A primer set, a kit and a detection method for mink coronavirus detection

By designing primer sets and optimizing RT-qPCR reaction conditions, the problems of insufficient sensitivity and specificity in mink coronavirus detection were solved, enabling quantitative detection and accurate assessment of viral load, and supporting epidemic monitoring and control in the mink farming industry.

CN120366520BActive Publication Date: 2025-11-07SHANDONG FIRST MEDICAL UNIV & SHANDONG ACADEMY OF MEDICAL SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510885671.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-30
Publication Date
2025-11-07
Estimated Expiration
2045-06-30

AI Technical Summary

Technical Problem

Existing methods for detecting mink coronaviruses lack sensitivity and specificity, making accurate detection difficult. They also lack quantitative analysis capabilities, failing to meet the needs for precise assessment of viral load and dynamic monitoring of the epidemic.

Method used

By designing specific primer sets and kits, combining RT-qPCR technology, optimizing primer concentrations and annealing temperatures, and establishing RT-qPCR detection methods for 1b and N fragments, viral copy numbers are calculated using standard curves to achieve quantitative detection.

Benefits of technology

It has achieved highly sensitive and specific quantitative detection of mink coronavirus, enabling accurate assessment of viral load and supporting dynamic monitoring of the epidemic and evaluation of prevention and control effectiveness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120366520B_ABST
    Figure CN120366520B_ABST
Patent Text Reader

Abstract

The application discloses a primer group, a kit and a detection method for mink coronavirus detection, and belongs to the technical field of virus detection. The 1b fragment and N fragment genome sequences of the mink coronavirus are selected as target regions, multiple sequence alignment is carried out, and a conservative region of the genome sequence is selected to design two groups of detection primers. The specific reaction conditions of the two groups of detection primers are optimized respectively, and the sensitivity of the two groups of detection primers is verified through experiments. 135 high-throughput sequencing positive samples are selected, and the two groups of detection primers in the method are used for sample detection respectively, and the results are consistent with the high-throughput sequencing results. The RT-qPCR detection method based on SYBR-Green can be used for mink coronavirus detection and quantification.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of virus detection, and particularly relates to a primer group, a kit and a detection method for mink coronavirus detection. BACKGROUND

[0002] Mink coronavirus (MCoV) belongs to the family of coronaviruses and has a typical envelope structure. The surface spike protein (S protein) can infect the host by combining with the host cell receptor, mainly causing digestive system diseases in minks, especially in young minks, with a high incidence rate of up to 90%. The clinical manifestations are severe diarrhea, vomiting, dehydration and rapid weight loss. In a densely populated breeding environment, the virus spreads through the respiratory tract and is spread through fecal contamination of the environment and feed, causing serious economic losses to the mink breeding industry.

[0003] At present, the detection of mink coronavirus mainly relies on conventional methods. However, with the application of high-throughput sequencing technology, it is found that the genomes of different strains have a large number of gene site variations, which poses a challenge to the sensitivity and specificity of existing detection methods, making it difficult to achieve accurate detection. In addition, the existing detection technology is only limited to qualitative analysis, and a reliable quantitative detection method has not been established, which cannot meet the needs of accurate evaluation of virus load, dynamic monitoring of epidemic situation and evaluation of prevention and control effect.

[0004] Therefore, it is urgent to develop a new detection method with sensitivity, specificity and quantitative analysis capability to solve the technical bottlenecks in the current detection of mink coronavirus and provide key technical support for the prevention and control of epidemic diseases in the mink breeding industry. SUMMARY

[0005] The application aims to provide a primer group for mink coronavirus detection, which comprises:

[0006] a primer MCoV-F-1b, the nucleotide sequence of which is shown in SEQ ID NO. 1;

[0007] a primer MCoV-R-1b, the nucleotide sequence of which is shown in SEQ ID NO. 2;

[0008] a primer MCoV-F-N, the nucleotide sequence of which is shown in SEQ ID NO. 3;

[0009] a primer MCoV-R-N, the nucleotide sequence of which is shown in SEQ ID NO. 4.

[0010] The target product length of the 1b fragment detection primer group is 156 bp, and the target product length of the N fragment detection primer group is 96 bp.

[0011] The nucleotide sequence of the primer MCoV-F-1b is shown as SEQ ID NO. 1: 5'-GCCATGATATTAGGTTCAAAACACG-3';

[0012] The nucleotide sequence of the primer MCoV-R-1b is shown as SEQ ID NO. 2: 5'-AGTACCATCACCAGAAGTTGTACC-3';

[0013] The nucleotide sequence of the primer MCoV-F-N is shown as SEQ ID NO. 3: 5'-TCTAGCTCAAATGGGTTTTGCTC-3';

[0014] The nucleotide sequence of the primer MCoV-R-N is shown as SEQ ID NO. 4: 5'-AACAGGTCTTTCARTAGACTTAGCC-3'.

[0015] The second object of the present application is to provide a detection kit, which comprises the primer set described above.

[0016] Further, the enzyme mixture containing SYBR Green, enzyme-free water, positive control and negative control.

[0017] The third object of the present application is to provide a method for detecting mink coronavirus using the primer set described above, comprising the following steps:

[0018] (1) Designing mink coronavirus 1b fragment and N fragment recombinant plasmid primers to ensure that the recombinant plasmid primers can amplify the complete target gene;

[0019] (2) Using plasmid primers to perform PCR on mink coronavirus positive samples in high-throughput sequencing results to amplify the complete target gene;

[0020] (3) Agarose gel electrophoresis to determine that the fragment length meets the target gene length;

[0021] (4) Purifying the PCR product in (2) that meets the target fragment length, and using DiaSpin column PCR product purification kit for PCR product purification;

[0022] (5) Connecting the purified product in (4) with the vector;

[0023] (6) Transforming the connection product into DH5a competent cells;

[0024] (7) Pick the monoclonal, small shake bacteria liquid 37℃ shaking bed overnight culture 12-16h;

[0025] (8) The bacteria liquid is identified by PCR, and the positive bacteria liquid is sent to Beijing Qikexing Biological Technology Co., Ltd. for sequencing;

[0026] (9) Extract the plasmid, measure the plasmid concentration, and store the plasmid in the refrigerator at-20℃ for standby.

[0027] Further, in step (1), the 1b fragment recombinant plasmid primers are P-1b-F and P-1b-R; the N fragment recombinant plasmid primers are P-N-F and P-N-R.

[0028] The nucleotide sequence of primer P-1b-F is shown in SEQ ID NO. 5: 5'-GATCGTGCATTGCCTAATATG-3', and the nucleotide sequence of primer P-1b-R is shown in SEQ ID NO. 6: 5'-ACGCTGCAATGCTTTAACA-3'. The nucleotide sequence of primer P-N-F is shown in SEQ ID NO. 7: 5'-AGAAGCAACTCTAGGTCTAGG-3', and the nucleotide sequence of primer P-N-R is shown in SEQ ID NO. 8: 5'-CAGTGTAATTCTCAGCTGTAGC-3'. The target length of the 1b fragment recombinant plasmid is 309bp, and the target length of the N fragment recombinant plasmid is 610bp;

[0029] Further, in step (2), the PCR reagent uses 2xRapid Taq Master Mix from Novozyme Biological Company;

[0030] Further, in step (4), the DiaSpin column PCR product purification kit is from Shenguo Biological Company;

[0031] Further, in step (5), the vector connection uses T vector PCR product rapid ligation kit from Shenguo Biological Company;

[0032] Further, in step (6), the DH5α competent cells are purchased from Tiangen Biological Company;

[0033] Further, in step (8), the bacteria liquid PCR identification result is shown in the attached Figure 2 , and the sequencing result is consistent with the original sequence;

[0034] Further, in step (9), the plasmid extraction uses the plasmid mini-preparation kit from Tiangen Biological Company.

[0035] The third object of the present application is to optimize the specific reaction conditions of SYBR-Green RT-qPCR of the RT-qPCR detection primer set containing the 1b fragment and the N fragment, including the primer concentration and the annealing temperature.

[0036] The fourth object of the present application is to conduct a sensitivity test on the two groups of RT-qPCR detection primers of the 1b fragment and the N fragment.

[0037] The fifth object of the present application is to provide two RT-qPCR standard curves, including the RT-qPCR standard curve of the 1b fragment of the mink coronavirus and the RT-qPCR standard curve of the N fragment.

[0038] Further, the establishment of the standard curve is based on the 10-fold dilution of the recombinant plasmid, and the plasmid standard copy number is taken as the abscissa, and the cycle number is taken as the ordinate to plot the standard curve, and the correlation coefficient R 2 and the standard curve equation are calculated. The RT-qPCR standard curve equation of the 1b fragment of the mink coronavirus is y = -3.3328x + 39.43, R 2 = 0.9913; the RT-qPCR standard curve equation of the N fragment of the mink coronavirus is y = -3.4256x + 40.068, R 2 = 0.9982. R 2 All are greater than 0.99, and the standard curves of the 1b fragment and the N fragment RT-qPCR both have good linear relationships.

[0039] The sixth object of the present application is to provide a detection and quantification method of the mink coronavirus based on the 1b fragment primer and the standard curve, which comprises the following steps:

[0040] (1) extracting the viral RNA in the sample;

[0041] (2) reverse transcribing the RNA into cDNA;

[0042] (3) taking the cDNA as a template to conduct the SYBR-Green RT-qPCR to obtain the sample CT value;

[0043] (4) substituting the CT value into the 1b fragment standard curve equation y = -3.3328x + 39.43 to calculate the viral copy number.

[0044] Further, the viral RNA extraction in step (1) uses the total RNA extraction kit of Bio-Rad Company.

[0045] Further, the reverse transcription reagent in step (2) uses Evo M-MLV reverse transcription reagent premix from EvoBiotech. The reverse transcription system includes: 4 μL 5x Evo M-MLV RT Master Mix, 4 μL RNA, 12 μL enzyme-free water. The reverse transcription reaction conditions are: 37℃ for 15 minutes, 85℃ for 5 seconds, 4℃ for cycling.

[0046] Further, the qPCR premix reagent in step (3) uses SYBR Green Pro Taq HS premix qPCR kit from EvoBiotech. The reaction components include: 10 μL 2x SYBR Green Pro Taq HS Premix, 0.8 μL primer MCoV-F-1b (10 μM), 0.8 μL primer MCoV-R-1b (10 μM), 2 μL cDNA, 6.4 μL enzyme-free water. The qPCR reaction conditions are: pre-denaturation 95℃ for 30 seconds; PCR reaction 95℃ for 5 seconds, 60℃ for 30 seconds, 40 cycles; Dissociation Curve analysis.

[0047] Further, when performing qPCR detection in step (3), each sample is performed for 3 technical repeats. A negative control is set, and the negative control is enzyme-free water.

[0048] Further, in step (3), the sample CT value is the average value of 3 repeats as the final result.

[0049] The seventh object of the present application is to provide a method for detecting and quantifying mink coronavirus based on N fragment primers and standard curve, comprising the following steps:

[0050] (1) extracting viral RNA in the sample;

[0051] (2) reverse transcription of RNA to cDNA;

[0052] (3) SYBR-Green RT-qPCR with cDNA as template to obtain CT value;

[0053] (4) substituting CT value into the N fragment standard curve equation y = -3.4256x + 40.068 to calculate the viral copy number.

[0054] Further, the viral RNA extraction in step (1) uses the total RNA extraction kit from Bio-Rad;

[0055] Further, the reverse transcription reagent in step (2) uses Evo M-MLV reverse transcription reagent premix from Aikongrui Biological Co., Ltd. The reverse transcription system includes: 4 μL 5 × Evo M-MLV RT Master Mix, 4 μL RNA, 12 μL enzyme-free water; the reverse transcription reaction conditions are: 37 °C for 15 minutes, 85 °C for 5 seconds, and 4 °C for cycling.

[0056] Further, the qPCR premix reagent in step (3) uses SYBR Green Pro Taq HS premix qPCR kit from Aikongrui Biological Co., Ltd. The reaction components include: 10 μL 2 × SYBR Green Pro Taq HS Premix, 0.4 μL primer MCoV-F-1b (10 μM), 0.4 μL primer MCoV-R-1b (10 μM), 2 μL cDNA, 7.2 μL enzyme-free water; the qPCR reaction conditions are: pre-denaturation at 95 °C for 30 seconds; PCR reaction at 95 °C for 5 seconds, 60 °C for 30 seconds, 40 cycles; dissociation curve analysis (Dissociation Curve);

[0057] Further, when performing qPCR detection in step (3), each sample is performed for 3 technical repeats; and a negative control is set, and the negative control is enzyme-free water;

[0058] Further, in step (3), the sample CT value is the average value of 3 repeats as the final result. BRIEF DESCRIPTION OF DRAWINGS

[0059] Figure 1 is the electrophoresis map of the PCR amplification result of the target gene;

[0060] Figure 2 is the electrophoresis map of the PCR amplification result of the bacterial liquid;

[0061] Figure 3 is the standard curve map of the 1b fragment RT-qPCR;

[0062] Figure 4 is the standard curve map of the N fragment RT-qPCR;

[0063] Figure 5 is the amplification curve map of the 1b fragment primer concentration optimization;

[0064] Figure 6 is the amplification curve map of the N fragment primer concentration optimization;

[0065] Figure 7 is the amplification curve map of the 1b fragment RT-qPCR annealing temperature at 58 °C;

[0066] Figure 8is a plot of amplification curves for 1b fragment RT-qPCR at an annealing temperature of 59°C;

[0067] Figure 9 is a plot of amplification curves for 1b fragment RT-qPCR at an annealing temperature of 60°C;

[0068] Figure 10 is a plot of amplification curves for 1b fragment RT-qPCR at an annealing temperature of 61°C;

[0069] Figure 11 is a plot of amplification curves for 1b fragment RT-qPCR at an annealing temperature of 62°C;

[0070] Figure 12 is a plot of amplification curves for N fragment RT-qPCR at an annealing temperature of 58°C;

[0071] Figure 13 is a plot of amplification curves for N fragment RT-qPCR at an annealing temperature of 59°C;

[0072] Figure 14 is a plot of amplification curves for N fragment RT-qPCR at an annealing temperature of 60°C;

[0073] Figure 15 is a plot of amplification curves for N fragment RT-qPCR at an annealing temperature of 61°C;

[0074] Figure 16 is a plot of amplification curves for N fragment RT-qPCR at an annealing temperature of 62°C;

[0075] Figure 17 is a plot of amplification curves for 1b fragment RT-qPCR sensitivity;

[0076] Figure 18 is a plot of amplification curves for N fragment RT-qPCR sensitivity. DETAILED DESCRIPTION

[0077] The present application is illustrated by the following examples.

[0078] The experimental methods used in the following examples are routine methods unless otherwise specified.

[0079] The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0080] Example 1 Design of mink coronavirus 1b fragment and N fragment detection primers and design of plasmid primers

[0081] The full-length sequence of mink coronavirus (accession number PQ182544.1) was downloaded from NCBI and compared with the sequence of mink coronavirus obtained by high-throughput sequencing in the previous stage. A conserved region was selected in the 1b fragment and N fragment, respectively. Primers were designed according to the conserved region, which were used as RT-qPCR detection primers in the subsequent stage. Plasmid primers were designed at the outer side of the genome position of the detection primers to ensure that the plasmid primers could amplify the complete target fragment. The primer sequences are shown in Table 1.

[0082] Table 1:

[0083]

[0084] The nucleotide sequence of the conserved region of the 1b fragment is as follows: GATCGTGCATTGCCTAATATGATTAGAATGGCATCTGCCATGATATTAGGTTCAAAACACGTTGGATGTTGTACCCATAGTGACAGATTTTATCGGCTTTCTAACGAGTTGGCACAAGTTCTTACAGAGGTTGTACACTGTACAGGTGGTTTTTATATAAAACCTGGTGGTACAACTTCTGGTGATGGTACTACAGCTTATGCCAACTCTGCATTCAACATATTTCAGGCTGTTTCTGCAAATGTCAATAGACTTTTAAGTGTAGATTCTAACACCTGTAACAATTACAATGTTAAAGCATTGCAGCGT (SEQ ID NO. 9).

[0085] The nucleotide sequence of the conserved region of the N fragment is as follows: AGAAGCAACTCTAGGTCTAGGTCTAGAGGAAGGTCTAAGTCTAACACAAGGTCTAATGATAATCAATCTTCAAGTCAAGATATAGCCACTGCTGTTGCTGCTGCTCTAGCTCAAATGGGTTTTGCTCCAAAAGAAACACAGAAGAATAAGTCTCGCTCTAAATCTAGAGATAGGGCTAAGTCTARTGAAAGACCTGTTCCTAAGAATGAAAACAAGCACTCATGGAAGAAAACACCTGGCAAAGGAGATGTTGAAACCATGTTTGGAAAACGCAGTGCCAATCATAATTTTGGTGATGCAGAATTAGTGAAGGATGGTAGTTCACATAAAAACTACCCTCAGTTGGCTGAAATGGTTCCTTCCACAGGTGCATTAGTGTTTGGTGGAAAGTGGGAAGCTACTGAGTCTGGTGATGATGTTATTGTCACTGTTAAYTACAGTTACAAACTACCAAAGAATGACCCTAAAACTACAGCTTTTGTTGGTCAGATTGGTGCATATRCCARACCTTCACAAGTGGCTAAAGAACAAAGATCTCGTTCTAAATCKCGYGAGAGATCAGCCACACCTGTGCCAACACCTGTGAGTGCTACAGCTGAGAATTACACTG (SEQ ID NO. 10).

[0086] Example 2 Synthesis of two-fragment recombinant plasmid

[0087] The positive sample of high-throughput sequencing of the early stage of selection was selected to extract viral RNA. The RNA was reverse transcribed into cDNA, and the cDNA was used as a template to perform PCR with two-fragment plasmid primers to amplify the target gene.

[0088] Further, the PCR reaction components are: 25 μL 2x Rapid Taq Master Mix, 2 μL upstream primer, 2 μL downstream primer, 2 μL cDNA, and 19 μL enzyme-free water. The amplification conditions are: pre-denaturation at 95°C for 30 seconds; PCR reaction at 95°C for 15 seconds, 54°C for 15 seconds, 72°C for 15 seconds, 32 cycles; and complete extension at 72°C for 5 minutes.

[0089] Agarose gel electrophoresis was performed to determine the size of the PCR product, which was consistent with the length of the target gene. The electrophoresis results are shown in Figure 1b, and the sizes of the 1b fragment and the N fragment PCR products are consistent with the length of the target gene. The length of the 1b fragment target gene is 309 bp, and the length of the N fragment target gene is 610 bp. Figure 1

[0090] The PCR product was purified using a DiaSpin column PCR product purification kit. The specific steps are as follows:

[0091] (1) Add 3 times the volume of buffer B3 to the PCR product and mix well;

[0092] (2) Transfer the liquid to the adsorption column, centrifuge at 8000 x g for 30 s, discard the liquid and keep the column;

[0093] (3) Add 500 μL of washing solution to the column, centrifuge at 9000 x g for 30 s, discard the liquid and keep the column;

[0094] (4) Repeat the above step once;

[0095] (5) Place the column in a new collection tube and centrifuge at 9000 x g for 1 minute;

[0096] (6) After centrifugation, place the column in a new centrifuge tube, and add 30 μL of elution buffer to the center of the adsorption membrane, and let it stand at room temperature for 1 minute, and centrifuge at 9000 x g for 1 minute.

[0097] The purified PCR product was connected with the vector, and the connection reaction components were: 1 μL T vector, 5 μL 2 x connection buffer, 1 μL 50% PEG 4000, 1 μL T4 DNA ligase, 2 μL target fragment. The reaction conditions are as follows: 22°C for 10 minutes.

[0098] The ligation product was transformed into DH5a competent cells, and the specific steps were as follows:

[0099] Take a sterile 1.5 ml EP tube and add 50 μL of DH5a competent cells and 6 μL of ligation product;

[0100] (1) Ice bath for 30 minutes;

[0101] (2) Heat shock at 42°C for 90 seconds;

[0102] (3) Ice bath again for 2 minutes;

[0103] (4) Add 800 ul of non-resistant LB liquid medium;

[0104] (5) Shake culture at 37°C for 1.5 hours;

[0105] ​(6) Centrifuge, 4000 rpm, 3 minutes, discard the supernatant;

[0106] (7) Mix the remaining liquid at the bottom of the EP tube and coat onto the ampicillin-resistant plate, divide the zone with a line, and culture in the incubator for 12 to 16 hours after coating.

[0107] Pick the single clone, shake the bacteria to amplify the plasmid, and the specific steps are as follows:

[0108] (1) Prepare the shaking tube, and add 3 ml of ampicillin-resistant LB liquid medium to each tube;

[0109] (2) Pick the single clone with a 10 ul gun head and punch it into the shaking tube with the gun head;

[0110] (3) Fix it with a rubber band and place it in a 37°C shaking bed for 12 to 16 hours.

[0111] Perform PCR identification on the bacterial solution, and the electrophoresis result of the bacterial solution PCR identification is shown in Figure 2 Send the positive bacterial solution to Beijing Qianke Biological Technology Co., Ltd. for sequencing. After comparing the sequencing result with the original sequence, extract the plasmid.

[0112] Use the plasmid extraction kit of Tiangen Biological Technology Co., Ltd. to extract the plasmid, and the specific steps are as follows:

[0113] (1) Take 1-5 ml of the bacterial solution of the overnight culture and add it to a centrifuge tube, centrifuge at 12000 rpm for 1 minute, and try to aspirate the supernatant;

[0114] (2) Add 150 μL of solution P1 to the centrifuge tube with the bacterial precipitate, and use a pipette or vortex to completely suspend the bacterial cell precipitate;

[0115] (3) Add 150 μL of solution P2 to the centrifuge tube, and gently invert it 6-8 times to fully lyse the bacteria;

[0116] (4) Add 150 μL of solution P4 to the centrifuge tube, immediately gently invert it 6-8 times, and mix well. At this time, a white flocculent precipitate will appear, and centrifuge at 12000 rpm for 7 minutes. At this time, a precipitate is formed at the bottom of the centrifuge tube;

[0117] (5) Add 60 μL of endotoxin-removing solution ER to the filtrate, mix well after inverting, and the solution will present a uniform and transparent yellow color;

[0118] (6) Add 0.3 times the volume of isopropanol to the mixed solution, mix well by inverting, and transfer it to the adsorption column CP4;

[0119] (7) Centrifuge at room temperature for 1 minute at 12000 rpm, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0120] (8) Add 600 μL of buffer ED to the adsorption column CP4, centrifuge at 12000 rpm for 1 minute, discard the waste in the collection tube, and put the adsorption column back into the collection tube;

[0121] (9) Add 700 μL of rinse PW to the adsorption column CP4, centrifuge at 12000 rpm for 1 minute, discard the waste in the collection tube, and put the adsorption column back into the collection tube;

[0122] (10) Repeat the previous step;

[0123] (11) Put the adsorption column back into the collection tube. Centrifuge at 12000 rpm for 2 minutes, which is to remove the residual rinse from the adsorption column;

[0124] (12) Put the adsorption column CP4 into a clean centrifuge tube, and add 50-100 μL of wash buffer TB to the middle of the adsorption membrane, and let it stand at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 minute to collect the plasmid solution into the centrifuge tube.

[0125] Example 3 Optimization of 1b fragment and N fragment primer concentration in mink coronavirus SYBR-Green RT-qPCR reaction

[0126] In the SYBR-Green RT-qPCR reaction, the primer concentration was optimized using four concentration gradients of 0.1 μmol / L, 0.2 μmol / L, 0.3 μmol / L, and 0.4 μmol / L, respectively. 10 7Standard plasmids containing the 1b gene sequence and the N gene sequence were used as templates, respectively. MCoV-F-1b and MCoV-R-1b were used as primers for detecting the 1b fragment, and MCoV-FN and MCoV-RN were used as primers for detecting the N fragment. The optimal primer concentration was determined by the primer concentration with the lowest Ct value and the highest fluorescence intensity. The specific operating steps are as follows: Add 10 μL of 2×SYBR Green Pro Taq HSPremix and 2 μL of plasmid to the reaction tube. Add 0.2 μL of forward and reverse primers (10 μM) at a primer concentration of 0.1 μmol / L; 0.4 μL of forward and reverse primers (10 μM) at a primer concentration of 0.2 μmol / L; 0.6 μL of forward and reverse primers (10 μM) at a primer concentration of 0.3 μmol / L; and 0.8 μL of forward and reverse primers (10 μM) at a primer concentration of 0.4 μmol / L. Finally, add enzyme-free water to a total reaction volume of 20 μL. Perform three technical replicates for each well. The reaction conditions are as follows: qPCR reaction conditions: pre-denaturation at 95℃ for 30 seconds; PCR reaction at 95℃ for 5 seconds, 60℃ for 30 seconds, 40 cycles; dissociation curve analysis.

[0127] The optimized amplification results of the 1b fragment RT-qPCR primer concentration are as follows: Figure 5 As shown in the figure, the optimal primer concentration for fragment 1b RT-qPCR is 0.4 μmol / L. The optimized primer concentration amplification results for fragment N RT-qPCR are shown below. Figure 6 As shown, the optimal primer concentration for N-fragment RT-qPCR is 0.2 μmol / L.

[0128] Example 4: Optimization of annealing temperature in SYBR-Green RT-qPCR reaction for mink coronavirus

[0129] After optimizing the primer concentrations, the annealing temperature was further optimized. In the SYBR-Green RT-qPCR reaction, five temperature gradients of 58℃, 59℃, 60℃, 61℃, and 62℃ were used for optimization. Using 10... 7Standard plasmids containing the 1b gene sequence and the N gene sequence were used as templates, respectively. MCoV-F-1b and MCoV-R-1b were used as primers for detecting the 1b fragment, and MCoV-FN and MCoV-RN were used as primers for detecting the N fragment. The optimal annealing temperature was determined by the lowest Ct value and the highest fluorescence intensity. The specific steps were as follows: Add 10 μL of 2×SYBR Green Pro Taq HS Premix, 2 μL of plasmid, 0.8 μL each of the upstream and downstream primers for the 1b fragment RT-qPCR reaction, and 0.4 μL each of the upstream and downstream primers for the N fragment RT-qPCR reaction to the reaction tube. Finally, add enzyme-free water to a total reaction volume of 20 μL. Each well was tested in triplicate. The reaction conditions were as follows: qPCR reaction conditions were: pre-denaturation at 95℃ for 30 seconds; PCR reaction at 95℃ for 5 seconds, followed by 58℃ / 59℃ / 60℃ / 61℃ / 62℃ for 30 seconds, for 40 cycles; and dissociation curve analysis was performed.

[0130] The optimized annealing temperature amplification results for fragment 1b RT-qPCR are as follows: Figure 7 , 8 As shown in Figures 9, 10, and 11, the optimal annealing temperature for fragment 1b RT-qPCR is 60℃. The optimized amplification results for fragment N RT-qPCR annealing temperature are shown in Figures 11. Figure 12 , 13 As shown in Figures 14, 15, and 16, it can be seen that the optimal annealing temperature for N-fragment RT-qPCR is 60℃.

[0131] The optimized reaction conditions for mink coronavirus SYBR-Green RT-qPCR are shown in Table 2 below:

[0132] Table 2:

[0133]

[0134] Example 5 Sensitivity assay for RT-qPCR reaction of 1b fragment and N fragment

[0135] The concentration of recombinant plasmids was determined using a NanoDrop 2000 UV spectrophotometer. The concentration of the 1b fragment recombinant plasmid was 60.7 ng / μL, and the concentration of the N fragment recombinant plasmid was 86.2 ng / μL.

[0136] The formula for calculating copy number concentration is as follows:

[0137] Recombinant plasmid copy number (copies / μL) = (plasmid DNA concentration (ng / μL) × 6.02 × 10⁻⁶) 23 (Number of recombinant plasmid bases × 660)

[0138] The calculated copy number of the 1b fragment recombinant plasmid was 1.79 × 10 11 copies / μL, and the N fragment recombinant plasmid concentration was 1.29 × 10 11 copies / μL, respectively, and the water mink coronavirus 1b and N fragment recombinant plasmids were diluted by 10 times (10 11 -10 1 copies / μL), and RT-qPCR detection was performed using the recombinant plasmid at each dilution as a template to observe the sensitivity of the water mink coronavirus 1b and N fragment RT-qPCR detection method.

[0139] As shown in Figure 17 , the water mink coronavirus 1b fragment RT-qPCR could detect 1.79 × 10 1 copies / μL; as shown in Figure 18 , the water mink coronavirus N fragment RT-qPCR could detect 1.29 × 10 1 copies / μL. This indicates that the water mink coronavirus 1b and N fragment RT-qPCR detection sensitivity is relatively high.

[0140] Example 6 Establishment of 1b fragment RT-qPCR standard curve The water mink coronavirus 1b fragment recombinant plasmid was diluted by 10 times, and the 1.79 × 10 10 copies / μL, 1.79 × 10 9 copies / μL, 1.79 × 10 8 copies / μL, 1.79 × 10 7 copies / μL, 1.79 × 10 6 copies / μL, 1.79 × 10 5 copies / μL, 1.79 × 10 4

[0141] copies / μL, 1.79 × 10 3 copies / μL, 1.79 × 10 2Recombinant plasmids at nine dilutions (copies / μL) were used as templates. The reaction mixture consisted of: 10 μL 2×SYBR Green Pro Taq HS Premix, 2 μL recombinant plasmid, 0.8 μL upstream primer MCoV-F-1b, 0.8 μL downstream primer MCoV-R-1b, and 6.4 μL enzyme-free water. The reaction conditions were: pre-denaturation at 95℃ for 30 seconds; PCR reaction at 95℃ for 5 seconds, 60℃ for 30 seconds, for 40 cycles; dissociation curve analysis was performed. Each sample was tested in triplicate. Based on the detection results at each dilution, a standard curve was plotted with plasmid standard copy number on the x-axis and CT value on the y-axis, as shown below. Figure 3 y = -3.3328x + 39.43, R 2 = 0.9913.

[0142] Example 7: Establishment of a standard curve for N-fragment RT-qPCR. The recombinant plasmid of the N-fragment of mink coronavirus was serially diluted 10-fold to 1.29 × 10⁻⁶. 10 copies / μL, 1.29 × 10 9 copies / μL, 1.29×10 8 copies / μL, 1.29×10 7 copies / μL, 1.29×10 6 copies / μL, 1.29×10 5 copies / μL, 1.29 × 10 4

[0143] copies / μL, 1.29 × 10 3 copies / μL, 1.29 × 10 2 Recombinant plasmids at nine dilutions (copies / μL) were used as templates. The reaction mixture consisted of: 10 μL 2×SYBR Green Pro Taq HS Premix, 2 μL recombinant plasmid, 0.4 μL upstream primer MCoV-FN, 0.4 μL downstream primer MCoV-RN, and 7.2 μL enzyme-free water. The reaction conditions were: pre-denaturation at 95℃ for 30 seconds; PCR reaction at 95℃ for 5 seconds, 60℃ for 30 seconds, for 40 cycles; dissociation curve analysis was performed. Each sample was tested in triplicate. Based on the results at each dilution, a standard curve was plotted with plasmid standard copy number on the x-axis and CT value on the y-axis, as shown below. Figure 4 y = -3.4256x + 40.068, R 2 = 0.9982.

[0144] R 2 >0.99, the standard curves of the 1b fragment and the N fragment RT-qPCR all have good linear relationships.

[0145] Example 8: RT-qPCR identification of mink coronavirus positive samples in high-throughput sequencing results

[0146] 135 high-throughput sequencing positive samples were selected, and the 1b fragment detection primers MCoV-F-1b and MCoV-R-1b and the reaction components and reaction conditions in Example 6 were used for detection, and at the same time, the N fragment detection primers MCoV-F-N and MCoV-R-N and the reaction components and reaction conditions in Example 7 were used for detection. The results show that under the detection of the 1b fragment and the N fragment two groups of primers, 135 samples are all positive, which is consistent with the high-throughput sequencing results. It is shown that the two groups of detection primers in the present application have high positive detection rate and good detection effect.

Claims

1. A primer set for detection of mink coronavirus, characterized in that, The primer set comprises: a primer MCoV-F-1b, the nucleotide sequence of which is shown as SEQ ID NO. 1; a primer MCoV-R-1b, the nucleotide sequence of which is shown as SEQ ID NO. 2; a primer MCoV-F-N, the nucleotide sequence of which is shown as SEQ ID NO. 3; a primer MCoV-R-N, the nucleotide sequence of which is shown as SEQ ID NO.

4.

2. A test kit characterized in that, The kit comprises the primer set of claim 1.

3. The kit of claim 2, wherein The kit further comprises: an enzyme mixture containing SYBR Green, enzyme-free water, a positive control and a negative control.

4. A method for detecting mink coronavirus using the primer set of claim 1 for non-diagnostic purposes, characterized by, The kit comprises the following steps: (1) extracting mink coronavirus RNA and performing reverse transcription to synthesize cDNA; (2) obtaining mink coronavirus 1b fragment and N fragment target genes by PCR amplification and constructing recombinant plasmids respectively; (3) 10-fold dilution of the recombinant plasmid, with the plasmid standard copy number as the abscissa and the CT value as the ordinate, to draw the RT-qPCR standard curve of the 1b fragment and the N fragment; (4) detecting the test sample to obtain the CT value, and calculating the specific copy number of the mink coronavirus in the sample by bringing the CT value into the corresponding standard curve equation.

5. The method of claim 4, wherein, The specific steps for constructing the recombinant plasmid in step (2) are as follows: (1) PCR amplification with 1b fragment and N fragment recombinant plasmid primers to obtain complete 1b fragment and N fragment target genes; the 1b fragment recombinant plasmid primers are primer P-1b-F and primer P-1b-R, and the N fragment recombinant plasmid primers are primer P-N-F and primer P-N-R; the nucleotide sequence of the primer P-1b-F is shown as SEQ ID NO. 5; the nucleotide sequence of the primer P-1b-R is shown as SEQ ID NO. 6; the nucleotide sequence of the primer P-N-F is shown as SEQ ID NO. 7; the nucleotide sequence of the primer P-N-R is shown as SEQ ID NO. 8; (2) purifying the PCR product; (3) connecting the purified product with the vector; (4) transforming the connection product into DH5α competent cells and screening positive clones.

6. The method of claim 4, wherein, The primer concentration is 0.1-0.4 μmol / L, and the annealing temperature is 58-62℃.

7. The method of claim 4 wherein, The steps for establishing the RT-qPCR standard curve in step (3) are as follows: (1) The recombinant plasmid was diluted by 10 times, respectively, 10 10 , 10 9 , 10 8 , 10 7 , 10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10 1 ; (2) RT-qPCR detection with each dilution plasmid as the template, and recording the corresponding CT value; (3) taking the plasmid standard copy number as the abscissa and the CT value as the ordinate to draw the standard curve.

Citation Information

Patent Citations

  • Probe primer group, kit and detection method for rapid identification and detection of mink coronavirus and novel coronavirus

    CN112501356A