in transgenic materials;
[0019] Figure 5 It is the measurement result of the oil content in the seeds of wild-type plants (WT) and BnKIN10-RNAi #1-#2. Detailed Embodiments
[0020] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation on the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0021] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0022] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0023] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and examples are merely exemplary.
[0024] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.
[0025] The rapeseed used in the present invention is the Brassica napus variety Westar.
[0026] The culture media and their components used in the embodiments of the present invention are as follows:
[0027] M0 basal medium: Used for pre-culturing rapeseed seeds before germination, without adding any plant hormones. The formula is as follows: MS salts: 4.4 g / L, sucrose: 30 g / L, Phytagel: 5.5 g / L, pH adjusted to 5.8, autoclaved (121 °C, 20 minutes);
[0028] M1 Co - culture Medium: This medium is used for the co - culture treatment of explants and Agrobacterium to promote T - DNA integration. The formula is as follows: MS salts: 4.4 g / L, sucrose: 30 g / L, mannitol: 18 g / L, 2,4 - D: 1.0 mg / L, KT: 0.3 mg / L, acetosyringone (AS): 100 μmol / L (added after filtration sterilization), Phytagel: 5.5 g / L, pH adjusted to 5.8, autoclaved (except for AS);
[0029] M2 Selection Medium: This medium is used for the resistance screening and bud induction of explants during the rapeseed genetic transformation process. The formula is as follows: MS salts: 4.4 g / L, sucrose: 30 g / L, BA (6 - benzylaminopurine): 1.0 mg / L, NAA (naphthaleneacetic acid): 0.05 mg / L, selection agent (selected according to the transformation construct): Basta (glufosinate) 5 - 10 mg / L or Kanamycin 50 mg / L, antibiotics: Timentin or Cefotaxime 150 - 300 mg / L (used to inhibit Agrobacterium), Phytagel: 5.5 g / L, pH adjusted to 5.8, autoclaved (121 °C, 20 minutes; except for hormones and antibiotics, which need to be added aseptically after cooling);
[0030] M3 Medium: It is used to promote the differentiation of callus into buds. The formula is as follows: MS salts: 4.4 g / L, glucose: 10 g / L, xylose: 0.25 g / L, MES buffer: 0.6 g / L, ZT (zeatin): 2.0 mg / L, IAA (indole - 3 - acetic acid): 0.1 mg / L, AgNO3: 150 μmol / L (added after filtration sterilization), TMT: 300 mg / L, Phytagel: 5.5 g / L, pH adjusted to 5.8;
[0031] M4 Rooting Medium: It is used to induce the rooting of green buds and form complete plants. The formula is as follows: MS salts: 4.4 g / L, sucrose: 20 g / L, IAA: 0.5 mg / L, Phytagel: 5.5 g / L, pH adjusted to 5.8, autoclaved.
[0032] Example 1 Cloning and Vector Construction of BnKIN10 RNA Interference Fragment
[0033] Target Sequence Design and Amplification: By aligning the CDS regions of 5 BnKIN10 homologous genes in rapeseed, a highly conserved segment with a length of approximately 500 bp was screened out as the target sequence for RNA interference (Target Sequence 1 and Target Sequence 2); The amino acid sequence of the protein encoded by BnKIN10 is shown in detail in SEQ ID NO.3.
[0034] Target Sequence 1:
[0035] ATTTCTGGAAAATTATATGCTGGCCCTGAAGTAGACGTCTGGAGTTGTGGTGTGATACTCTACGCTCTTCTTTGTGGGACTCTTCCGTTCGATGATGAGAACATTCCCAACCTTTTTAAGAAGATTAAGGGAGGAATATATACACTACCGAGCCATTTATCTGGTGGTGCTAGAGATTTGATCCCGAGGATGCTCGTGGTAGACCCCATGAAAAGAGTAACCATACCTGAGATCCGGCAACACAATTGGTTCCAAGCTCATCTTCCAAGGTATTTAGCTGTTCCTCCTCCGGATACGGTGCAGCAGGCCAAAAAGAT(SEQ ID NO.1);
[0036] Target sequence 2:
[0037] ATCTTTTTGGCCTGCTGCACCGTATCCGGAGGAGGAACAGCTAAATACCTTGGAAGATGAGCTTGGAACCAATTGTGTTGCCGGATCTCAGGTATGGTTACTCTTTTCATGGGGTCTACCACGAGCATCCTCGGGATCAAATCTCTAGCACCACCAGATAAATGGCTCGGTAGTGTATATATTCCTCCCTTAATCTTCTTAAAAAGGTTGGGAATGTTCTCATCATCGAACGGAAGAGTCCCACAAAGAAGAGCGTAGAGTATCACACCACAACTCCAGACGTCTACTTCAGGGCCAGCATATAATTTTCCAGAAAT(SEQ ID NO.2);
[0038] Nucleotide sequence of the BnKIN10 gene:
[0039]
[0040] Amino acid sequence of BnKIN10:
[0041] MDGSGGRGGVESILPNYKLGRTLGIGSFGRVKIAEHSLTGHKVAIKILNRRKIKNMEMEEKVRREIKILRLFMHPHIIRLYEVIETPTDIYLVMEYVNSGELFDYIVEKGRLQEDEARNFFQQIISGVEYCHRNMVVHRDLKPENLLLDSKSNVKIADFGLSNIMRDGHFLKTSCGSPNYAAPEVISGKLYAGPEVDVWSCGVILYALLCGTLPFDDENIPNLFKKIKGGIYTLPSHLSAGARDLIPRMLVVDPMKRVTIPEIRQHNWFQAHLPRYLAVPPPDTAQQAKKIDEEILQEVINMMGFDRNLLIESLRNRTQNDGTVTYYLILDNRFRVSAGYLGAEFQETMEGTPRMHPAESVASPVSNRLPGLMEFQGVGLRSQYPVERKWALGLQSRAHPREIMTEVLKALQDLNVCWKKIGPYNMKCRWVPNSADNSMQDNNYFGDDSSIIENDAAVKSPNVVKFELQLYKTRDDKYLLDLQRVLGPQFLFLDLCAAFLAQLRVL(SEQ ID NO.4).
[0042] The sequences of target sequence 1 and target sequence 2 were amplified by PCR using specific primers BnKIN10-RNAi-F and BnKIN10-RNAi-R respectively. The PCR program was set as follows: pre-denaturation at 95°C for 5 min, followed by 34 cycles (95°C for 30 s, 58°C for 30 s, 72°C for 30 s), and finally extension at 72°C for 5 min;
[0043] BNKIN10-RNAI-F: AGTGGTCTCTGTCCAGTCCTATTTCTGGAAAATTATATGC(SEQ ID NO.5);
[0044] BNKIN10-RNAI-R: GGTCTCAGCAGACCACAAGTATCTTTTTGGCCTGCTGCAC(SEQ ID NO.6).
[0045] The electrophoresis pattern of the PCR amplification product is shown in Figure 1It can be seen that the BnKIN10 RNAi target sequences 1 and 2 can be amplified using specific primers, and the product length is approximately 500 bp.
[0046] Vector construction: The PCR products were respectively ligated into the pNC-CAMBIA1304-RNAi vector (Nimble Cloning, Hainan Nixing Biotechnology Co., Ltd.) in the forward and reverse directions to construct a hairpin structure. An intron sequence was inserted between the sense and antisense fragments to form a structure capable of expressing double-stranded RNA. The constructed recombinant vector was named pNC-CAMBIA1304-BnKIN10-RNAi.
[0047] (2) Escherichia coli transformation and identification: The construct was introduced into DH5α competent cells using the heat shock method. LB plates containing antibiotics were used to screen for positive clones, and colony PCR was performed to verify the insertion direction and sequence integrity.
[0048] The schematic diagram of the pCAMBIA1304-BnKIN10-RNAi construct is shown in Figure 2 , Figure 2 which shows the basic structure of the RNAi expression vector, including the positions and arrangements of elements such as the 35S promoter, BnKIN10 homologous fragments inserted in the forward and reverse directions, the intron ligation region, and the selection marker gene.
[0049] Example 2 Genetic transformation of rapeseed and regeneration of transgenic plants
[0050] (1) Preparation of Agrobacterium competent strain: The verified pNC-CAMBIA1304-BnKIN10-RNAi construct was introduced into Agrobacterium tumefaciens GV3101; the positive monoclonal was inoculated into YEP liquid medium and cultured overnight at 28 °C on a shaker until OD 600 0.4 - 0.6;
[0051] (2) Preparation of rapeseed explants: After surface sterilization of rapeseed seeds Westar, they were sown on the M0 basal medium and cultured in the dark for 5 - 6 days; the hypocotyls were taken as explants and cut into segments about 0.8 - 1 cm in length for standby;
[0052] (3) Infection and co-culture: The explants were added to the co-culture medium containing Agrobacterium (DM liquid medium) and soaked for 10 - 15 minutes; then transferred to the M1 co-culture medium and cultured in the dark at 24 °C for 36 - 48 hours;
[0053] (4) Resistance screening and regeneration culture: Transfer the explants to the M2 selection medium containing hygromycin and ticarcillin, culture for 15 days to induce callus; transfer to the M3 medium to induce bud point differentiation, subculture regularly, and obtain green adventitious buds; transfer the buds with growing points to the M4 rooting medium to obtain transgenic seedling plants BnKIN10-RNAi (#1 and #2).
[0054] The phenotypic diagrams of BnKIN10-RNAi transgenic positive plants are shown in Figure 3 . Compare the overall morphology of the two plants BnKIN10-RNAi (#1 and #2) with that of the wild-type WT rapeseed, and it can be seen that there is no significant abnormality in the morphology of the transgenic positive plants.
[0055] Example 3 Screening of Transgenic Plants and Detection of Gene Expression
[0056] (1) DNA extraction and PCR identification: Take the leaves of transgenic plants and extract genomic DNA by the CTAB method. Use hygromycin identification primers (F: ATCGGACGATTGCGTCGCAT (SEQ ID NO.7); R: ATGCGACGCAATCGTCCGAT (SEQ ID NO.8)) for PCR amplification, and analyze the electrophoresis to judge positive plants;
[0057] (2) Total RNA extraction and reverse transcription: Extract total RNA from positive lines and synthesize cDNA using the reverse transcription kit (323) of Novoprotein Scientific Inc.;
[0058] (3) qRT-PCR analysis: Use BnKIN10 gene-specific primers (SEQ ID NO.9-18) to perform real-time fluorescence quantitative PCR detection on the expression of 5 BnKIN10 homologous genes (BnaA01KIN10WE, BnaA03KIN10WE, BnaC01KIN10WE, BnaC05KIN10WE, and BnaC07KIN10WE), and the internal reference is the BnUBC9 gene.
[0059] C07F: CAACGTTATGCGAGATGGTC (SEQ ID NO.9);
[0060] C07R: GAATAATCCTCCTCCTCTCA (SEQ ID NO.10);
[0061] Detect the expression of the gene BnaC07KIN10WE with C07F and C07R, and the nucleotide sequence of BnaC07KIN10WE (SEQ ID NO.11):
[0062]
[0063] C05F: CAATTGGTTCCAAGCTCAT (SEQ ID NO.12);
[0064] C05R: CATATTGATAACTTCTTGGA (SEQ ID NO.13);
[0065] Detect the expression of gene BnaC05KIN10WE using C05F and C05R. The nucleotide sequence of BnaC05KIN10WE (SEQ ID NO.14):
[0066]
[0067] A03F: GATGGTACTTCGCGTATGCA (SEQ ID NO.15);
[0068] A03R: GCCTAACGTGTGAAGCTACG (SEQ ID NO.16);
[0069] Detect the expression of gene BnaA03KIN10WE using A03F and A03R. The nucleotide sequence of BnaA03KIN10WE (SEQ ID NO.17):
[0070]
[0071] A01F: CCAAGAAGTTATTAATATG (SEQ ID NO.18);
[0072] A01R: GGTGCGGTTGCGGAGAGACT (SEQ ID NO.19);
[0073] Detect the expression of gene BnaA01KIN10WE using A01F and A01R. The nucleotide sequence of BnaA01KIN10WE (SEQ ID NO.20):
[0074]
[0075] C01F: TGTTCACAGAGATCTTAAGC (SEQ ID NO.21);
[0076] C01R: GAAAGTGACCATCTCGCATA (SEQ ID NO.22);
[0077] Detect the expression of gene BnaC01KIN10WE using C01F and C01R. The nucleotide sequence of BnaC01KIN10WE (SEQ ID NO.23):
[0078]
[0079] The present invention verified by qRT-PCR that the expression level of the BnKIN10 gene in the interference strain was significantly reduced ( Figure 4 ), and the results showed that the expression level was significantly downregulated in the transgenic lines.
[0080] Example 4 Analysis of lipid content in transgenic knockdown materials
[0081] (1) Five samples of rapeseed seeds were selected for each material. 20 grams of seeds were taken from each sample, and impurities were removed to keep the seeds intact and dry.
[0082] (2) The sample was placed in a constant temperature drying oven and dried at 40°C for 24 hours to eliminate the interference of moisture on the spectral signal as much as possible;
[0083] (3) Spectra were collected using a near-infrared spectrometer (NIRSDS2500) with a wavelength range of 850 to 2500 nm and measured in diffuse reflectance mode. The sample was placed in a standard cuvette or sample cup to ensure that the measurement surface was uniform and flat to avoid scattering anomalies;
[0084] (4) The spectrum of each sample was collected three times, and the average spectrum was taken as the final data input. Its original reflectance or absorbance spectrum information was recorded for subsequent modeling analysis.
[0085] The results of oil content determination in wild type (WT) and BnKIN10-RNAi (#1-#2) seeds are shown in Figure 5 It can be seen that compared with the wild-type material, the total oil content of seeds of the interference strain was significantly downregulated, indicating that BnKIN10 is involved in regulating seed oil synthesis.
[0086] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.
Claims
1. Application of BnKIN10 gene in regulating oil content of rapeseed grains, characterized in that, The nucleotide sequence of the BnKIN10 gene is as shown in SEQ ID NO.
3.
2. The application according to claim 1, wherein The regulation includes: when inhibiting the BnKIN10 gene in rapeseed, the oil content of the rapeseed grains can be reduced.
3. The application according to claim 2, wherein The method of inhibition includes the following steps: constructing a recombinant plasmid by combining the BnKIN10 gene with an expression vector; transferring the recombinant plasmid into rapeseed by an Agrobacterium-mediated method to inhibit the BnKIN10 gene.
4. The application according to claim 3, characterized in that When using the Agrobacterium-mediated method to transform rapeseed, the infection site of Agrobacterium is the hypocotyl of rapeseed.
5. A method for cultivating rapeseed varieties, characterized in that, It includes the step of inhibiting the BnKIN10 gene in rapeseed to obtain a rapeseed variety with stable inheritance of inhibited BnKIN10 gene; the nucleotide sequence of the BnKIN10 gene is as shown in SEQ ID NO.3.