RPA (recombinase polymerase amplification) primer, probe, kit and method for rapidly detecting adenovirus type 4

Abstract

The invention belongs to the technical field of molecular detection, and particularly relates to an RPA primer, a probe, a kit and a method for rapidly detecting adenovirus type 4. The RPA primer comprises a forward primer and a reverse primer, the sequence of the forward primer is as shown in SEQ ID No.1, the sequence of the reverse primer is as shown in SEQ ID No.2, and the sequence of the RPA-LFD probe is as shown in SEQ ID No.3. According to the method, the primers and the probe are applied, so that the method has the characteristics of good specificity, high sensitivity, simplicity, rapidness, high efficiency and the like, the requirement of rapid detection in a farm can be met, the detection efficiency is improved, and a new technical support is provided for rapid detection of the chicken adenovirus.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular detection, and particularly relates to an RPA primer and probe, a kit and a method for rapidly detecting adenovirus type 4. Background Art

[0002] Fowl Adenovirus (FAdV) is a common avian pathogen belonging to the family Adenoviridae, which has a significant impact on the health and production performance of chicken flocks. Fowl Adenovirus is an enveloped double-stranded DNA virus with a diameter of about 70 nanometers (nm) and an icosahedral symmetry. According to antigenic differences, Fowl Adenovirus can be divided into three groups (groups I, II, and III), among which group I is the most common. Group I can be further divided into multiple serotypes, such as serotype 4 (FAdV-4), which is the main pathogen causing hydropericardium hepatitis syndrome (HHS) in recent years. FAdV-4 was first reported in Pakistan.

[0003] At present, serological and molecular biological methods are available for the detection of Fowl Adenovirus at home and abroad. Among them, the serological method is mainly double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), but the sensitivity of this method for detecting Fowl Adenovirus is relatively low, and it cannot detect low-concentration virus samples. Moreover, the whole detection process is time-consuming, taking several hours or even longer. Molecular biological methods mainly include PCR, real-time fluorescence quantitative PCR (qPCR), and gene sequencing. These molecular detection technologies require professional personnel to operate, expensive instrument equipment, complex operation procedures, and long detection times, making it difficult to apply to on-site detection in non-laboratory environments such as fields and ports.

[0004] The detection method combining recombinase polymerase amplification (RPA) technology with a lateral flow dipstick (LFD) is a rapid, simple and suitable for on-site detection technology. RPA technology is an isothermal nucleic acid amplification technology that can rapidly amplify target nucleic acid sequences under constant temperature conditions (usually 37-42°C). The lateral flow dipstick is based on the specific binding of antigen and antibody, and the results are visualized through the test line and quality control line on the dipstick. By combining RPA with LFD, using RPA to rapidly amplify the target nucleic acid, and then detecting the amplification product through the dipstick, rapid and simple on-site detection is achieved. Compared with other methods, due to the characteristics of rapid efficiency, simple operation, result visualization, high specificity and sensitivity of the RPA-LFD technology, this technology has developed rapidly in recent years.

[0005] Among them, although isothermal nucleic acid amplification technology is simple to operate, the design of its primers is difficult, and the existing primers have poor specificity and sensitivity, resulting in a lack of reagents for isothermal nucleic acid amplification.

[0006] In view of this, the present invention is specifically proposed. Summary of the Invention

[0007] The object of the present invention is to overcome the above-mentioned disadvantages of the prior art and provide an RPA primer and probe, a kit and a method for rapid detection of adenovirus type 4. The detection method has the characteristics of good specificity, high sensitivity, simplicity, rapidity, high efficiency, etc. when using the RPA primer and probe of the present invention, can meet the requirements of rapid detection in farms, improve the detection efficiency, and provide new technical support for the rapid detection of chicken adenovirus.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] In the first aspect, the present invention provides an RPA primer for rapid detection of adenovirus type 4 (FAdV-4). The RPA primer includes a forward primer and a reverse primer. The sequence of the forward primer is as shown in SEQ ID No.1, and the sequence of the reverse primer is as shown in SEQ ID No.2.

[0010] Specifically, SEQ ID No.1 is as follows:

[0011] FAdV-4-RPA-F1: TGGATAACACGGGCACCAATTACCTGGGAGCG;

[0012] FAdV-4-RPA-F2: GGATAACACGGGCACCAATTACCTGGGAGCGG;

[0013] FAdV-4-RPA-F3: ATAACACGGGCACCAATTACCTGGGAGCGGT;

[0014] FAdV-4-RPA-F4: TAACACGGGCACCAATTACCTGGGAGCGGTG;

[0015] FAdV-4-RPA-F5: AACACGGGCACCAATTACCTGGGAGCGGTGG;

[0016] Specifically, SEQ ID No.2 is as follows:

[0017] FAdV-4-RPA-R1: TGCTCGGGCACCCTCAACTCGGAGCGTTCGGG;

[0018] FAdV-4-RPA-R2: GCTCGGGCACCCTCAACTCGGAGCGTTCGGGC;

[0019] FAdV-4-RPA-R3: CTCGGGCACCCTCAACTCGGAGCGTTCGGGCA;

[0020] FAdV-4-RPA-R4: TCGGGCACCCTCAACTCGGAGCGTTCGGGCAT;

[0021] FAdV-4-RPA-R5: CGGGCACCCTCAACTCGGAGCGTTCGGGCATG.

[0022] Furthermore, the RPA primer is designed for the hexon protein gene of adenovirus type 4 (position: 740 - 946).

[0023] In a second aspect, the present invention provides an RPA-LFD probe for rapid detection of adenovirus type 4. The sequence of the RPA-LFD probe is shown in SEQ ID No.3, and the specific sequence is 5’-FAM-ATACCATAGTCGTGCCGCCTCCCGAGGACTA(THF)GACG ATTATAACATAGGCA-3’-C3-spacer.

[0024] Among them, the 5’ end is labeled with FAM, the 3’ end is C3-spacer, and THF (tetrahydrofuran) is 31 bases away from the 5’ end in the middle.

[0025] Furthermore, the RPA-LFD probe is designed for the hexon protein gene of adenovirus type 4.

[0026] In a third aspect, the present invention provides an application of the above-mentioned RPA primer and RPA-LFD probe in the preparation of an FAdV-4-RPA-LFD kit for detecting adenovirus type 4.

[0027] In a fourth aspect, the present invention provides an FAdV-4-RPA-LFD kit for rapid detection of adenovirus type 4. The FAdV-4-RPA-LFD kit contains the RPA primer described in claim 1.

[0028] Furthermore, the RPA kit also contains the above-mentioned RPA-LFD probe.

[0029] Furthermore, the RPA kit also contains buffer A Buffer and B Buffer;

[0030] In a fifth aspect, the present invention provides a method for rapid detection of adenovirus type 4, including the following steps:

[0031] Step 1, extract the DNA of the sample to be tested;

[0032] Step 2, establish an FAdV-4-RPA reaction system and perform an RPA amplification reaction: Using the DNA extracted in Step 1 as a template, perform an isothermal amplification reaction with the RPA primers, RPA-LFD probe, and buffer A Buffer and B Buffer in Claim 8 to obtain an RPA amplification product;

[0033] Step 3, screen out the optimal RPA primers according to the RPA amplification product;

[0034] Step 4, establish an FAdV-4-RPA-LFD detection system: Use the RPA primers in Step 3 to establish an FAdV-4-RPA-LFD reaction system, and then insert a test strip into the FAdV-4-RPA-LFD reaction system to obtain a detection result after the reaction.

[0035] Specifically, the process of using a test strip to detect the reaction product is as follows: Insert the test strip into the FAdV-4-RPA-LFD reaction system. If both the quality control line C line and the test line T line of the test strip show red bands, it is determined as a positive result, indicating that the sample contains chicken adenovirus; if only the quality control line C line of the test strip shows a red band and the test line T line does not show color, it is determined as a negative result, indicating that the sample does not contain chicken adenovirus.

[0036] Further, in Step 4, the FAdV-4-RPA-LFD reaction system includes the RPA primers in Step 3, the RPA-LFD probe in Claim 8, and buffer A Buffer and B Buffer.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] 1) According to the Hexon protein gene sequence of FAdV-4, the present invention designs and screens specific RPA primers and probe sequences, and establishes an RPA-LFD detection system for FAdV-4, which can provide technical support for the rapid detection and early prevention and control of this virus.

[0039] 2) The method of the present invention has a low reaction temperature, which is 39°C. The instrument is simple and the time-consuming is short. The whole reaction only takes about 12 minutes, and a water bath can reach the reaction conditions. It has high sensitivity and can detect the number of virus particles within 100 copies. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] The drawings here are incorporated into the description and form a part of this description, and are used together with the description to explain the principles of the present invention.

[0041] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, for those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0042] Figure 1 RPA primer screening in Example 1 of the present invention;

[0043] Figure 2 RPA-LFD detection results of FAdV-4 in Example 2 of the present invention;

[0044] Figure 3 Results of the test strip of the FAdV-4 specific RPA-LFD monitoring system in Example 4 (it should be noted that FAdV in the picture represents FAdV-4);

[0045] Figure 4 Specificity results of the RPA primer in Example 4 (it should be noted that FAdV in the picture represents FAdV-4);

[0046] Figure 5 Sensitivity results of the RPA primer in Example 4;

[0047] Figure 6 Sensitivity results of the RPA-LFD detection system in Example 4. Detailed implementation manners

[0048] Here, the exemplary embodiments will be described in detail. The implementation manners described in the following exemplary embodiments do not represent all implementation manners consistent with the present invention. On the contrary, they are only examples consistent with some aspects of the present invention detailed in the appended claims.

[0049] Example 1: Design of RPA primers for detecting adenovirus type 4

[0050] (1) Gene screening. Download the sequence of the FAdV-4 gene on the NCBI website, and use the DNASTAR software to perform multiple comparisons on the hexon gene sequence of FAdV-4 to obtain the final hexon protein gene sequence, with the serial number: PP934606.1.

[0051]

[0052] (2) Design of RPA primers

[0053] 10 RPA primers were designed for the screened hexon protein gene sequence as described in Table 1:

[0054] Table 1 RPA primers of FAdV-4

[0055]

[0056]

[0057] In the present invention, 10 designed primer pairs were used to amplify the hexon protein gene sequence of fowl adenovirus, and the amplification effects of different primer pairs were compared (the results are shown in Table 2).

[0058] Table 2 RPA primer combinations of FAdV-4

[0059]

[0060]

[0061] The upstream and downstream primer combinations in Table 2 are 25 pairs of primers, and the primer synthesis was completed by Shanghai Sangon Biotech Co., Ltd.

[0062] The method for screening RPA primers is as follows:

[0063] 1) Extract genomic DNA of fowl adenovirus

[0064] 2) Use 5 forward primers and 5 reverse primers designed to form 25 pairs of primer pairs, and perform RPA amplification respectively. The amplified fragments are 190 bp - 250 bp;

[0065] 3) First, prepare a reaction system with a basic RPA amplification reagent (i.e., non-strip type), RPA primers and viral DNA, and detect the amplification product by agarose gel electrophoresis. Further, irradiate the reaction product under an ultraviolet lamp, and fragments of the expected amplification size were obtained as a result.

[0066] Specifically, the screening results of RPA primers are as follows:

[0067] Using the DNA extracted from FAdV-4 as a template, amplify with the designed RPA primers. Prepare the RPA reaction system according to the instructions of the RPA isothermal amplification kit (basic type). The detection results are as Figure 1As shown, it indicates that the T10, T11, and T13 primer pairs can amplify target fragments with clear bands and appropriate lengths (250 bp). The negative control is negative. Therefore, the T13 primer pair with the brightest band and the strongest specificity is selected as the upstream and downstream primers for the FAdV-4-RPA-LFD detection system.

[0068] It should be noted that Figure 1 In [reference], M: standard molecular weight; 1-25: amplified by 25 pairs of RPA primers; NC: ddH2O; positive: FAdV-4 serotype 4.

[0069] The T10, T11, and T13 primer pairs have good sensitivity and specificity, and relatively high primer amplification efficiency. Their sequences are as follows:

[0070] The primer pair T10 includes the forward primer F2: 5'-GGATAACACGGGCACCAA TTACCTGGGAGCGG-3' and the reverse primer R5: 5'-CGGGCACCCTCAACTC GGAGCGTTCGGGCATG-3';

[0071] The primer pair T11 includes the forward primer F3: 5'-ATAACACGGGCACCAATTA CCTGGGAGCGGT-3' and the reverse primer R1: 5'-TGCTCGGGCACCCTCAAC TCGGAGCGTTCGGG-3';

[0072] The primer pair T13 includes the forward primer F3: 5'-ATAACACGGGCACCAATT ACCTGGGAGCGGT-3' and the reverse primer R3: 5'-CTCGGGCACCCTCAACT CGGAGCGTTCGGGCA-3'.

[0073] Example 2: Design of RPA-LFD (test strip type) probe for detecting adenovirus type 4

[0074] Design the probe according to the requirements of test strip type RPA isothermal rapid amplification. The probe and primer combinations are shown in Table 3:

[0075] Table 3 RPA primer and RPA-LFD probe sequences

[0076]

[0077] The sequence of the ssDNA probe (i.e., RPA-LFD probe) designed for the hexon protein gene is:

[0078] 5’-FAM-ATACCATAGTCGTGCCGCCTCCCGAGGACTA(THF)GACGATTA TAACATAGGCA-3’-C3-spacer, The probe was synthesized by General (Anhui) Co., Ltd. for strip-type RPA amplification.

[0079] Results of the establishment of the FAdV-4-RPA-LFD detection system

[0080] Using the DNA of FAdV-4 and the plasmid of the hexon gene of FAdV-4 as templates respectively, RPA amplification was carried out using the screened T13 primer pair and the probe primer (RPA-LFD). The RPA reaction system was prepared according to the RPA nucleic acid amplification kit (strip type). After the reaction, 10 μL of the amplification product was mixed with 190 μL of ddH2O and visualized with a test strip. The test strip detection results are as Figure 2 shown. A distinct test line appeared simultaneously with the control line, indicating that the screened primers and probe can be used for the RPA-LFD detection of FAdV-4.

[0081] It should be noted that Figure 2 the DNA in [the relevant content] is the product extracted from FAdV-4 and is used for the RPA-LFD experiment; the plasmid is the synthetic plasmid of PMD-19T of the hexon gene of FAdV-4, and the template of the NC group is the negative control, supplemented with water.

[0082] Example 3: Establishment of an FAdV-4-RPA-LFD kit for detecting adenovirus type 4

[0083] This RPA kit includes the following components:

[0084] (1) The RPA primers in Example 1:

[0085] The primer is T13;

[0086] (2) The RPA-LFD probe in Example 2, and the probe sequence is as follows:

[0087] 5’-FAM-ATACCATAGTCGTGCCGCCTCCCGAGGACTA(THF)GACGATTATAACATAGGCA-3’-C3-spacer

[0088] (3) The recombinase polymerase, buffer A Buffer, and B Buffer reagents for amplifying the target gene (in this example, a combination of helicase, single-stranded binding enzyme, and polymerase is selected) are purchased from EasyGo Biotechnology;

[0089] (4) Other substances for preparing the RPA amplification reaction system: DNA template, ddH2O.

[0090] (5) Colloidal gold test strip.

[0091] Configure an FAdV-4-RPA-LFD reaction system:

[0092] The forward primer and reverse primer contained in the reaction system are those in this example, and the specific sequences are:

[0093] FAdV-4-LFD-F2: 5’-GGATAACACGGGCACCAATTACCTGGGAGCGG, FAdV-4-LFD-R5: 5’-Biotin-CGGGCACCCTCAACTCGGAGCGTTCGGGC ATG-3’;

[0094] The probe contained is that in this example, and the specific sequence is:

[0095] 5’-FAM-ATACCATAGTCGTGCCGCCTCCCGAGGACTA(THF)GACGATTATAACATAGGCA-3’-C3-spacer;

[0096]

[0097] Example 4: Establishment of a method for detecting adenovirus type 4

[0098] Step 1. Extraction of total DNA

[0099] Refer to the operation of the DNA kit, and store the extracted DNA sample at -80 °C for later use;

[0100] Step 2. Establishment of the FAdV-4-RPA reaction system

[0101] Using the DNA of FAdV-4 as a template, perform RPA amplification using the corresponding primers. Prepare the RPA reaction system according to the instructions of the RPA isothermal amplification kit (basic type). The 50 μL reaction system is:

[0102] A Buffer 29.4 μL, upstream primer (10 μmol / L) 2 μL, downstream primer (10 μmol / L) 2 μL, DNA template 2 μL, add ddH2O 12.1 μL, mix by inversion and then add B Buffer 2.5 μL. After incubation at 39 °C for 30 min, the reaction ends. Add 50 μL of tris saturated phenol (tris), shake and mix well, centrifuge and take 5 μL of the supernatant for agarose gel electrophoresis detection. Observe the amplification results of each pair of RPA primers through the gel imaging system and select the pair of primers with the brightest amplification band and the strongest specificity for subsequent experiments. As Figure 1As shown, the primer pair of T13 can be used for the RPA-LFD detection of FAdV-4;

[0103] Step 3: Establishment of the FAdV-4-RPA-LFD detection system

[0104] Using the DNA of FAdV-4 and the hexon gene plasmid as templates, RPA amplification was carried out using the designed primer pair T13 and the probe (RPA-LFD) involved in Table 3. The reaction system was prepared according to the RPA nucleic acid amplification kit (test strip type). The 50 μL reaction system was: 29.4 μL of A Buffer, 2 μL of upstream primer (10 μmol / L), 2 μL of downstream primer (10 μmol / L), 0.6 μL of probe, 2 μL of DNA template, 11.5 μL of ddH2O was added, and after mixing well by pipetting, 2.5 μL of B Buffer was added. After incubation at 39°C for 16 min, the reaction ended. 10 μL was taken and added to a centrifuge tube containing 190 μL of ddH2O, and after mixing evenly, the test strip was inserted into the PCR reaction tube, and the test result was directly read according to the color development of the test strip. Specifically, the test result is as Figure 2 shown, indicating that the screened primers and probes can be used for the RPA-LFD detection of FAdV-4;

[0105] Among them, in step 3, 2 μL of upstream primer (10 μmol / L) and 2 μL of downstream primer (10 μmol / L) are the optimal primers obtained after screening in step 2, and the 5' end of the downstream primer is biotin-labeled.

[0106] To verify the efficacy of the method of the present invention, the following verification was carried out in this example:

[0107] 1) Specificity test of the FAdV-4-RPA and FAdV-4-RPA-LFD detection systems:

[0108] The DNA of FAdV-4, plasmid, NDV (Newcastle disease), IV (Infectious bronchitis virus), IBDV (Infectious bursal disease virus) and AEV (Avian encephalomyelitis virus) were respectively detected using the FAdV-4-RPA (basic kit) established in step 2 and the FAdV-4-RPA-LFD reaction system (test strip kit) established in step 3, and ddH2O was set as the blank control to evaluate the specificity of the detection method. The specific test results are as Figure 3 and Figure 4 shown.

[0109] From Figure 3It can be seen that in the FAdV-4-RPA-LFD reaction system established in step 3, only the test strip for detecting FAdV-4 showed an obvious test line while the quality control line appeared. No test lines were observed in other samples and the blank control. The detection result of the FAdV-4-RPA-LFD detection system was consistent with the specific electrophoresis result of FAdV-4, indicating that the designed and screened RPA primers were specific. Figure 4 For the specific result of the FAdV-4-RPA reaction system established in step 2, Figure 3 and Figure 4 By comparison, it can be seen that the established FAdV-4-RPA-LFD detection system has good specificity;

[0110] 2) Sensitivity test of FAdV-4-RPA and FAdV-4-RPA-LFD detection systems:

[0111] The hexon gene plasmid used for detecting sensitivity was obtained by Shanghai Sangon Biotech Co., Ltd. synthesizing the hexon gene into the PMD-19T vector.

[0112] Using the plasmid of the PMD-19T vector containing the hexon gene of FAdV-4 (hereinafter referred to as the hexon plasmid), with a concentration of 7.9×10 11 as the template, gradient dilution was carried out, with 10 dilution factors of -1, -2, -3, -4, -5, -6, -7, -8, -9, and -10 respectively. The sensitivity was analyzed and compared using the FAdV-4-RPA established in step 2 (basic kit) and the FAdV-4-RPA-LFD reaction system established in step 3 (test strip kit). The specific results are as shown in Figure 5 and Figure 6 shown.

[0113] It can be seen from Figure 5 that the detection sensitivity of the FAdV-4-RPA reaction system established in step 2 can reach 790 copies. It can be seen from Figure 6 that the sensitivity of the RPA-LFD detection system of the FAdV-4-RPA-LFD reaction system established in step 3 can reach 7.9 copies. It can be seen from Figure 5 and Figure 6 by comparison that the established FAdV-4-RPA-LFD detection system has relatively high sensitivity.

[0114] The above are only specific implementation manners of the present invention, enabling those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be obvious to those skilled in the art. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention.

[0115] It should be understood that the present invention is not limited to what has been described above, and various modifications and changes can be made without departing from its scope. The scope of the present invention is only limited by the appended claims.

Claims

1. An RPA primer for rapid detection of adenovirus type 4, characterized in that, The RPA primer includes a forward primer and a reverse primer. The sequence of the forward primer is shown as SEQ ID No.1, and the sequence of the reverse primer is shown as SEQ ID No.

2.

2. The RPA primer according to claim 1, wherein The RPA primer is designed for the hexon protein gene of adenovirus type 4.

3. A RPA-LFD probe for rapid detection of adenovirus type 4, characterized in that, The sequence of the RPA-LFD probe is shown as SEQ ID No.3, and the specific sequence is 5’-FAM-ATACCATAGTCGTGCCGCCTCCCGAGGACTA(THF)GACGATTATAACATAGGCA-3’-C3-spacer.

4. The RPA-LFD probe according to claim 3, wherein The RPA-LFD probe is designed for the hexon protein gene of adenovirus type 4.

5. Application of the RPA primer according to claim 1 and the RPA-LFD probe according to claim 3 in the preparation of an FAdV-4-RPA-LFD kit for detecting adenovirus type 4.

6. A FAdV-4-RPA-LFD kit for rapid detection of adenovirus type 4, characterized in that, The FAdV-4-RPA-LFD kit contains the RPA primer according to claim 1.

7. The FAdV-4-RPA-LFD kit according to claim 6, wherein The RPA kit further contains the RPA-LFD probe according to claim 3.

8. The FAdV-4-RPA-LFD kit according to claim 7, wherein The FAdV-4-RPA-LFD kit further contains buffer A Buffer and B Buffer.

9. A method for rapid detection of adenovirus type 4, characterized in that, Comprising the following steps: Step 1: Extract the DNA of the sample to be tested. Step 2: Establish an FAdV-4-RPA reaction system and perform an RPA amplification reaction: Using the DNA extracted in step 1 as a template, perform an isothermal amplification reaction with the RPA primer, RPA-LFD probe, and buffer A Buffer and B Buffer in claim 8 to obtain an RPA amplification product. Step 3: Screen out the optimal RPA primer according to the RPA amplification product. Step 4: Establish an FAdV-4-RPA-LFD detection system: Use the RPA primer in step 3 to establish an FAdV-4-RPA-LFD reaction system, and then insert the test strip into the FAdV-4-RPA-LFD reaction system to obtain a detection result after the reaction.

10. The method for rapid detection of adenovirus type 4 according to claim 9, wherein In step 4, the FAdV-4-RPA-LFD reaction system includes the RPA primer in step 3, the RPA-LFD probe in claim 8, and buffer A Buffer and B Buffer.

Images