Application of circERBB2 in prostatic cancer angiogenesis

Abstract

Prostate cancer is one of the most common malignant tumors of males in the global range, and the molecular mechanism in the generation and development process of PCa is not completely researched clearly; the application focuses on the action mechanism of circERBB2 molecules in prostatic cancer, and finally proves that in hypoxia Du145 and PC3 cells, circERBB2 is specifically combined with HUR, and meanwhile, the HUR is combined with and enhances VEGFA transcription, so that circERBB2 participates in hypoxia-mediated vascularization; the invention discloses an application of circERBB2 in prostatic cancer angiogenesis, namely, the prostatic cancer angiogenesis is inhibited by inhibiting the expression of circERBB2. By promoting the expression of circERBB2, the prostatic cancer angiogenesis is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of prostate cancer research, and particularly to an application of circERBB2 in prostate cancer angiogenesis. Background Art

[0002] Circular RNAs (circRNAs) are a class of covalently closed circular non-coding RNAs (Non-coding RNA, ncRNA) without 5' and 3' termini, and are involved in malignant behaviors such as the proliferation, migration and invasion of tumor cells. CircRNAs have the following characteristics: tissue-specific expression, highly stable structure, highly enriched in eukaryotes, and most are evolutionarily conserved. The ERBB2 receptor belongs to the protein tyrosine kinase family.

[0003] Prostate cancer (PCa) studied by the research group is one of the most common malignant tumors in men worldwide, and the molecular mechanism during the occurrence and development of PCa has not been fully studied. Currently, there is no research report on the circERBB2 molecule in PCa. Therefore, the research group focused on the study of the mechanism of action of the circERBB2 molecule in prostate cancer. Previous detections found that the expression of the circERBB2 molecule was significantly increased in PCa cells, but how the circERBB2 molecule participates in the molecular mechanism of the occurrence and development of PCa still needs further study. Summary of the Invention

[0004] In view of this, the research group of the present invention further studied the molecular mechanism of circERBB2 in the development of prostate cancer. It was further learned about the application of circERBB2 in prostate cancer.

[0005] The present invention provides an application of circERBB2 in prostate cancer angiogenesis.

[0006] Preferably, the application in prostate cancer angiogenesis includes two types: the application of inhibiting prostate cancer angiogenesis and the application of promoting prostate cancer angiogenesis.

[0007] Preferably, the application in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis by inhibiting the expression of circERBB2; and the application of promoting prostate cancer angiogenesis by increasing the expression of circERBB2.

[0008] Preferably, the application in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis by knocking out or suppressing the expression of EIF4A3, reducing the generation of circERBB2; and the application of promoting prostate cancer angiogenesis by enhancing the expression of EIF4A3 and promoting the generation of circERBB2 under hypoxia.

[0009] Preferably, the application in prostate cancer angiogenesis includes the application of knocking out or suppressing the generation of circERBB2, that is, reducing circERBB2 bound to HUR, thereby reducing VEGFA transcription and inhibiting prostate cancer angiogenesis; and the application of promoting prostate cancer angiogenesis by the binding of circERBB2 to HUR under hypoxia, resulting in the stable binding of HUR and enhancing VEGFA transcription.

[0010] A method for inhibiting prostate cancer angiogenesis by inhibiting the expression of circERBB2, thereby inhibiting prostate cancer angiogenesis.

[0011] Preferably, knocking out or suppressing the expression of EIF4A3 reduces the generation of circERBB2, thereby inhibiting prostate cancer angiogenesis.

[0012] Preferably, knocking out or suppressing the generation of circERBB2, that is, reducing circERBB2 bound to HUR, thereby reducing VEGFA transcription and inhibiting prostate cancer angiogenesis.

[0013] A method for promoting prostate cancer angiogenesis by increasing the expression of circERBB2, thereby promoting prostate cancer angiogenesis.

[0014] Preferably, under hypoxia, enhancing the expression of EIF4A3 promotes the generation of circERBB2, thereby promoting prostate cancer angiogenesis.

[0015] Preferably, the binding of circERBB2 to HUR under hypoxia results in the stable binding of HUR and enhances VEGFA transcription, thereby promoting prostate cancer angiogenesis.

[0016] An application of circERBB2 in the preparation of drugs related to prostate cancer blood vessels.

[0017] Preferably, drugs related to prostate cancer blood vessels inhibit or promote prostate cancer angiogenesis by regulating circERBB2.

[0018] Preferably, the circERBB2 is a circular RNA formed by the reverse splicing of exons 5 to 9 of the linear gene ERBB2.

[0019] Preferably, the gene sequence of the circERBB2 is as shown in SEA ID NO.1.

[0020] Through the research on the molecular mechanism of circERBB2 in the development of prostate cancer, the present invention discovers that by regulating the expression of circERBB2, the angiogenesis of prostate cancer can be inhibited or promoted, which has great application value for the in vivo or in vitro research on the angiogenesis of prostate cancer. Brief Description of the Drawings

[0021] Appendix Figure 1 is the chromosomal localization map of circERBB2.

[0022] Appendix Figure 2 is the schematic diagram of the molecular structure of circERBB2.

[0023] Appendix Figure 3 is the schematic diagram of the electrophoresis results that circERBB2 can be specifically amplified by PCR in the cDNA templates of different prostate cancer cell lines PC3 and Du145, and circERBB2 cannot be specifically amplified by PCR in the gDNA templates of different prostate cancer cell lines PC3 and Du145.

[0024] Appendix Figure 4 is the sequencing result of the purified product of PCR amplification of circERBB2.

[0025] Appendix Figure 5 is the comparison diagram of the expression levels of circERBB2 in prostate cancer cells and normal prostate epithelial cells.

[0026] Appendix Figure 6 is the comparison diagram of the expression levels of circERBB2 in prostate cancer pathological tissues and adjacent tissues.

[0027] Appendix Figure 7 is the schematic diagram of the results of qRT-PCR detection of the knockdown effect when si-circERBB2 is transfected into Du145 and PC3 cells respectively.

[0028] Figure 8 is the schematic diagram of the results of the CCK-8 experiment to verify the effect of knocking down circERBB2 on the proliferation ability of PCa cells.

[0029] Appendix Figure 9 is the schematic diagram of the results of the plate cloning experiment to verify the effect of knocking down circERBB2 on the proliferation ability of PCa cells.

[0030] Appendix Figure 10Schematic diagram of the results of Transwell assay detecting the effects of transfection with si-circ#2 on the migration and invasion abilities of Du145 and PC3 cells.

[0031] Appendix Figure 11 Schematic diagram of the results of flow cytometer detecting the effects of transfection with si-circ#2 on the apoptosis of Du145 and PC3 cells by Annexin Ⅴ-FITC / PI double staining method.

[0032] Appendix Figure 12 Schematic diagram of the results of establishing a hypoxic PCa cell model in vitro using the anaerobic bag method and detecting the protein expression of HIF1α by Western blot.

[0033] Appendix Figure 13 Schematic diagram of the results of detecting the expression of circERBB2 in hypoxic PCa cells by qRT-PCR.

[0034] Appendix Figure 14 Analysis of RBPs binding to the flanks of circERBB2 on the circinteractome website.

[0035] Appendix Figure 15 Schematic diagram of the results of Western blot detecting the protein expression of RIP pull-down.

[0036] Appendix Figure 16 Schematic diagram of the results of qRT-PCR detecting the expression of circERBB2 after RIP pull-down of proteins.

[0037] Appendix Figure 17 Schematic diagram of the results of agarose gel electrophoresis separation showing that EIF4A3 can bind to circERBB2 in hypoxic Du145 and PC3 cells.

[0038] Appendix Figure 18 Schematic diagram of the results of qRT-PCR detecting the effect of knocking down EIF4A3 on the expression of EIFA3 mRNA in PCa cells.

[0039] Appendix Figure 19 Schematic diagram of the results of qRT-PCR detecting the effect of knocking down EIF4A3 on the expression of circERBB2 under normoxia.

[0040] Appendix Figure 20 Schematic diagram of the effect of hypoxia on the expression of EIF4A3.

[0041] Appendix Figure 21It is a schematic diagram of the qRT-PCR detection results after transfecting siRNA of EIF4A3 into Du145 and PC3 cells under hypoxia conditions.

[0042] Appendix Figure 22 It is a schematic diagram of the vector structure for packaging the knockdown virus of circERBB2.

[0043] Appendix Figure 23 It is a schematic diagram of the vector structure for packaging the overexpression virus of circERBB2.

[0044] Appendix Figure 24 It is a schematic diagram of the detection results of the infection efficiency of the virus solution.

[0045] Appendix Figure 25 It is the protein expression of HIF1α and VEGFA detected by Western blot in hypoxic Du145 and PC3 cells.

[0046] Appendix Figure 26 It is the angiogenesis experiment to detect the effect of hypoxia on the angiogenesis of HUVEC cells.

[0047] Appendix Figure 27 It is a schematic diagram of the qRT-PCR results after directly infecting the knockdown virus solution and overexpression virus solution of circERBB2 into HUVEC cells.

[0048] Appendix Figure 28 It is a schematic diagram of the angiogenesis ability, i.e., the tube formation experiment results, after knocking down circERBB2 in HUVEC cells.

[0049] Appendix Figure 29 It is a schematic diagram of the angiogenesis ability, i.e., the tube formation experiment results, after overexpressing circERBB2 in HUVEC cells.

[0050] Appendix Figure 30 It is the result of observing the fluorescent tubules after knocking down circERBB2 under a fluorescence inverted microscope.

[0051] Appendix Figure 31 It is the result of observing the fluorescent tubules after overexpressing circERBB2 under a fluorescence inverted microscope.

[0052] Appendix Figure 32 It is the result of transfecting the interference sequence of circERBB2 into Du145 and PC3 cells and detecting the protein expression of VEGFA after knocking down circERBB2 by Western blot.

[0053] Appendix Figure 33The interference sequence of circERBB2 was transfected into Du145 and PC3 cells, and the supernatant of each transfection group was extracted to prepare a conditioned medium, which was co-cultured with HUVEC cells, and the results of angiogenesis of HUVEC cells were obtained.

[0054] Appendix Figure 34 It is the Western blot result of the rescue experiment in Du145 cells.

[0055] Appendix Figure 35 It is the result of qRT-PCR detecting the expression level of circERBB2 in each group of the rescue experiment.

[0056] Appendix Figure 36 It is the result of the angiogenesis experiment by extracting the supernatant of each group of the rescue experiment to prepare a conditioned medium.

[0057] Appendix Figure 37 circERBB2 has a binding site with HUR.

[0058] Appendix Figure 38 It is a schematic diagram of the result of Western blot detecting the efficiency of immunoprecipitated protein in the RIP experiment.

[0059] Appendix Figure 39 It is the result of qRT-PCR detecting the expression of circERBB2 in the HUR-enriched pulled-down RNA in hypoxic PCa cells.

[0060] Appendix Figure 40 It is the detection of the binding of circERBB2 and HUR by agarose gel electrophoresis separation experiment.

[0061] Appendix Figure 41 It is the expression of HUR-pulled-down immunoprecipitated circERBB2 detected by qRT-PCR in the RIP experiment after knocking down circERBB2 in hypoxic Du145 and PC3 cells.

[0062] Appendix Figure 42 It is the Western blot detection of the effect of knocking down circERBB2 on the expression of HUR protein in Du145 and PC3 cells.

[0063] Appendix Figure 43 It is the Western blot detection of the protein expression of HUR after hypoxic treatment of Du145 and PC3 cells.

[0064] Appendix Figure 44 It is the result of qRT-PCR detecting the expression of the pulled-down immunoprecipitated VEGFA mRNA in the RIP experiment.

[0065] Appendix Figure 45 This is an experiment using agarose gel electrophoresis to detect the specific binding of HUR and VEGFA. Specific implementation method I. Experimental preparation

[0066] 1. Main materials and reagents The human normal prostate epithelial cell line RWPE-1 and prostate cancer cell lines LNCap, PC3, HUVEC, and Du145 were all purchased from the Cell Bank of the Chinese Academy of Sciences' Committee for the Preservation of Type Cultures (Shanghai). 22RV1 was purchased from Servicebio Biotechnology Co., Ltd. / Wuhan. Source of pathological tissue sections: Eight pairs of PCa pathological tissues were taken from paraffin blocks of PCa tissues and adjacent tissues that were collected from the Department of Pathology of Ningxia Medical University General Hospital from August 2023 to October 2023 and had not undergone radiotherapy or chemotherapy. The above pathological specimens were confirmed by two pathologists. This research project has been approved by the Ethics Committee of Ningxia Medical University.

[0067] RPMI 1640 medium, high-quality fetal bovine serum, and GAPDH antibody were purchased from Wuhan Saiwei'er Company; siRNA of circERBB2 was synthesized by Guangzhou Ribobio Co., Ltd.; Lipofectamine 2000 was purchased from Invitrogen; trypsin and 0.1% crystal violet aqueous solution were purchased from Beijing Solarbio Science & Technology Co., Ltd.; RNA extraction kit, reverse transcription kit, and q-PCR real-time fluorescence quantitative PCR kit were all purchased from Novoprotein Scientific Inc.; RNApure FFPE Kit for fixed tissue RNA extraction was purchased from CW Biotech Co., Ltd.; CCK8 reagent was purchased from AbMole; Matrigel matrix glue was purchased from Corning; Golden Easy PCR system, DNA purification and recovery kit, and genomic DNA extraction kit were all purchased from Tiangen Biochemical Technology Co., Ltd.; primer sequences were synthesized by Sangon Biotech; HIF1α antibody, EIF4A3 antibody, β-tubulin antibody, and IgG antibody were purchased from Proteintech (Wuhan Sanying); goat anti-rabbit IgG-HRP and goat anti-mouse IgG-HRP were purchased from Thermo; whole protein extraction kit and BCA protein concentration detection kit were purchased from KeyGen Biotech Co., Ltd.; 2.5L anaerobic gas generating package, 2.5L round-bottom vertical anaerobic culture bag, and oxygen indicator were purchased from Haibo Biotech; RIP kit was purchased from Gisai Biotech.

[0068] 2. Cell culture and cell transfection Du145, PC3, LNCap, and 22RV1 cells were all cultured in RPMI 1640 medium containing 10% fetal bovine serum; RWPE-1 cells were cultured in a special medium for human prostate epithelial cells, namely K-SFM culture solution containing 50 μg / mL bovine pituitary extract and 5 ng / mL epidermal growth factor; the medium used for HUVEC cells was DMEM medium containing 10% fetal bovine serum and 1% double antibody (Penicillin-streptomycin mixed solution).

[0069] The above cells were all placed in an incubator at 37°C and 5% CO2 for culture, and the medium was changed every two days. When the cell confluence reached 80% - 90%, digestion and passage were carried out. The number of passages of the cells used in the cell experiment did not exceed fifteen generations.

[0070] For cell transfection, for transient transfection, the cationic liposome method was used; for stable transfection, lentiviral infection was used. Logarithmic growth phase cells were seeded in 6-well plates. When the confluence reached 50% - 60%, each siRNA was transfected into Du145 and PC3 cells using Lipofectamine 2000 reagent, and then cultured in the incubator for 24 - 48 h before performing relevant experiments. All operations were carried out according to the instructions of the kit.

[0071] 3. Establishment of a hypoxic cell model of prostate cancer by the anaerobic bag method Take the culture dish of Du145 cells in the logarithmic growth phase and place it in an anaerobic culture bag. Put a CO2 gas-generating packet and an oxygen indicator in each bag. The CO2 gas-generating packet can quickly increase the CO2 gas concentration and decrease the oxygen concentration in the bag, thus creating a hypoxic environment.

[0072] At the end of the experiment, RNA and protein samples were collected for subsequent relevant experiments, and the successful establishment of the hypoxic cell model was evaluated by detecting the expression of HIF1α protein. II. Practical process

[0073] The research group already knew that the human chromosome localization of circERBB2 was chr17: 37864573 - 37866734, as shown in the appendix Figure 1 As shown. circERBB2 is a circular RNA formed by the reverse splicing of exons 5 to 9 of the linear gene ERBB2, and the full length of circERBB2 is 676 bp. The sequence is as shown in SEA ID NO.1, and the molecular structure schematic diagram of circERBB2 is as shown in the appendix Figure 2 As shown.

[0074] Circular RNA circERBB2 is a closed RNA molecule formed by the classical linear splicing of the linear gene ERBB2, that is, removing introns from the initial transcript and connecting the exons head to tail, namely, reverse splicing and circularization of exons.

[0075] CircERBB2 circular RNA is a class of covalently closed circular non-coding RNA (non-coding RNA) without 5' and 3' ends; it is highly enriched in eukaryotes and evolutionarily conserved.

[0076] In multicellular organisms, the terminal structure of the linear gene ERBB2 makes it easily recognized and degraded by exonucleases, while circular RNA is not.

[0077] Our research group designed specific detection primers spanning its splice junctions. The primer sequences of circERBB2 are as follows: Forward primer (5'→3') TGCCTCCACTTCAACCACAG; Reverse primer (5'→3') GAGCGATGAGCACGTAGCC.

[0078] CircERBB2 can be specifically amplified by PCR in the cDNA templates of different prostate cancer cell lines PC3 and Du145, and cannot be specifically amplified by PCR in the gDNA templates of different prostate cancer cell lines PC3 and Du145. The results are as shown in the appendix Figure 3 shown; meanwhile, it was confirmed by sequencing that the PCR amplification product contains the splice site of circERBB2. The sequencing results are as shown in the appendix Figure 4 shown, and the gene sequence of circERBB2 is as shown in SEA ID NO.1. The above results confirmed the specificity of the circERBB2 detection primers.

[0079] To detect the expression of circERBB2 in PCa cells and pathological tissues, the results of qRT-PCR showed that compared with the normal prostate epithelial cell line RWPE-1, circERBB2 was highly expressed in the prostate cancer cell lines LNCap, 22RV1, PC3, and Du145 ( P <0.01), and the results are as shown in the appendix Figure 5 shown. Meanwhile, paraffin blocks of PCa tissues and adjacent tissues collected from the Department of Pathology of Ningxia Medical University General Hospital from August 2023 to October 2023 and untreated with radiotherapy and chemotherapy were collected. The results of qRT-PCR showed that compared with adjacent tissues, circERBB2 was also highly expressed in PCa pathological tissues ( P(< 0.05), and the results are shown in the appendix Figure 6 (n = 8; compared with the control group, * P < 0.05, ** P < 0.01). The above results of the two groups showed that circERBB2 was highly expressed in PCa cells and pathological tissues.

[0080] Given that circERBB2 was highly expressed in PCa cells and pathological tissues, in order to further clarify the role of circERBB2 in the proliferation, migration, invasion and apoptosis of PCa cells, the research group commissioned Guangzhou Ribobio Co., Ltd. to design and synthesize two siRNA sequences (si-circERBB2) spanning the splicing junctions of circERBB2. Specifically, the sequence of si-hsa-circERBB2#1 was CTGTCCCTGATATCCAGGA; the sequence of si-hsa-circERBB2#2 was TGCCTGTCCCTGATATCCA. They were transfected into Du145 and PC3 cells respectively, and the qRT-PCR detection results are shown in the appendix Figure 7 (n = 8; compared with the control group, * P < 0.05, ** P < 0.01. Both interference sequences could effectively reduce the expression of circERBB2 in Du145 and PC3 cells. We selected the interference sequence (si-circ#2) with better knockdown effect ( P < 0.01 or P < 0.05) to carry out subsequent experimental studies.

[0081] si-circ#2 was transfected into Du145 and PC3 cells. Next, the CCK-8 assay and plate colony formation assay were used to explore the effect of circERBB2 on the proliferation ability of PCa cells. The results of the CCK-8 assay are shown in the appendix Figure 8 (n = 8; compared with the control group, * P < 0.05, ** P < 0.01. Compared with the si-NC group, the OD values of Du145 and PC3 cells in the si-circ#2 group were significantly decreased (both P < 0.01). Similarly, the results of the plate colony formation assay are shown in the appendix Figure 9 (n = 8; compared with the control group, * P < 0.05, ** P < 0.01. Compared with the si-NC group, the formation of single Du145 and PC3 cell clone colonies in the si-circ#2 group was significantly decreased (both P(<0.01). The results showed that knocking down circERBB2 could inhibit the proliferation ability of Du145 and PC3 cells.

[0082] Migration and invasion ability are important characteristics of the malignancy of cancer cells. To investigate the role of circERBB2 in the migration and invasion of PCa cells, the effects of transfection with si-circ#2 on the migration and invasion ability of Du145 and PC3 cells were detected by Transwell assay. The Transwell results are shown in the appendix Figure 10 As shown, compared with the si-NC group, the migration and invasion ability of Du145 and PC3 cells in the si-circ#2 group was significantly inhibited (both P (<0.01). It was shown that knocking down circERBB2 could inhibit the migration and invasion ability of PCa cells.

[0083] Cell apoptosis is a process of programmed cell death, which is closely related to the metastasis, treatment and drug resistance of malignant tumors. To explore the role of circERBB2 in the apoptosis of PCa cells, the effects of transfection with si-circ#2 on the apoptosis of Du145 and PC3 cells were detected by AnnexinⅤ-FITC / PI double staining method. The results obtained by flow cytometer and converted into histograms are shown in the appendix Figure 11 As shown, compared with si-NC, after transfection with si-circ#2, Du145 ( P (<0.05) and PC3 ( P (<0.01) the apoptosis rate of cells increased significantly. It was shown that knocking down circERBB2 could induce the apoptosis of Du145 and PC3 cells.

[0084] From the above results, it was known that knocking down circERBB2 could inhibit the proliferation vitality, the ability of single cell clones to form aggregates, migration and invasion ability of Du145 and PC3 cells, and could promote the apoptosis of Du145 and PC3 cells, further indicating that circERBB2 plays a role as a cancer-promoting molecule in PCa cells.

[0085] Hypoxia is a common feature of malignant tumors and the most important factor inducing malignant transformation of tumor cells. It is a common feature of malignant tumors, which can trigger cellular stress and participate in the progression and treatment resistance of malignant tumors through activating the hypoxia-inducible factor (HIF) pathway. Research reports show that hypoxia is involved in the regulation of circRNAs generation and the process of tumor angiogenesis. To further elucidate the mechanism of the elevated expression of circERBB2 in PCa cells, the research group established a hypoxia PCa cell model in vitro using the anaerobic bag method and evaluated the success of establishing the hypoxia cell model by detecting the protein expression of HIF1α by Western blot. The results are as follows Figure 12 shown. It can be seen that after treatment with the anaerobic bag method, the protein expression of HIF1α was significantly enhanced, indicating the successful establishment of the hypoxia cell model. The expression of circERBB2 in hypoxia PCa cells was detected by qRT-PCR, and the results are as follows Figure 13 shown. Compared with the normoxia culture group, the expression of circERBB2 in hypoxia cells was significantly enhanced ( P <0.01 or P <0.05). It indicates that hypoxia can induce the expression of circERBB2 in PCa cells.

[0086] To further elucidate the internal reasons and potential mechanisms for the enhanced expression of circERBB2 in hypoxia PCa cells, the research group used the bioinformatics website Circinteractome to analyze and found that there are three RBPs that can bind to the flanks of circERBB2 and participate in its regulation and generation: AGO2, EIF4A3, IGF2BP1. The results are as follows Figure 14 shown. First, IGF2BP1 with only 1 binding site was excluded, and then the literature was consulted, and EIF4A3 related to hypoxia was preferably considered.

[0087] To further study the expression of EIF4A3 under hypoxia conditions, the primer sequences of EIF4A3 were designed as follows: Forward primer (5'→3')AAGGGAGAGATGTCATCGCAC; Reverse primer (5'→3')GCTTGAGTTTCACGAACCTGA.

[0088] To verify the binding of EIF4A3 to circERBB2, we used the RIP experiment to enrich the RNAs bound to EIF4A3 in PCa cells under hypoxia. Western blot was used to detect the efficiency of RIP pull-down proteins, and the results are as follows Figure 15As shown, it is proved that the immunoprecipitation of EIF4A3 antibody protein is effective; the expression of circERBB2 in the precipitated RNA was detected by qRT-PCR, and the results are as attached Figure 16 As shown, compared with the IgG group, the enrichment of circERBB2 in the IP group (EIF4A3 enrichment group) of hypoxic Du145 and PC3 cells was significantly increased ( P <0.01 or P <0.05); the agarose gel electrophoresis separation experiment further showed that EIF4A3 could bind to circERBB2 in hypoxic Du145 and PC3 cells, and the results are as attached Figure 17 As shown. The above results indicate that in hypoxic PCa cells, EIF4A3 can specifically bind to circERBB2. Based on this, the research group speculated that the generation of circERBB2 might be regulated by EIF4A3.

[0089] To further explore whether the expression of circERBB2 in PCa cells under hypoxia is regulated by EIF4A3, two siRNA sequences of EIF4A3 were designed and synthesized by a biological company. Specifically, the sequence of si-EIF4A3#1 is AGCCACCUUCAGUAUCUCA; the sequence of si-EIF4A3#2 is CCUCCAGUGUUUGGAUAUU.

[0090] The effect of knocking down EIF4A3 on the expression of EIFA3 mRNA in PCa cells was detected by qRT-PCR, and the results are as attached Figure 18 As shown, compared with the control group si-NC, after transfection with si-EIF4A3#1 and si-EIF4A3#2, the mRNA (both P <0.01) and protein expression of EIF4A3 in Du145 and PC3 cells were significantly decreased. Then, the effect of knocking down EIF4A3 on the expression of circERBB2 under normoxia was detected by qRT-PCR, and the results are as attached Figure 19 As shown, compared with the control group, * P <0.05, ** P <0.01. When the expression of EIF4A3 was knocked down in PCa cells under normoxic conditions, the expression of circERBB2 was also significantly decreased ( P <0.01 or P <0.05). The above results indicate that the expression of circERBB2 in normoxic PCa cells can be regulated by EIF4A3.

[0091] To clarify the expression of EIF4A3 under hypoxic conditions and further explore whether the expression of circERBB2 in PCa cells under hypoxia is regulated by EIF4A3, the expression of EIF4A3 in hypoxic PCa cells was detected by Western blot. The results are as follows Figure 20 shown. After cell hypoxia induction, the protein expression of EIF4A3 was enhanced. At the same time of hypoxia, siRNA of EIF4A3 was transfected into Du145 and PC3 cells; the qRT-PCR detection results are as follows Figure 21 shown. Hypoxia can significantly promote the expression of circERBB2. At the same time, knocking down the EIF4A3 molecule can significantly reduce the hypoxia-induced expression of circERBB2 ( P <0.05 or P <0.01). In summary, the expression of EIF4A3 increases under hypoxic conditions. Knocking down EIF4A3 can reduce the hypoxia-induced expression of circERBB2, which also indicates that the expression of circERBB2 is regulated by EIF4A3 under hypoxic conditions.

[0092] In summary, hypoxia promotes the generation of circERBB2 by enhancing the expression of EIF4A3.

[0093] To further explore the molecular mechanism of circERBB2 in PCa cells, the research group commissioned Shanghai GeneChem Co., Ltd. to design and package the viral solution of circERBB2. By inserting the interference sequence of si-circ#2, the knockdown virus of circERBB2 was packaged using the vector as shown in Figure 22 the following figure and named LV_hsa_circERBB2_RNAi (RNAi); the overexpression virus of circERBB2 was packaged using the vector as shown in Figure 23 the following figure and named hsa_circ_ERBB2_oe (oe), and it was infected into Du145 and PC3 cells. The infection efficiency was observed by an inverted fluorescence microscope. The results are as follows Figure 24 shown, indicating that the lentivirus (the cells with green fluorescence in the figure) was successfully infected into Du145 and PC3 cells. The expression of circERBB2 in Du145 and PC3 cells after lentivirus infection was detected by qRT-PCR. The results showed that after lentivirus infection, the expression of circERBB2 was effectively reduced and overexpressed (both P <0.01).

[0094] After clarifying the role of circERBB2 as an oncomolecule and the fact that hypoxia can induce its expression, and that the generation and expression of circERBB2 under hypoxia are regulated by EIF4A3, the research group further elucidated the mechanism of action of circERBB2 in the development of PCa cells mediated by hypoxia, that is, through what specific mechanism does circERBB2 play what role in PCa cells mediated by hypoxia.

[0095] Tumor hypoxia is inseparable from angiogenesis. Angiogenesis is the process of new blood vessel formation and is a key requirement and important process for tumor invasion and metastasis. The designed VEGFA primer sequences are as follows: Forward primer (5'→3') GCGGATCAAACCTCACCAA; Reverse primer (5'→3') GGGAACGCTCCAGGACTTAT.

[0096] Through Western blot and angiogenesis experiments, the effects of hypoxia on the protein expression of the key angiogenesis protein vascular endothelial growth factor A (VEGFA) in Du145 and PC3 cells and the angiogenesis of human umbilical vein endothelial cells (HUVEC) were explored. The Western blot results are as attached Figure 25 As shown, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as the internal reference, compared with the normoxia group, the protein expressions of HIF1α and the key angiogenesis protein VEGFA in Du145 and PC3 cells were increased under hypoxic conditions.

[0097] Among them, the primer sequences of GAPDH are Forward primer (5'→3') AAATCCCATCACCATCTTCC; Reverse primer (5'→3') ATGACCCTTTTGGCTCCC.

[0098] Next, we conducted an angiogenesis experiment to study the effect of hypoxia on the angiogenesis of HUVEC cells. The supernatant of Du145 and PC3 cells under hypoxia was collected to prepare a conditioned medium, which was co-cultured with HUVEC cells. We selected the number of junctions as the quantitative index for the tubule formation experiment. The results of the angiogenesis experiment are as attached Figure 26 As shown, compared with the control group, * P <0.05. The number of tubule junctions formed in HUVEC cells under hypoxia was more than that formed under normoxic conditions (bothP <0.05). The above results indicate that hypoxia can promote the expression of VEGFA in PCa cells and angiogenesis in HUVEC cells.

[0099] To further verify whether circERBB2 is involved in the angiogenesis process, the knockdown virus solution and overexpression virus solution of circERBB2 were directly infected into HUVEC cells to detect whether circERBB2 affects the angiogenesis ability of HUVEC cells. The qRT-PCR results are as follows Figure 27 shown. Compared with the control group, the expression of circERBB2 in HUVEC cells was significantly knocked down and overexpressed (both P <0.01)). The results of the tube formation assay are as follows Figure 28 shown. Compared with the control LV-NC group, knockdown of circERBB2 in HUVEC cells could inhibit the angiogenesis of HUVEC cells, P <0.01; as shown in Figure 29 the following. Compared with the control oe-NC group, overexpression of circERBB2 in HUVEC cells could promote the angiogenesis of HUVEC cells ( P <0.05); by observing the fluorescent tubules of knockdown or overexpression of circERBB2 under a fluorescence inverted microscope, the results are as follows Figure 30 shown. The number of fluorescent tubules formed in the knockdown group was less than that in the LV-NC control group, and the results are as follows Figure 31 shown. The number of fluorescent tubules formed in the overexpression group was more than that in the oe-NC control group. In summary, circERBB2 is involved in and promotes the angiogenesis of HUVEC cells.

[0100] To further explore the relationship between circERBB2 and angiogenesis, the interference sequence of circERBB2 was transfected into Du145 and PC3 cells, and the effect of knockdown of circERBB2 on the expression of VEGFA protein was detected by Western blot; the supernatant of each transfection group was extracted to prepare a conditioned medium, which was co-cultured with HUVEC cells to further reflect whether circERBB2 affects and participates in angiogenesis through the angiogenesis of HUVEC cells. The Western blot results are as follows Figure 32 shown. Compared with the control si-NC, the expression of VEGFA protein decreased in the circERBB2 knockdown group in Du145 and PC3 cells. The results of the angiogenesis assay are as follows Figure 33As shown, the number of tubule intersections formed by the circERBB2 knockdown group in Du145 and PC3 cells was less than that of the control group (both P < 0.01). The above results further indicated that knockdown of circERBB2 inhibited angiogenesis of HUVEC cells by reducing the protein expression of VEGFA.

[0101] The above results showed that after knockdown of circERBB2 in PCa cells, the protein expression of VEGFA was decreased and angiogenesis of HUVEC cells was inhibited. To further explore whether hypoxia was involved in the regulation of VEGFA by circERBB2, a rescue experiment was conducted in Du145 cells. The results of Western blot were as Figure 34 shown. After knockdown of circERBB2 in Du145 cells under normoxic conditions, the protein expression of VEGFA in Du145 cells decreased compared with that of the control group si-NC. However, after hypoxia treatment, the protein expression of VEGFA was upregulated compared with that of the circERBB2 knockdown group. The expression of circERBB2 in each group was detected by qRT-PCR. The results were as Figure 35 shown in the figure. Compared with the control group, the expression of circERBB2 in the circERBB2 knockdown group under normoxic conditions decreased ( P < 0.01). However, after hypoxia treatment, the expression of circERBB2 was upregulated compared with that of the circERBB2 knockdown group under normoxia ( P < 0.05). The conditioned medium was prepared from the supernatant of each group above for angiogenesis experiment. The results were as Figure 36 shown. Under normoxic conditions, compared with the control group si-NC, the circERBB2 knockdown group could inhibit angiogenesis of HUVEC cells ( P < 0.01). However, after hypoxia treatment, the angiogenesis of HUVEC cells could be restored and upregulated (* P < 0.05, ** P < 0.01). In summary, hypoxia could regulate the expression of VEGFA by regulating the expression of circERBB2 and was involved in the process of angiogenesis.

[0102] The above results indicate that hypoxia can regulate the expression of VEGFA, a key protein in PCa cell angiogenesis, by modulating the expression of circERBB2 in PCa cells. However, the specific mechanism by which circERBB2 participates in and regulates angiogenesis under hypoxia remains unclear. To further explore the mechanism by which circERBB2 regulates the expression of VEGFA protein in PCa cells under hypoxia, we analyzed RBPs that can bind to circERBB2 and are closely related to the hypoxia pathway through the bioinformatics website Circinteractome. Through analysis and screening, the ELAV family protein - HUR was obtained.

[0103] HUR, also known as ELAV L1 (Embryonic Lethal Abnormal Vision Like 1). Human Antigen - HUR (Human Antigen R, HUR) belongs to the ELAV family. HUR contains three RNA recognition motifs (RRMs), which are highly consistent with other HU proteins in sequence homology and structural similarity. The first two tandemly arranged RRMs (RRM1 and RRM2) near the N-terminus can directly interact with target transcripts containing adenine- and uridine-rich elements (AREs) or uridine-rich sequences in the 3' untranslated region (UTR), thus participating in the occurrence and development of tumors. Its functions include RNA binding, regulation of gene expression, etc., and play an important role in cell physiological and pathological processes.

[0104] Bioinformatics analysis showed that circERBB2 has a binding site with HUR, as shown in the appendix. Figure 37 To verify whether circERBB2 specifically binds to HUR in PCa cells under hypoxia, we used the RIP experiment to immunoprecipitate RNA molecules that can bind to HUR protein in hypoxic PCa cells. Western blot was used to detect the efficiency of immunoprecipitated proteins in the RIP experiment. The results are shown in the appendix. Figure 38 As shown, a specific band appeared in the IP group (HUR enrichment group), and no band appeared in the IgG group, indicating that the HUR antibody protein immunoprecipitation was effective and specific; qRT-PCR was used to detect the expression of circERBB2 in the HUR-enriched pull-down RNA in hypoxic PCa cells. The results are shown in the appendix. Figure 39 As shown, compared with the IgG group, the specific enrichment of circERBB2 in the IP group (HUR enrichment group) of hypoxic Du145 and PC3 cells increased significantly (both P <0.01); the results of agarose gel electrophoresis separation are shown in the appendix.Figure 40 As shown, circERBB2 bands were amplified in the IP group (HUR group). Compared with the control group, * P <0.05, ** P <0.01, further indicating that HUR can specifically bind to circERBB2 in hypoxic Du145 and PC3 cells. In summary, circERBB2 can specifically bind to HUR in hypoxic Du145 and PC3 cells.

[0105] To further verify the binding between circERBB2 and HUR under hypoxia, we infected the knockdown virus solution of circERBB2 into Du145 cells and placed them under hypoxic conditions. Through the RIP experiment, RNA molecules that can bind to HUR were immunoprecipitated from the control groups and the circERBB2-knockdown groups of the two cells respectively. The results of qRT-PCR are as follows Figure 41 As shown, compared with the control group, * P <0.05, ** P <0.01. In hypoxic Du145 cells, compared with the control LV-NC group, less circERBB2 was immunoprecipitated with the HUR antibody in the circERBB2-knockdown group (both P <0.01); there was no significant difference in the circERBB2 immunoprecipitated with the IgG antibody between the control LV-NC group and the circERBB2-knockdown group in Du145 cells. The results further illustrate the specific binding between circERBB2 and HUR in hypoxic PCa cells.

[0106] To further investigate whether circERBB2 is involved in regulating the expression of HUR and the expression of HUR under hypoxia, we performed Western blot experiments to explore the protein expression of HUR under different conditions. The results are as follows Figure 42 As shown, when circERBB2 was knocked down in Du145 and PC3 cells under normoxic conditions, there was no significant difference in the protein expression of HUR, indicating that circERBB2 may not be involved in regulating the expression of HUR. Combining the above results, circERBB2 can bind to HUR, suggesting that circERBB2 and HUR may exist in the form of an RNA-protein immune complex in PCa cells. After treating Du145 and PC3 cells with hypoxia, the expression of HUR was detected. The Western blot results are as follows Figure 43As shown, the protein expression of HUR increased, indicating that hypoxia can induce the expression of HUR, and HUR is closely related to the hypoxia pathway. Accordingly, we speculate that circERBB2 and hypoxia-related HUR may play a role in the form of an RNA-protein immune complex binding, participate in downstream angiogenesis, and hypoxia can induce the protein expression of HUR.

[0107] To support its continuous proliferation, tumor cells will undergo adaptive changes in an adverse environment and thus develop in a more aggressive direction. As the tumor tissue continues to grow, it needs to form new blood vessels to obtain nutrients and oxygen. This indicates that the oxygen content is inseparable from angiogenesis. Vascular endothelial growth factor-A (VEGFA) is a rich AU element (ARE). Previous studies have reported that HUR promotes angiogenesis by stabilizing the mRNA of VEGFA in tumor endothelium. Therefore, we speculate whether circERBB2 in PCa cells under hypoxia binds to HUR to form an immune complex, resulting in the binding of HUR to VEGFA, thereby promoting angiogenesis in HUVEC cells? To verify this speculation, we detected whether it was related to angiogenesis under hypoxia and after knocking down circERBB2 through an angiogenesis experiment.

[0108] Next, further explore the effect of the binding of circERBB2 and HUR on VEGFA, and specifically explain how circERBB2 participates in hypoxia-mediated angiogenesis. In the RIP experiment, RNA immunoprecipitated by the HUR antibody was collected from Du145 and PC3 cells under hypoxia, and the results were detected by qRT-PCR as shown in the appendix Figure 44 As shown, compared with the IgG group, the two cell IP groups (HUR group) specifically immunoprecipitated VEGFA (both P <0.01). The results of agarose gel electrophoresis separation are shown in the appendix Figure 45 As shown, compared with the control group, ** P <0.01, which further proves that the IP group (HUR group) can amplify the VEGFA band, indicating that VEGFA mRNA can specifically bind to HUR in hypoxic Du145 and PC3 cells.

[0109] In summary, in hypoxic Du145 and PC3 cells, circERBB2 participates in hypoxia-mediated angiogenesis by specifically binding to HUR, and at the same time HUR binds and enhances VEGFA transcription.

[0110] Experimental conclusions and applications In summary, this study reveals that hypoxia-induced circERBB2 plays a role as an oncogenic molecule in PCa cells. circERBB2 is highly expressed in PCa cells and pathological tissues. Knockdown of circERBB2 can inhibit the proliferation, migration and invasion abilities of PCa cells and promote apoptosis. In terms of upstream expression regulation, hypoxia regulates the expression of EIF4A3, and EIF4A3 binds to circERBB2, thereby regulating the molecular expression of circERBB2, that is, hypoxia can promote the generation of circERBB2 by enhancing the expression of EIF4A3. In terms of downstream mechanisms, circERBB2 can regulate the expression of VEGFA by binding to HUR. That is, under hypoxia, the binding of circERBB2 to HUR in PCa cells causes HUR to stably bind and enhance VEGFA transcription, participating in hypoxia-mediated angiogenesis. Knockdown of circERBB2 can inhibit hypoxia-induced angiogenesis in HUVEC cells.

[0111] Based on the above experimental conclusions, the present invention obtains an application of circERBB2 in prostate cancer angiogenesis in vivo or in vitro. The application of circERBB2 in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis and the application of promoting prostate cancer angiogenesis. Specifically, the application of inhibiting prostate cancer angiogenesis by inhibiting the expression of circERBB2. Or, the application of promoting prostate cancer angiogenesis by promoting the expression of circERBB2.

[0112] Specifically, the application in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis by knocking out or inhibiting the expression of EIF4A3 to reduce the generation of circERBB2; and the application of promoting prostate cancer angiogenesis by enhancing the expression of EIF4A3 through hypoxia to promote the generation of circERBB2.

[0113] Specifically, the application in prostate cancer angiogenesis includes knocking out or inhibiting the generation of circERBB2, that is, reducing circERBB2 that binds to HUR, thereby reducing VEGFA transcription, thereby inhibiting the application of prostate cancer angiogenesis; and the application of promoting prostate cancer angiogenesis by the binding of circERBB2 to HUR under hypoxia, thereby causing HUR to stably bind and enhance VEGFA transcription.

[0114] The present invention provides a method for inhibiting angiogenesis in prostate cancer, specifically by inhibiting the expression of circERBB2 and applying it to inhibit angiogenesis in prostate cancer. Specifically, by knocking out or inhibiting the expression of EIF4A3, the generation of circERBB2 is reduced, thereby inhibiting angiogenesis in prostate cancer. Specifically, by knocking out or inhibiting the generation of circERBB2, that is, reducing circERBB2 that binds to HUR, thereby reducing VEGFA transcription, thereby inhibiting angiogenesis in prostate cancer.

[0115] The present invention provides a method for promoting angiogenesis in prostate cancer, specifically by increasing the expression of circERBB2 and promoting angiogenesis in prostate cancer. Specifically, through hypoxia, the expression of EIF4A3 is enhanced, promoting the generation of circERBB2, thereby promoting angiogenesis in prostate cancer. Specifically, through the binding of circERBB2 to HUR under hypoxia, thereby causing HUR to stably bind and enhance VEGFA transcription, thereby promoting (increasing) angiogenesis in prostate cancer.

[0116] The present invention provides an application of circERBB2 in the preparation of drugs related to prostate cancer angiogenesis. Specifically, circERBB2 is used in the preparation of drugs related to prostate cancer angiogenesis for inhibiting or promoting angiogenesis in prostate cancer.

[0117] The above-mentioned circERBB2 is a circular RNA formed by the reverse splicing of exons 5 to 9 of the linear gene ERBB2. Specifically, the gene sequence of the circERBB2 is shown in SEA ID NO.1.

Claims

1. Application of circERBB2 in prostate cancer angiogenesis.

2. The application of circERBB2 in prostate cancer angiogenesis according to claim 1, characterized in that, The application in prostate cancer angiogenesis includes two types: the application of inhibiting prostate cancer angiogenesis and the application of promoting prostate cancer angiogenesis.

3. Use of circERBB2 in the angiogenesis of prostate cancer as described in any one of claims 1-2, characterized in that, The application in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis by inhibiting the expression of circERBB2; and the application of promoting prostate cancer angiogenesis by increasing the expression of circERBB2.

4. Use of circERBB2 as described in any one of claims 1-2 in the angiogenesis of prostate cancer, characterized in that, The application in prostate cancer angiogenesis includes the application of inhibiting prostate cancer angiogenesis by knocking out or inhibiting the expression of EIF4A3 to reduce the generation of circERBB2; and the application of promoting prostate cancer angiogenesis by hypoxia to enhance the expression of EIF4A3 and promote the generation of circERBB2.

5. Use of circERBB2 as described in any one of claims 1-2 in the angiogenesis of prostate cancer, characterized in that, The application in prostate cancer angiogenesis includes the application of knocking out or inhibiting the generation of circERBB2, that is, reducing circERBB2 binding to HUR, thereby reducing VEGFA transcription and inhibiting prostate cancer angiogenesis; and the application of promoting prostate cancer angiogenesis by the binding of circERBB2 to HUR under hypoxia, which causes stable binding of HUR and enhances VEGFA transcription.

6. A method for inhibiting angiogenesis in prostate cancer, characterized in that, Inhibiting prostate cancer angiogenesis by inhibiting the expression of circERBB2.

7. The method for inhibiting angiogenesis of prostate cancer according to claim 6, characterized in that, Knocking out or inhibiting the expression of EIF4A3 to reduce the generation of circERBB2, thereby inhibiting prostate cancer angiogenesis.

8. The method for inhibiting prostate cancer angiogenesis according to claim 6, wherein Knocking out or inhibiting the generation of circERBB2, that is, reducing circERBB2 binding to HUR, thereby reducing VEGFA transcription and inhibiting prostate cancer angiogenesis.

9. A method for enhancing angiogenesis in prostate cancer, characterized in that, Promoting prostate cancer angiogenesis by increasing the expression of circERBB2.

10. The method for enhancing angiogenesis in prostate cancer according to claim 9, characterized in that, Promoting the generation of circERBB2 by hypoxia to enhance the expression of EIF4A3, thereby promoting prostate cancer angiogenesis.

11. The method for enhancing angiogenesis in prostate cancer according to claim 9, wherein Promoting prostate cancer angiogenesis by the binding of circERBB2 to HUR under hypoxia, which causes stable binding of HUR and enhances VEGFA transcription.

12. Application of circERBB2 in the preparation of drugs related to prostate cancer blood vessels.

13. Use of circERBB2 as claimed in claim 12 in the preparation of drugs related to prostate cancer blood vessels, characterized in that, Drugs related to prostate cancer blood vessels inhibit or promote prostate cancer angiogenesis by regulating circERBB2.

14. As described in any one of claims 1, 6, 9, and 12, characterized in that, circERBB2 is a circular RNA formed by the back-splicing of exons 5 to 9 of the linear gene ERBB2.

15. As described in any one of claims 1, 6, 9, and 12, characterized in that, The gene sequence of circERBB2 is shown as SEA ID NO.1.

Images