Use of a substance that detects slamf8 in the preparation of a product for screening and diagnosing prostate cancer and test kits

Abstract

The application provides a use of a substance for detecting SLAMF8 in the preparation of a product for screening and diagnosing prostate cancer and a detection kit, and relates to the technical field of biotechnology. The application finds that SLAMF8 can be used as a diagnostic marker of prostate cancer, and a kit using a primer probe group including a primer pair with a nucleotide sequence as shown in SEQ ID NO. 2 and 3; and a probe with a nucleotide sequence as shown in SEQ ID NO. 4 can efficiently diagnose prostate cancer.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of a substance for detecting SLAMF8 in the preparation of a product for screening and diagnosing prostate cancer and a detection kit. BACKGROUND

[0002] Prostate cancer is one of the common malignant tumors in men, and there are various detection methods and kits that can be used for its diagnosis and prognosis, mainly including the following:

[0003] Prostate-specific antigen (PSA) detection kit: PSA refers to a protein secreted by prostate tissue, and its detection result can be used for prostate cancer screening and diagnosis. The advantage is simple and easy to operate, but its disadvantage is that PSA has low specificity, which will cause false positive and false negative results.

[0004] PCA3 detection kit: PCA3 is a gene specific to prostate cancer cells, and this detection method detects whether a patient has prostate cancer by the concentration of PCA3 in the urine sample. The advantage is that it is not sensitive to false positive interference, but its disadvantage is that its sensitivity is not as good as PSA detection.

[0005] PHI (prostate health index) detection kit: PHI is an index composed of prostate-specific antigen (PSA), free PSA (fPSA), and human adrenergic receptor subtype 2 (hK2), which is helpful in the diagnosis and prognosis of prostate cancer. The advantage is that the combination of PHI helps to reduce false positive results, but its disadvantage is that PSA has a certain influence on PHI, and the cost is relatively high.

[0006] Prolaris gene detection kit: Prolaris gene detection kit assesses the prognosis and treatment response of prostate cancer based on the relevant genes of the tumor, combined with the clinical data of the patient, through the RNA level in the in situ pathological tissue of the patient being detected. The advantage is that it can help identify high-risk and provide more accurate guidance for treatment, but its disadvantage is that it is relatively expensive and requires high-level technical personnel to interpret data.

[0007] Riching the diagnostic markers of prostate cancer, improving the prostate cancer detection product, helps to improve the diagnostic defects of prostate cancer in the prior art.

[0008] In view of this, the present application is proposed. SUMMARY

[0009] The purpose of the present application is to provide the application of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer, and a kit for diagnosing prostate cancer, in order to enrich the diagnostic markers of prostate cancer and improve the prostate cancer detection product.

[0010] To solve the above technical problems, the present application adopts the following technical solutions:

[0011] SLAMF8 gene (Signaling Lymphocyte Activation Molecule Family Member 8), also known as CD353, BLAME (B-lymphocyte Activation Molecule), is a transmembrane immunoglobulin superfamily protein. In the human body, SLAMF8 is mainly expressed in immune cells in lymphoid tissue, bone marrow, spleen, gastrointestinal epithelial cells, liver, lung and other tissues. Studies have shown that SLAMF8 is related to the activation, proliferation and differentiation of various immune cells, including T lymphocytes, B lymphocytes, dendritic cells, myeloid cells and granulocyte cells. Specifically, SLAMF8 is closely related to the biological function of T lymphocytes, it can promote T cell apoptosis, regulate T cell differentiation and promote T cell proliferation. In addition, SLAMF8 can also participate in the maturation of dendritic cells and its regulation, regulate the activation and proliferation of B cells, and regulate the differentiation of granulocyte cells. The present application found that the content level of SLAMF8 is related to prostate cancer, and SLAMF8 has a higher transcription level in samples with prostate cancer, so it can be used as a diagnostic marker for prostate cancer.

[0012] Based on this finding, in a first aspect, the application provides the use of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer.

[0013] In an optional embodiment, the diagnosis of prostate cancer includes one or more of prostate cancer screening (such as early-stage prostate cancer screening), prostate cancer diagnosis, prostate cancer recurrence diagnosis, prostate cancer metastasis prediction, and prostate cancer prognosis prediction.

[0014] SLAMF8 is used as a diagnostic marker for the diagnosis of prostate cancer. SLAMF8 as a diagnostic marker includes but is not limited to protein or nucleic acid, when it is nucleic acid, it can be DNA or RNA. That is, SLAMF8 may, for example, but not limited to, represent the expression amount or activity of protein, the transcription level of RNA or the content of DNA in the sample.

[0015] In an optional embodiment, the target substance detected includes nucleic acid encoding SLAMF8, including but not limited to mRNA or cDNA encoding SLAMF8 gene.

[0016] In an optional embodiment, the target substance detected includes mRNA of SLAMF8 gene.

[0017] In an optional embodiment, the substance for detecting SLAMF8 includes reagents and / or instruments for detecting SLAMF8.

[0018] In an optional embodiment, the substance for detecting SLAMF8 includes, but is not limited to, reagents and / or instruments for detecting proteins and / or nucleic acids related to SLAMF8. It includes, but is not limited to, reagents and / or instruments required for reverse transcription, PCR amplification reaction, qPCR amplification reaction, RT-PCR amplification reaction, ELISA detection method, immunoblotting method, immunomagnetic bead detection, chemiluminescence method or immunochromatography test paper and the like. According to the specific detection means, the skilled in the art can select the substance for detecting SLAMF8 according to the methods described in general and more specific textbooks, references, process manuals, product instructions and standard documents, and the present application does not limit this.

[0019] In an optional embodiment, the substance for detecting SLAMF8 includes a primer probe set.

[0020] In an optional embodiment, the nucleotide sequence of the target fragment amplified by the primer probe set is shown in SEQ ID NO. 1.

[0021] In an optional embodiment, the primer probe set for detecting SLAMF8 includes a primer pair with a nucleotide sequence shown in SEQ ID NO. 2 and 3; and a probe with a nucleotide sequence shown in SEQ ID NO. 4, which is modified with a luminescent label and a quencher label.

[0022] In an optional embodiment, the detection sample of the product for diagnosing prostate cancer can be derived from conventional samples used in clinical detection in the art, including but not limited to blood (plasma or serum), cells, tissues, body fluids and secretions, and more specific examples include but are not limited to pharyngeal secretions, or exfoliated cells in urine and the like.

[0023] In an optional embodiment, the product for diagnosing prostate cancer further includes at least one of enzymes, buffer components, metal ions, salts, fluorescent dyes, surfactants, dNTPs, primer probe sets for amplifying an internal standard gene, positive controls and negative controls for amplification reaction.

[0024] In an optional embodiment, the nucleotide sequence of the target fragment of the primer probe set for amplifying an internal standard gene is shown in SEQ ID NO. 5, which is derived from the ABL1 gene.

[0025] In an optional embodiment, the primer probe set for amplifying an internal standard gene includes a primer pair with a nucleotide sequence shown in SEQ ID NO. 6 and 7; and a probe with a nucleotide sequence shown in SEQ ID NO. 8, which is modified with a luminescent label and a quencher label.

[0026] In an optional embodiment, the luminescent label of each probe is independently selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0027] In an optional embodiment, the quencher label of each probe is independently selected from BHQ1, BHQ2, BHQ3 or MGB.

[0028] In an optional embodiment, the luminescent label is labeled at the 5' end of the probe, and the quencher label is labeled at the 3' end of the probe.

[0029] In an optional embodiment, the luminescent label and / or the quencher label of the probe for detecting SLAMF8 and the probe for detecting the internal standard gene can be the same or different.

[0030] In an optional embodiment, when the content of SLAMF8 in the sample to be tested is higher than that in the normal sample, it is determined that the sample to be tested is a sample of prostate cancer. The normal sample is a sample determined as not having prostate cancer by an acceptable standard known in the art.

[0031] In an optional embodiment, when the content ratio of SLAMF8 mRNA and internal standard mRNA in the sample to be tested is higher than that in the normal sample, it is determined that the sample to be tested is a sample of prostate cancer.

[0032] In an optional embodiment, when the content ratio of SLAMF8 mRNA and internal standard mRNA in the sample to be tested is higher than 0.3543, it is determined that the sample to be tested is a sample of prostate cancer.

[0033] In an optional embodiment, the mRNA content of human SLAMF8 gene is detected by a one-step real-time fluorescent RT-PCR detection method and a double-standard curve quantitative principle.

[0034] In a second aspect, a primer probe set for detecting SLAMF8 is also provided, comprising a primer pair with nucleotide sequences as shown in SEQ ID NO. 2 and 3; and a probe with a nucleotide sequence as shown in SEQ ID NO. 4, which is modified with a luminescent label and a quencher label. The primer probe set can be used for quantitative detection of SLAMF8 in a linear range of 10-10000 copies / μL.

[0035] In an optional embodiment, the luminescent label of the probe shown in SEQ ID NO. 4 is selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0036] In an optional implementation, the quenching marker of the probe shown in SEQ ID NO.4 is selected from BHQ1, BHQ2, BHQ3 or MGB.

[0037] In an optional embodiment, a luminescent marker is applied to the 5' end of the probe shown in SEQ ID NO.4, and a quenching marker is applied to the 3' end of the probe shown in SEQ ID NO.4.

[0038] Thirdly, a kit for diagnosing prostate cancer is also provided, which includes the primer and probe set for detecting SLAMF8 from the second aspect.

[0039] In optional embodiments, it may also include at least one of the following: an enzyme, a buffer component, a metal ion, a salt, a fluorescent dye, a surfactant, dNTPs, a primer-probe set for amplifying an internal control gene, a positive control, and a negative control.

[0040] In an optional embodiment, the nucleotide sequence of the target fragment of the primer-probe set used to amplify the internal standard gene is shown in SEQ ID NO.5, and it is derived from the ABL1 gene.

[0041] In an optional embodiment, the primer-probe set for amplifying the internal control gene includes primer pairs with nucleotide sequences as shown in SEQ ID NO. 6 and 7; and probes with nucleotide sequences as shown in SEQ ID NO. 8, wherein the probes are modified with luminescent and quenching markers.

[0042] In an optional embodiment, the luminescent marker of the probe shown in SEQ ID NO.8 is selected from FAM, VIC, TET, JOE, HEX, CY3, CY5, TAMRA, ROX, Texas Red or CY5.5.

[0043] In an optional implementation, the quenching marker of the probe shown in SEQ ID NO.8 is selected from BHQ1, BHQ2, BHQ3 or MGB.

[0044] In an optional embodiment, a luminescent marker is applied to the 5' end of the probe shown in SEQ ID NO.8, and a quenching marker is applied to the 3' end of the probe shown in SEQ ID NO.8.

[0045] Fourthly, methods for detecting SLAMF8 for non-diagnostic and therapeutic purposes are also provided, including using the primer and probe set for detecting SLAMF8 in the second aspect, or the kit in the third aspect to amplify the test product.

[0046] In an optional implementation, the mRNA content of the human SLAMF8 gene is detected using a one-step real-time fluorescence RT-PCR method and the principle of dual standard curve quantification.

[0047] Compared with the prior art, the present application has the following beneficial effects:

[0048] The present application finds that SLAMF8 is related to prostate cancer and is up-regulated in prostate cancer, and uses it as a diagnostic marker, and finds that the sensitivity and specificity of the diagnostic marker can reach more than 90%, and provides the use of a substance for detecting SLAMF8 in the preparation of a product for diagnosing prostate cancer. The detection sample of the kit prepared by using SLAMF8 as a diagnostic marker is flexible, and samples such as pharyngeal secretions or exfoliated cells in urine can be used, and the sample is non-invasive and convenient for large-scale screening and real-time tracking monitoring of prognosis, which is beneficial for the diagnosis of prostate cancer, the prediction of recurrence and metastasis, and the judgment of treatment efficacy.

[0049] The present application also provides a primer probe set for detecting SLAMF8 and a detection kit comprising the same, which has a sensitivity of 10 copies / μL and can specifically amplify the SLAMF8 gene without amplifying human cDNA and gDNA, and has good specificity and sensitivity. BRIEF DESCRIPTION OF DRAWINGS

[0050] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can obtain other drawings according to these drawings without creative labor.

[0051] Figure 1 SLAMF8 amplification curve and internal standard amplification curve in Example 2 of the present application;

[0052] Figure 2 Internal standard standard curve in Example 2 of the present application;

[0053] Figure 3 SLAMF8 standard curve in Example 2 of the present application;

[0054] Figure 4 Clinical sample gDNA amplification results in Example 3 of the present application;

[0055] Figure 5 Clinical sample cDNA amplification results in Example 3 of the present application;

[0056] Figure 6 Ct values of SLAMF8 gene and internal standard gene in Example 5 of the present application;

[0057] Figure 7mRNA concentration of SLAMF8 gene and mRNA concentration of internal standard gene in Example 5 of the present application (* indicates P value < 0.05 in T test);

[0058] Figure 8 mRNA content ratio of SLAMF8 gene and internal standard gene in Example 5 of the present application;

[0059] Figure 9 ROC curve in Example 5 of the present application (* indicates P value < 0.05 in T test). DETAILED DESCRIPTION

[0060] The technical solutions of the present application will be described below in conjunction with the embodiments, obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0061] Example 1

[0062] The present embodiment provides a kit for diagnosing prostate cancer, which comprises a primer probe composition for detecting SLAMF8 gene and a probe composition for detecting internal standard, and the primer probe composition for detecting SLAMF8 is designed according to the gene information in Table 1.

[0063] Table 1

[0064]

[0065]

[0066] The internal standard gene is derived from ABL1 (ABL proto-oncogene 1, non-receptor tyrosine kinase) gene, and the SLAMF8 target fragment and the ABL1 target fragment are as follows.

[0067] SLAMF8 target fragment:

[0068] GCCCAGCCCCTGTGTACAAGTGTTCATTGCTGTA GAAAGGGATGCTCAGCCCTCCAAGACCTGCCAGGT TTCTTTGT CCTGTTGGGCCCCCAACATCAGCGAAAT AACCCTAGCTGGCGACGGGAGACAACC ATGGACTTTGGTATGGAACCACACAGCCTCTTCACAGACGGACAGGTGCTGAGC ATTCCTGGGGACCAGGAGACAGAGATGTGGCCTATTCCTGCATTGTCTCCAACCCTGTCAGCTGGGACTTGGCCACAGTCACGCCCTGGGATAGCTGTCATCATGAGGCAGCACCAGGGAAGGCCTCCTACAAAGATGTGCTGCTGGTG GTGGTGCTGTCTCGCTGCTCCTGATGCTGGTTACTCTCTTCTCTGCCTGGC ACTGGTGCCCC (SEQ ID NO. 1)

[0069] ABL1 target fragment:

[0070] AAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTTGCACTGTATGATTTTGTGGCCAGTGGAGATAACACTCTAAGCATAACTAAAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGAATGGTGTGAAGCCCAAACCAAAAATGGCCAAGGCTGGGTCCCAAGCAACTACATCACGCCAGTCAACAGTCTGGAGAAACACTCCTGGTACCATGGGCCTGTGTCCCGCAATGCCGCTGAGTATCTGCTGAGCAGCGGGATCA (SEQ ID NO. 5)

[0071] Table 2

[0072] Primer / probe Sequence (5'-3') Sequence ID SLAMF8-F 5'-CCCAACATCAGCGAAATAACC-3' SEQ ID NO. 2 SLAMF8-R 5'-GAAGAGAGTAACCAGCATCAG-3 SEQ ID NO. 3 SLAMF8-P 5'-FAM-CCTTCCCTGGTGCTGCCTCATGAT-BHQ1-3' SEQ ID NO. 4 ABL1-F 5'-CACTCTAAGCATAACTAAAGGTGAAAAGC-3' SEQ ID NO. 6 ABL1-R 5'-GATGTAGTTGCTTGGGACCCA-3' SEQ ID NO. 7 ABL1-P 5'-FAM-CCATTTTTGGTTTGGGCTTCACACCATT-BHQ1-3' SEQ ID NO. 8

[0073] Example 2

[0074] Kit sensitivity (amplification efficiency) verification:

[0075] 1. Verification method:

[0076] Prepare SLAMF8 PCR detection reagent and internal standard gene PCR detection reagent, and detection references 1-4 (target gene concentrations of 10, 100, 1000 and 10000 copies / μL, respectively).

[0077] The reaction system is as follows:

[0078] Table 3

[0079]

[0080] The reaction procedure is as follows:

[0081] Table 4

[0082]

[0083] 2. Acceptance Criteria: Through standard curve analysis, the linearity R between the SLAMF8 gene and the internal control gene is [value missing]. 2 >0.99, amplification efficiency between 90% and 110%.

[0084] 3. Verification results are as follows Figures 1-3 As shown in Table 5, from Figure 1 It can be seen that the primer and probe set designed for the SLAMF8 gene and internal control gene in the kit can successfully amplify the target gene at 10–10,000 copies / μL, and the linearity within this range is high. 2 The amplification efficiency was 95.207% and 92.524%, respectively, reaching 0.99, indicating that the kit provided in Example 1 has high amplification efficiency and a sensitivity of up to 10 copies / μL.

[0085] Table 5

[0086]

[0087] Example 3

[0088] Reagent kit specificity validation:

[0089] When extracting RNA from human samples, genomic fragment contamination may occur. This kit uses specific primers and probes designed for the SLAMF8 gene mRNA fragment to avoid interference from genomic fragments in cDNA.

[0090] 1. Verification method:

[0091] SLAMF8 PCR gene detection reagent was prepared according to Example 1 to detect normal human cDNA and normal human genomic gDNA. SLAMF8 genomic detection reagent was used as a control group (the only difference from Example 1 is the probe, the probe of SLAMF8 genomic detection reagent is 5'-FAM-ACTTTGGTATGGAACCACAC-MGB-3', SEQ ID NO. 9).

[0092] 2. Acceptance criteria:

[0093] The control group SLAMF8 genomic detection reagent showed obvious amplification in the detection of clinical sample cDNA and gDNA, while the SLAMF8 gene detection reagent (detecting RNA) provided in Example 1 showed no amplification in the detection of clinical sample cDNA and gDNA.

[0094] 3. Verification results: as shown in Table 5 and Table 6. Figure 4 and Figure 5 It can be seen that the control group SLAMF8 genomic detection reagent showed obvious amplification in the detection of clinical sample cDNA and gDNA, while the SLAMF8 gene detection reagent (detecting RNA) provided in Example 1 showed no amplification in the detection of clinical sample cDNA and gDNA.

[0095] Table 6

[0096]

[0097] Example 4

[0098] Accuracy verification:

[0099] 1. Verification method:

[0100] SLAMF8 detection reagent was prepared according to Example 1 to detect reference 1-4 (target gene concentration: 10-10000 copies / μL) and positive quality control (target value 5000 copies / μL). Reference 1-4 formed a standard curve, and the positive quality control SLAMF8 was quantified.

[0101] 2. Acceptance criteria: the relative deviation between the content of positive quality control SLAMF8 and the target value should be <15% through standard curve analysis.

[0102] 3. Verification results: as shown in Table 7, the relative deviation should be <15%, meeting the methodological requirements.

[0103] Table 7

[0104]

[0105] Example 5

[0106] The kit provided in Example 1 was used to detect clinical samples, which were morning urine samples of patients. The samples were extracted using the Solypure Urine RNA Extraction Kit (R1300), and the mRNA content of the SLAMF8 gene in the clinical samples was detected by one-step real-time fluorescent RT-PCR and double-standard curve detection. The reaction system and reaction procedure were the same as those in Example 2. The reference 1-4 (the target gene concentration was 10, 100, 1000 and 10000 copies / μL, respectively) was used to construct a standard curve, and the detection results of the reference 1-4 were as shown in the following table.

[0107] Table 8

[0108]

[0109]

[0110] Table 9

[0111]

[0112] The detection results are shown in Figure 6 , Figure 7 and Figure 8 . It can be seen from Figure 6 that the Ct value of SLAMF8 in the tumor group is lower than that in the benign hyperplasia group and the normal group, indicating that the mRNA content of SLAMF in the tumor group is higher, and the transcription level of the internal standard gene in the tumor group, the benign hyperplasia group and the normal group has no difference. Figure 7 Further, it is further proved that the tumor group contains more SLAMF8 mRNA, and the content of the internal standard gene in the tumor group, the benign hyperplasia group and the normal group has no difference. It can be seen from Figure 8 that the mRNA content ratio of SLAMF8 gene and internal standard gene in the tumor group is significantly greater than that in other groups, therefore, the SLAMF8 in the subject sample can be used as a diagnostic marker for prostate cancer, and the increase of the transcription level of SLAMF8 indicates that the sample to be tested is derived from a prostate cancer patient. The ROC curve is shown in Figure 9 , and the related parameters are shown in Table 8, which shows that the sensitivity of the subject sample as a diagnostic marker can reach 94.1%, and the specificity can reach 95.1%.

[0113] Table 10

[0114]

[0115] The extracted part of the experimental data is shown in Tables 11-13:

[0116] Table 11

[0117]

[0118] Table 12

[0119]

[0120] Table 13

[0121]

[0122]

[0123] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that the technical solutions described in the foregoing embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. Use of a substance that detects SLAMF8 in the manufacture of a product for the diagnosis of prostate cancer, characterized in that, The substance for detecting SLAMF8 comprises a primer pair with nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3, and a probe with a nucleotide sequence as shown in SEQ ID NO. 4, and the product for diagnosing prostate cancer is used for detecting a sample derived from exfoliated cells in urine or pharyngeal secretions.

2. Use according to claim 1, characterized in that, The target substance for detection is mRNA of the SLAMF8 gene.

3. Use according to claim 1, characterized in that, The probe is modified with a luminescent label and a quencher label.

Images