Agents for treating or preventing dominant genetic diseases

Abstract

Disclosed is an agent for the treatment of a common form of autosomal dominant retinitis pigmentosa (ADRP) wherein the agent comprises a first nucleotide sequence encoding a CRISPR-related (Cas) endonuclease bound to an NG or NNGRRT PAM (Primal Spacer Adjacent Motif) sequence, and a second nucleotide sequence encoding or comprising a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the gRNA specifically targets a target mutant allele selected from the group consisting of RHOP23H and NR2E3G56R.

Description

Technical Field

[0001] The present disclosure particularly relates to agents for treating certain forms of autosomal dominant retinitis pigmentosa (ADRP).

[0002] Priority Documents

[0003] This application claims priority to Australian Provisional Patent Application No. 2022902322, filed on August 16, 2022, titled "AGENT FOR TREATING OR PREVENTING A DOMINANTLY-INHERITED DISEASE", the content of which is hereby incorporated by reference in its entirety. Background Art

[0004] Retinitis pigmentosa (RP) is a leading cause of inherited blindness, characterized by the death of rod photoreceptor cells, resulting in a reduced ability of the eye to adapt to dim light or darkness ("night blindness"), loss of peripheral vision, and ultimately (over the course of decades) loss of central vision. It is estimated that approximately 1.77 million to 2.35 million people are affected globally (https: / / rarediseases.org / rare-diseases / retinitis-pigmentosa / ), and approximately 25% to 30% of cases are inherited in an autosomal dominant manner.

[0005] The two most common mutation sites that cause autosomal dominant retinitis pigmentosa (ADRP) are the rhodopsin (RHO) gene and the nuclear receptor subfamily 2 group E member 3 (NR2E3) gene. RHO is the most abundant protein in retinal photoreceptor cells (accounting for nearly 50% of the total protein in rod outer segments) and is involved in the phototransduction cascade in rod photoreceptor cells, while NR2E3 is a photoreceptor-specific transcription factor that is essential for the development and maintenance of rod photoreceptor cells. NR2E3 complexes with other factors to promote the transcription of rod genes, including RHO. There are over 150 known RHO mutations that can cause ADRP (www.ncbi.nlm.nih.gov / clinvar), but only one mutation in the NR2E3 gene that causes ADRP, namely the c.166G>A (p.Gly56Arg; G56R) mutation in NR2E3. However, this is the second most common mutation in ADRP. The most common mutation that causes ADRP is the c.68C>A (p.Pro23His; P23H) mutation in RHO.

[0006] Unfortunately, ADRP is currently incurable, and there are no available treatments to prevent or significantly delay the progression of the disease. Perhaps only vitamin A palmitate supplements have evidence of being able to slow photoreceptor function decline (in children) (Berson, EL et al., JAMA Ophthalmol 136(5):490 - 495, 2018). Other than that, the only other options currently available are essentially limited to using acetazolamide in the later stages of the disease to reduce retinal swelling (macular edema) caused by the disease to improve vision (Fishman GA et al., Arch Ophthalmol 107(10):1445 - 1452, 1989), or retinal implantation (again in the later stages of the disease) to provide some partial vision. Therefore, there is an urgent need for new and innovative treatment methods to treat this devastating disease.

[0007] One potential approach to developing novel ADRP therapies is to use genome editing technologies, including the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) method, which is considered to offer great potential for treating genetic diseases. In fact, clinical trials using the CRISPR method have recently begun for a range of different diseases, including sickle cell disease and hereditary transthyretin amyloidosis (hATTR) (https: / / innovativegenomics.org / news / crispr - clinical - trials - 2021 / ). Additionally, of particular interest in the context of the present disclosure, in 2020, a clinical trial of a CRISPR - based therapy began for patients suffering from recessive retinopathies (i.e., Leber congenital amaurosis (LCA)), a disease that causes severe vision loss or blindness in newborns (ClinicalTrials.gov identifier: NCT03872479; and Maeder M et al., Nat Med 25:229 - 233, 2019).

[0008] However, in the context of treating autosomal dominant genetic diseases such as ADRP, a major limitation of using CRISPR methods is the need to specifically target only the disease-causing allele, which is particularly challenging for single nucleotide changes (i.e., point mutations) in the coding sequence. Additionally, in the context of considering gene editing for autosomal dominant genetic diseases, it may generally be preferred to correct mutant alleles by exploiting homology-directed repair (HDR). However, since the HDR process occurs in the S / G2 phase of dividing cells (Jasin M et al., Cold Spring Harb Perspect Biol 5:a012740, 2013), this may be difficult in post-mitotic cells such as retinal photoreceptor cells (Cai Y et al., Sci Adv 5:eaav3335, 2019).

[0009] Accordingly, in the work that led to the present disclosure, the applicant sought to determine whether a CRISPR-based method could be developed that could provide a potentially viable therapy for ADRP without relying on repair processes such as HDR. SUMMARY OF THE INVENTION

[0010] According to a first aspect, the present disclosure relates to an agent for treating a common form of autosomal dominant retinitis pigmentosa (ADRP) in a subject, wherein the agent comprises:

[0011] (i) a first nucleotide sequence encoding a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT protospacer adjacent motif (PAM) sequence; and

[0012] (ii) a second nucleotide sequence encoding or comprising a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R.

[0013] When the agent is delivered to a suitable cell (particularly a retinal photoreceptor cell) of a subject suffering from or predisposed to ADRP caused by the RHOP23H or NR2E3G56R allele, a CRISPR-Cas complex (ribonucleoprotein complex; RNP) is formed by the expressed Cas endonuclease and gRNA, which is capable of specifically targeting and cleaving the target mutant allele, thereby inactivating the target mutant allele (i.e., preventing the expression of the encoded mutant protein).

[0014] In some preferred embodiments, the first nucleotide sequence may encode any Cas endonuclease that binds to the PAM sequence NG. A suitable Cas endonuclease is known as SpCas9-NG.

[0015] In some preferred embodiments, the second nucleotide sequence may encode or comprise a gRNA that comprises a targeting nucleotide sequence selected from SEQ ID NO: 3, 6, 8, and 9 (where the target mutant allele is RHOP23H) or SEQ ID NO: 17 and 18 (where the target mutant allele is NR2E3G56R).

[0016] In a second aspect, the present disclosure provides a pharmaceutical composition comprising a combination of the agent according to the first aspect with a pharmaceutically acceptable carrier, diluent, and / or excipient.

[0017] In a third aspect, the present disclosure provides a method of treating a subject suffering from or susceptible to ADRP, the method comprising administering to the subject the agent according to the first aspect or the pharmaceutical composition according to the second aspect.

[0018] In some embodiments, the method is initiated in childhood, such as, for example, before the onset of ADRP disease and / or the appearance of ADRP symptoms, and the child subject has been genotyped for the RHOP23H and NR2E3G56R mutant alleles. Initiating the method as early as possible may prevent or delay the onset of ADRP disease or the appearance of ADRP symptoms.

[0019] In a fourth aspect, the present disclosure provides the use of the agent according to the first aspect for treating or preventing ADRP caused by the RHOP23H or NR2E3G56R mutant allele.

[0020] In a fifth aspect, the present disclosure provides the use of the agent according to the first aspect in the manufacture of a medicament (such as a pharmaceutical composition) for treating or preventing ADRP caused by the RHOP23H or NR2E3G56R mutant allele.

[0021] In a sixth aspect, the present disclosure provides a CRISPR-Cas complex (ribonucleoprotein complex; RNP) comprising a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT PAM (protospacer adjacent motif) sequence and a guide RNA (gRNA), wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 provides: (A) a schematic diagram of ten (10) guide RNA molecules (gRNAs) designed to specifically target the RHOP23H mutant allele that causes ADRP. The P23H mutation (i.e., c.68C>A) in the allele DNA sequence is shown with a black background. The relevant PAM sequence is located adjacent to the depicted point of each gRNA molecule; for example, the NG PAM sequence of the gRNA designated "RhoNG1" contains the "CG" motif located immediately downstream of the last nucleotide ("T") of the allele DNA sequence targeted by the gRNA. RhoNG5 and rhoVQR share the same gRNA sequence and target overlapping PAM motifs "CG" and "CGA", respectively; and (B) graphical results of CRISPR activity on RHOP23H and wild-type (WT) alleles in HEK293T RHOP23H / + disease model cells. The figure shows the percentage of WT, P23H, and insertion / deletion alleles (i.e., edited RHOP23H alleles) after transfection and selection of HEK293T RHOP23H / + (mean of n = 3 biological replicates). A WT proportion > 33% is thought to be due to large deletions that cannot be amplified due to the loss of primer sites (Adikusuma F et al., Nature 560(7717):E8, 2018);

[0023] Figure 2 provides: (A) a schematic diagram of nine (9) guide RNA molecules (gRNAs) designed to specifically target the NR2E3G56R allele that causes ADRP. The G56R mutation (i.e., c.166G>A) in the allele DNA sequence is shown with a black background. The relevant PAM sequence is located adjacent to the point of each gRNA molecule; for example, the NG PAM sequence of the gRNA designated "nrNG1" contains the "TG" motif located immediately downstream of the last nucleotide ("A") of the allele DNA sequence targeted by the gRNA. gRNA nrNG3 and SpCas9-3 share the same gRNA sequence and target PAM motifs "TG" and "TGG", respectively; and (B) graphical results of CRISPR activity on NR2E3G56R and wild-type (WT) alleles in HEK293T NR2E3G56R / + disease model cells. The figure shows the percentage of WT, P23H, and insertion / deletion alleles (i.e., edited RHOP23H alleles) after transfection and selection of HEK293T NR2E3G56R / +Percentages of wild type (WT), G56R, and insertion / deletion alleles (i.e., the edited NR2E3 G56R alleles) (mean of n = 3 biological replicates). A WT proportion >50% was considered likely due to large deletions that could not be amplified due to loss of primer sites (Adikusuma F et al., Nature 560(7717):E8, 2018). Detailed implementation

[0024] Two of the most common mutations that cause autosomal dominant retinitis pigmentosa (ADRP) are both single-allele "gain-of-function" mutations (Diakatou M et al., Int J Mol Sci 20:2542, 2019). Specifically, the RHO disease variant P23H causes progressive loss of vision through a toxic gain-of-function mechanism (Athanasiou D et al., Prog Retin Eye Res 62:1-23, 2018), in which the mutation causes misfolded RHO-P23H protein to accumulate in rod photoreceptor cells, overwhelming the proteasome and leading to a progressive toxic accumulation of RHO-P23H, which causes retinal degeneration. Similarly, the NR2E3 disease variant G56R causes the expression of a mutant protein that acts as a gain-of-function protein and appears to interact with the CRX cofactor protein to block the expression of rod-specific genes that are essential for rod cell differentiation (Roduit R et al., PLoS One 4:e7379, 2009). Recognizing that both of the affected genes, RHO and NR2E3, are haplo-sufficient (i.e., one normal gene copy is sufficient to produce normal vision (Diakatou et al., 2019 supra; and Haider NB et al., Nat Genet 24:127-131, 2000)), the Applicant wished to determine whether a CRISPR-based method could be developed that could specifically ablate (inactivate) the disease-causing mutant alleles, thereby preventing the expression of the mutant proteins and thus providing a potentially viable therapy for ADRP (which might prevent or even reverse retinal degeneration in affected patients). Ideally, the normal copy of the corresponding gene could provide "disease rescue" (i.e., phenotypic rescue through haplo-sufficiency), such that the strategy might be effective without relying on repair processes such as HDR.

[0025] Accordingly, in a first aspect, the present invention provides an agent for treating a common form of autosomal dominant retinitis pigmentosa (ADRP) in a subject, wherein the agent comprises:

[0026] (i) A first nucleotide sequence encoding a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT PAM (protospacer adjacent motif) sequence; and

[0027] (ii) A second nucleotide sequence encoding or comprising a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R.

[0028] In some embodiments, the agent may comprise one or two polynucleotide molecules, such as an expression vector / construct and / or viral vector suitable for delivery to a subject (e.g., particularly to photoreceptor cells of a subject), such that the first and second nucleotide sequences (and operably linked promoters and / or regulatory sequences) may be provided on the same or different polynucleotide molecules. In such embodiments, the agent thus comprises: (i) a first nucleotide sequence encoding a Cas endonuclease that binds to an NG or NNGRRT protospacer adjacent motif sequence, wherein the first nucleotide sequence is operably linked to a first promoter and / or regulatory sequence for expressing the Cas endonuclease; and (ii) a second nucleotide sequence encoding a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the second nucleotide sequence is operably linked to a second promoter and / or regulatory sequence for transcribing the gRNA, and wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R. The first and second promoters and / or regulatory sequences may be the same or different. When the agent is delivered to suitable target cells, particularly retinal photoreceptor cells, of a subject suffering from or predisposed to ADRP (i.e., the subject has a RHOP23H or NR2E3G56R allele), the Cas endonuclease is expressed intracellularly while the gRNA is produced by transcription, thereby forming a CRISPR-Cas complex capable of specifically targeting and cleaving (cutting) both DNA strands of the target mutant allele, resulting in inactivation of the target mutant allele (i.e., such that the encoded mutant protein cannot be expressed).

[0029] However, the Cas endonuclease does not need to be expressed in the target cell, nor does the gRNA need to be transcribed. That is, the agent may comprise a first nucleotide sequence consisting of mRNA for expressing the Cas endonuclease in the cell, or the agent may comprise a second nucleotide sequence containing the gRNA itself. Thus, in some other embodiments, the agent comprises: (i) a first nucleotide sequence encoding a CRISPR-associated (Cas) endonuclease that binds to the NG or NNGRRT protospacer adjacent motif sequence (e.g., the first nucleotide sequence is provided in the form of mRNA for expressing the Cas endonuclease); and (ii) a second nucleotide sequence encoding a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, the second nucleotide sequence being operably linked to a promoter and / or regulatory sequences for transcribing the gRNA, and wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R. And in some still other embodiments, the agent comprises: (i) a first nucleotide sequence encoding a CRISPR-associated (Cas) endonuclease that binds to the NG or NNGRRT PAM (protospacer adjacent motif) sequence, the first nucleotide sequence being operably linked to a promoter and / or regulatory sequences for expressing the Cas endonuclease; and (ii) a second nucleotide sequence containing a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R.

[0030] However, the CRISPR-Cas complex is provided in the cell, and although not wishing to be bound by theory, it is believed that the CRISPR-Cas complex facilitates the incorporation of frameshift insertions / deletions (i.e., "insertions or deletions" of nucleotides) through non-homologous or microhomology-mediated end joining repair mechanisms (NHEJ / MMEJ) after double-strand DNA breaks (cuts), and in this way, it is believed that the target mutant alleles (i.e., RHOP23H or NR2E3G56R) can be inactivated without relying on repair processes such as HDR, thereby allowing phenotypic rescue through haploinsufficiency.

[0031] In some preferred embodiments, the first nucleotide sequence may encode any Cas endonuclease that binds to the PAM sequence NG. One such suitable Cas endonuclease is called SpCas9-NG, as described, for example, in Nishimasu H et al., Science 361:1259-1262, 2018.

[0032] In some other preferred embodiments, the first nucleotide sequence can encode any Cas endonuclease that binds to the PAM sequence NNGRRT. One suitable Cas endonuclease of this type is called SaCas9 and is described, for example, in Ran FA et al., Nature 520(7546):186-191, 2015 and Maeder et al., 2019 ibid.

[0033] The second nucleotide sequence can encode or comprise a gRNA (also referred to as a gRNA spacer sequence, which is typically about 20 nucleotides in length and defines the genomic sequence to be targeted) containing a targeting nucleotide sequence.

[0034] In some embodiments, the second nucleotide sequence can encode or comprise a gRNA having a targeting nucleotide sequence that hybridizes to a nucleotide sequence within a target mutant allele that includes a mutation site, and wherein the mutation site corresponds to at least one nucleotide located at or near the 3'-end of the gRNA (e.g., within 8 or fewer nucleotides, and more preferably within 6 or fewer nucleotides). As shown in the examples below, such embodiments may be particularly suitable for targeting RHOP23H.

[0035] In some embodiments, the second nucleotide sequence can encode or comprise a gRNA having a targeting nucleotide sequence selected from those shown below:

[0036] For targeting RHOP23H SEQ ID NO:1-9

[0037] For targeting NR2E3G56R SEQ ID NO:14-21

[0038] Preferably, when the target mutant allele is RHOP23H, the second nucleotide sequence encodes or comprises a gRNA that comprises a targeting nucleotide sequence selected from SEQ ID NO:3, 6, 8, and 9, more preferably selected from SEQ ID NO:3, 6, and 8.

[0039] Preferably, when the target mutant allele is NR2E3G56R, the second nucleotide sequence encodes or comprises a gRNA that comprises a targeting nucleotide sequence selected from SEQ ID NO:17 and 18.

[0040] Those skilled in the art will be aware that the gRNA preferably further comprises a scaffold sequence necessary for binding to the Cas endonuclease (thereby forming a CRISPR-Cas complex), also known as trans-activating RNA (tracrRNA). A gRNA that contains both the targeting nucleotide sequence and the scaffold sequence is referred to as a single-guide RNA (sgRNA) molecule. Scaffold sequences suitable for use with SpCas9-NG are well known to those skilled in the art and have been described in Nishimasu et al., 2018 supra; the disclosure thereof is incorporated herein by reference. Scaffold sequences suitable for use with SaCas9 are also well known to those skilled in the art. However, the preferred scaffold for use with SaCas9 is as described below and comprises the nucleotide sequence shown below:

[0041] GTTTCAGTACTCTGGAAACAGAATCTACTGAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTTTTT(SEQ ID NO:24).

[0042] Thus, for example, when the target mutant allele is RHOP23H, the first nucleotide sequence may encode a Cas endonuclease called SpCas9-NG, and the second nucleotide sequence may encode or comprise a gRNA that comprises a suitable scaffold (e.g., GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC (SEQ ID NO:29)) and a targeting nucleotide sequence having a nucleotide sequence selected from SEQ ID NOs: 3, 6, and 8. In another example, when the target mutant allele is RHOP23H, the first nucleotide sequence may encode a Cas endonuclease called SaCas9, and the second nucleotide sequence may encode or comprise a gRNA that comprises a scaffold having the nucleotide sequence shown in SEQ ID NO:24 and a targeting nucleotide sequence having the nucleotide sequence shown in SEQ ID NO:9.

[0043] The agent can be prepared in the form of a viral delivery vector or a virus-like particle (VLP) (including an engineered virus-like particle (eVLP)) for delivery to a subject. Examples of suitable viral delivery vectors include "classical" adeno-associated virus (AAV) vectors (such as those described in Naso MF et al., BioDrugs 31(4):317-334, 2017; and Xu CL et al., Viruses 11(1):28, 2019), as well as other vectors based on full-length adenovirus (AdV), lentiviral (LV) vectors (such as non-integrating lentiviral vectors), and baculovirus (BV) vectors (Aulicinio F et al., Nucleic Acids Res 50(13); 7783-7799, 2022), which can be used, for example, in combination with magnetic nanoparticles for complement shielding. Examples of suitable VLPs include VLPs based on retroviral capsids (such as VLPs based on the gag polyprotein of Friend murine leukaemia virus (FMLV), which have been shown to be able to deliver encapsulated macromolecules to the eye; Banksota S et al., Cell 185:250-265, 2022). However, the agent can also be prepared in other forms well known to those skilled in the art for delivery to a subject, such as non-viral vector systems, including liposomes, lipid nanoparticles (LNPs), delivery forms incorporating cell-penetrating peptides (CPPs), nanoparticles made of polymeric materials or other organic materials, and nanoparticles made of gold (auNP), silica, and / or other inert inorganic materials. The use of nanoparticle delivery forms can provide advantages such as reduced immunogenicity, design flexibility, and ease of large-scale production for therapeutic use, for example. Suitable delivery vectors (such as these vectors and the viral vectors mentioned above) have been reviewed, for example, in Lino CA et al., Drug Deliv 25(1):1234-1257, 2018; and Behr M et al., Acta Pharm Sin B 11(8):2150-2171, 2021; the disclosures of which are incorporated herein by reference.

[0044] In some preferred embodiments, the agent is prepared for delivery to a subject in the form of an AAV delivery vector. AAV has been routinely used for in vivo delivery of various polynucleotide molecules for therapeutic purposes, including delivery of the CRISPR-Cas system to the eye (see Hung SS et al., Invest Ophthalmol Vis Sci 57:3470-3476, 2016; and Li F et al., Front Cell Neurosci 14:570917, 2020). In a particular embodiment, the first nucleotide sequence is provided on a first AAV vector (“vector 1”), the first nucleotide sequence being operably linked to a suitable promoter sequence (e.g., a strong constitutive promoter sequence such as the well-known cytomegalovirus (CMV) promoter sequence) to drive the expression of the Cas endonuclease, and the second nucleotide sequence is provided on a second AAV vector (“vector 2”), the second nucleotide sequence being operably linked to a suitable promoter sequence (e.g., a strong constitutive promoter sequence such as the well-known human U6 promoter sequence) to produce the gRNA.

[0045] In some other preferred embodiments, the agent is prepared for delivery to a subject in the form of an LV delivery vector. Recent studies indicate that self-inactivating non-integrating lentiviral-based delivery vectors can be successfully used to deliver the CRISPR-Cas system to the eye with extremely high efficiency (Ling S et al., Nature Biomed Eng 5:144-156, 2021). In this instance, the LV delivery vector co-delivers the mRNA encoding the Cas endonuclease and an expression cassette (incorporated into the lentiviral genome) to the target cells so that the target cells produce the gRNA (by transcription). Such vectors are characterized by a “burst” of Cas endonuclease expression (due to rapid degradation of the mRNA in the cells), which may prevent or reduce the likelihood of off-target mutations. LV delivery vectors may have an advantage when it is desired to express the Cas endonuclease and the gRNA from their respective expression cassettes within the target cells, as they have a larger packaging capacity (i.e., compared to AAV; approximately 8.0 kb versus approximately 4.7 kb), enabling the generation and delivery of a single LV vector containing both the first nucleotide sequence (encoding the Cas endonuclease) and the second nucleotide sequence (encoding the gRNA).

[0046] In a second aspect, the present disclosure provides a pharmaceutical composition comprising a combination of the agent according to the first aspect with a pharmaceutically acceptable carrier, diluent, and / or excipient.

[0047] Examples of suitable carriers and diluents are well known to those skilled in the art and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, PA 1995. Examples of suitable excipients can be found in Handbook of Pharmaceutical Excipients, 2nd Edition, (1994), edited by A Wade and PJ Weller. Examples of suitable carriers include lactose, starch, glucose, methylcellulose, magnesium stearate, mannitol, sorbitol, and the like. Examples of suitable diluents include ethanol, glycerol, and water.

[0048] The pharmaceutical composition may further comprise any suitable binder, lubricant, suspending agent, coating agent, and solubilizing agent. Examples of suitable binders include starch, gelatin, natural sugars such as glucose, anhydrous lactose, free-flowing lactose, β-lactose, corn sweeteners, natural and synthetic gums (such as gum arabic, tragacanth, or sodium alginate), carboxymethyl cellulose, and polyethylene glycol. Examples of suitable lubricants include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, and the like. Preservatives, stabilizers, dyes, and even flavoring agents may be provided in the pharmaceutical composition. Examples of preservatives include sodium benzoate, sorbic acid, and esters of p-hydroxybenzoic acid. Antioxidants and suspending agents may also be used.

[0049] The pharmaceutical composition will be administered to a subject suffering from or susceptible to ADRP in a therapeutically effective amount, which is an amount sufficient to produce a beneficial or desired clinical outcome. The therapeutically effective amount may be administered in one or multiple administrations. Generally, the therapeutically effective amount is sufficient to treat ADRP or otherwise alleviate, improve, stabilize, reverse, slow down, or delay the progression of the disease. In addition, notwithstanding the foregoing, those skilled in the art will understand that the therapeutically effective amount may vary and depend on a variety of factors, including the activity of the CRISPR-Cas system, the metabolic stability and duration of action of a particular CRISPR-Cas system, the age, weight, sex, and / or health status of the subject, the route and timing of administration, and the severity of the ADRP to be treated.

[0050] The pharmaceutical composition may preferably be intended for use as a "single administration" therapy. However, single daily administrations, multiple daily administrations, controlled or sustained release, or periodic (e.g., monthly, every two months, or every three months) or non-periodic (e.g., the interval period may vary from time to time during the treatment of the subject) administrations may also be considered as needed to achieve the most effective results. The pharmaceutical composition may be administered, for example, by subretinal or intravitreal injection (with or without in vivo electroporation, by application from a standard porator device (such as available from (Obtained in Holliston, MA, United States of America) with a suitable square pulse / wave).

[0051] In a third aspect, the present disclosure provides a method of treating a subject suffering from or susceptible to ADRP, wherein the method comprises administering to the subject an agent of the first aspect or a pharmaceutical composition of the second aspect.

[0052] Preferably, the method is initiated at diagnosis, onset, and / or appearance of ADRP symptoms, typically during puberty, and may continue for the remainder of the subject's life. In some embodiments, the method is initiated in childhood, such as, for example, before the onset and / or appearance of ADRP symptoms, and the child subject has been genotyped for the RHOP23H and NR2E3G56R mutant alleles. Initiating the method as early as possible may prevent or delay the onset of the disease or the appearance of symptoms.

[0053] In a fourth aspect, the present disclosure provides the use of an agent of the first aspect for treating or preventing ADRP caused by the RHOP23H or NR2E3G56R mutant allele.

[0054] In a fifth aspect, the present disclosure provides the use of an agent of the first aspect in the manufacture of a medicament (e.g., a pharmaceutical composition) for treating or preventing ADRP caused by the RHOP23H or NR2E3G56R mutant allele.

[0055] In a sixth aspect, the present disclosure provides a CRISPR-Cas complex (ribonucleoprotein complex; RNP) comprising a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT PAM (protospacer adjacent motif) sequence and a guide RNA (gRNA), wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R.

[0056] The CRISPR-Cas complex of the sixth aspect can be used as a "directly delivered" agent for treating autosomal dominant retinitis pigmentosa (ADRP) in a subject, wherein the ADRP-causing mutation is RHOP23H or NR2E3G56R. Thus, the present disclosure should also be understood to extend to, for example, pharmaceutical compositions comprising the CRISPR-Cas complex of the sixth aspect (in combination with a pharmaceutically acceptable carrier, diluent, and / or excipient) and methods of treating a subject afflicted with or susceptible to ADRP, wherein the method comprises administering the CRISPR-Cas complex of the sixth aspect or a pharmaceutical composition comprising the same. The Cas endonuclease of the CRISPR-Cas complex of the sixth aspect can be, for example, SpCas9-NG, SpCas9-VQR, or SaCas9. The gRNA of the CRISPR-Cas complex of the sixth aspect can comprise a targeting nucleotide sequence (gRNA spacer sequence) selected from SEQ ID NOs: 1-9 below (for targeting RHOP23H) and SEQ ID NOs: 14-21 (for targeting NR2E3G56R). The gRNA can be produced synthetically and includes one or more chemical modifications to increase the stability of the gRNA and / or the CRISPR-Cas complex (e.g., incorporation of one or more nucleotides having 2'-O-methyl (2'OMe) or 2'-O-methoxyethyl (MOE) ribose modifications, one or more 5'-methylcytosine (MeC) nucleotides, and / or one or more phosphorothioate (PS) backbone linkages). The CRISPR-Cas complex of the sixth aspect can be directly delivered to the target cell (especially the nucleus of the target cell) using one or more of a variety of techniques well known to those of skill in the art (e.g., the techniques reviewed in Zhang S et al., Theranostics 11(2):614-648, 2021; the disclosure of which is incorporated herein by reference), and includes, for example, physical methods such as microinjection, electroporation, biolistic techniques, and microfluidic techniques, and / or the use of synthetic carriers such as lipid nanoparticles (LNPs) and cell-derived vesicles, polymers, nanogels, inorganic nanoparticles, and DNA nanowires. In some embodiments, the CRISPR-Cas complex of the sixth aspect can be delivered to the target cell in the form of VLPs, and especially retroviral capsid-based VLPs (or eVLPs) (e.g., FMLV-based eVLPs, which have been shown to be capable of delivering encapsulated macromolecules to the eye; Banksota et al., 2022 supra).

[0057] In this patent specification, many terms well known to those of skill in the art are used. However, for clarity, some of these terms are defined below.

[0058] As used herein, the term "treatment" includes preventing or treating a disease or disorder and alleviating the established symptoms of a disease or disorder. Thus, the act of "treating" ADRP includes: (1) preventing or delaying the appearance of clinical symptoms of the development of the disease or disorder in a subject who has or is predisposed to the disease or disorder; (2) inhibiting the disease or disorder (i.e., curbing, reducing, or delaying the development or recurrence of the disease or disorder (in the case of maintenance treatment) or at least one of its clinical or subclinical symptoms); and (3) alleviating or reducing the disease or disorder (i.e., causing the disease or disorder or at least one of its clinical or subclinical symptoms to regress).

[0059] As used herein, the phrase "manufacture of a medicament" includes using a pharmaceutical agent directly as a drug or in any stage of manufacturing a drug.

[0060] The medicaments of the present disclosure are further described below with reference to the following non-limiting examples and figures.

[0061] Examples

[0062] Example 1 CRISPR-based editing of the RHO allele that causes ADRP

[0063] Identification of candidate guide RNAs

[0064] To identify candidate guide RNA (gRNA) sequences for allele-specific targeting, the human RHOP23H allele sequence was scanned to find all possible CRISPR-Cas9 gRNA options. Although no gRNA sequences targeting the P23H site were available for the canonical SpCas9 system, gRNAs for three other Cas9 endonucleases were identified. Specifically, eight (8) gRNAs of SpCas9-NG (also abbreviated as Cas9-NG) (designated rhoNG1-8), one gRNA of SpCas9-VQR (designated rhoVQR1), and one gRNA of SaCas9 (designated rhoSA1) were identified. The short protospacer adjacent motif (PAM) sequence of SpCas9-NG is NG PAM, while SpCas9-VQR binds to NGA PAM, and SaCas9 binds to the NNGRRTPAM sequence. When the gRNA of canonical length does not start with G, an additional G is appended to the 5' end of the gRNA to enhance transcription under the U6 RNA polymerase III promoter. In some cases, the G naturally exists in the target sequence (SEQ ID NO: 1, 2, 7, and 9); otherwise, the additional G does not match the target DNA sequence (SEQ ID NO: 4). These RHO gRNAs are shown schematically in Figure 1A and the sequences targeting the allele (i.e., the gRNA spacer sequences) are shown in Table 1.

[0065] Table 1

[0066] gRNA 5'→3' targeting nucleotide sequence rhoNG1* UGGCUGCGUACCACACCCGU(SEQ ID NO:1) rhoNG2* AAGUGGCUGCGUACCACACC(SEQ ID NO:2) rhoNG3 GUGGGUACUCGAAGUGGCUG(SEQ ID NO:3) rhoNG4* ACUGUGGGUACUCGAAGUGGC(SEQ ID NO:4) rhoNG5 GGUGUGGUACGCAGCCACUU(SEQ ID NO:5) rhoNG6 GUGUGGUACGCAGCCACUUCG(SEQ ID NO:6) rhoNG7* CAGCCACUUCGAGUACCCAC(SEQ ID NO:7) rhoNG8 GUACUGUGGGUACUCGAAGU(SEQ ID NO:8) rhoSA1 GACGGGUGUGGUACGCAGCCACU(SEQ ID NO:9) rhoVQR GGUGUGGUACGCAGCCACUU(SEQ ID NO:5)

[0067] (*An extra G nucleotide was added to the 5' end of the given sequence to enhance transcription of the U6 promoter*)

[0068] Screening of off-target activities of candidate gRNAs

[0069] Each of the ten candidate gRNA molecules was screened to ensure that their cleavage activity was restricted to the RHOP23H allele sequence and no significant cleavage was observed in the wild-type (WT) allele.

[0070] Construction of CRISPR expression constructs

[0071] Cas9-NG expression construct

[0072] Initially, a plasmid for expressing SpCas9-NG and containing a puromycin resistance gene (PuroR) was constructed using standard methods known to those skilled in the art; hereinafter referred to as Cas9-NG-puro. The nucleotide sequence of SpCas9-NG is the same as that published (Nishimasu et al., 2018, ibid.). The inclusion of PuroR facilitated the enrichment of transfected cells after in vitro transfection. The expression of SpCas9-NG enzyme and PuroR was driven by the well-known CBh promoter (Gray SJ et al., Hum Gene Ther 9:1143-1153, 2011), such that puromycin resistance occurred only in tandem with SpCas9-NG expression. The plasmid also encoded a gRNA site upstream of the scaffold sequence where the oligonucleotide sequence of a custom gRNA molecule could be inserted for expression of the gRNA by the U6 RNA polymerase III promoter. Subsequently, according to standard methods known to those skilled in the art, the custom oligonucleotide sequences corresponding to the gRNAs in Table 1 (SEQ ID NO: 1–8) were inserted into the gRNA site of Cas9-NG-puro to generate eight expression constructs targeting RHOP23H. An example of the nucleotide sequence of an example encoding the full-length gRNA (containing the RhoNG6 spacer sequence and the scaffold sequence) in the Cas9-NG-puro expression plasmid is shown below:

[0073] 5'–GTGTGGTACGCAGCCACTTCGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaa aaagtggcaccgagtcggtgc–3' (SEQ ID NO:10)

[0074] (Note. The RhoNG6 spacer sequence is shown in uppercase, while the scaffold sequence is shown in lowercase).

[0075] Cas9-VQR expression construct

[0076] A plasmid for expressing SpCas9-VQR and PuroR (px459-VQR, Addgene reference: 196971) was obtained. The nucleotide sequence of SpCas9-VQR is as published (Kleinstiver B et al., Nature 523:481-485, 2015). As described above, the inclusion of PuroR facilitates the enrichment of successfully transfected cells after in vitro transfection, and the expression of Cas9-VQR enzyme and PuroR is driven by the CBh promoter (Gray et al., 2011 ibid.). Similarly, the plasmid also encodes the gRNA site upstream of the scaffold sequence, and the gRNA expression is driven by the U6 RNA polymerase III promoter. Subsequently, according to the standard methods known to those skilled in the art, a custom oligonucleotide sequence corresponding to the Cas9-VQR gRNA (SEQ ID NO:5) in Table 1 was inserted into the Cas9-VQR-puro expression plasmid to generate an expression construct targeting RHOP23H.

[0077] SaCas9 expression construct

[0078] Initially, an expression plasmid for expressing SaCas9 and PuroR was generated using the standard methods known to those skilled in the art; the construct is hereinafter referred to as SaCas9-puro. In addition, SaCas9-puro was modified to change a stretch of thymine (T) nucleotides in the gRNA scaffold, which was expected to have a negative effect on the amount of gRNA transcription; the modified construct is hereinafter referred to as SaCas9-puro-V3. In the construct, the expression of SaCas9 enzyme and PuroR is driven by the CBh promoter (Gray et al., 2011 ibid.). SaCas9-puro-V3 also encodes the gRNA site upstream of the scaffold sequence, from which the gRNA expression is driven by the U6 RNA polymerase III promoter. Subsequently, a custom oligonucleotide sequence corresponding to the SaCas9 gRNA (SEQ ID NO:9) in Table 1 was inserted into SaCas9-puro-V3 to generate an expression construct targeting RHOP23H. The nucleotide sequence encoding the full-length gRNA (containing the RhoSA1 spacer sequence and the scaffold sequence) in the SaCas9-puro V3 expression plasmid is shown below:

[0079] 5'-GACGGGTGTGGTACGCAGCCACTgtttcagtactctggaaacagaatctactgaaacaaggcaaaatgccgtgt ttatctcgtcaacttgttggcgagatttttt-3'(SEQ ID NO:11)

[0080] (Note. The RhoSA1 spacer sequence is shown in uppercase, while the scaffold sequence is shown in lowercase).

[0081] Transfection of cells with CRISPR expression constructs

[0082] Each of the CRISPR expression constructs was transfected into HEK293T cells according to standard methods known to those skilled in the art. The successfully transfected cells were enriched by culturing in the presence of puromycin. The transfected cells were grown until approximately 90% confluent and then harvested. DNA extraction was performed according to standard methods known to those skilled in the art.

[0083] Analysis of WT alleles

[0084] The target site, nucleotides -12 to 388 of exon 1 of the human RHO gene, was amplified using the following primers and standard methods known to those skilled in the art:

[0085] Forward primer: 5'-GGTCAGAACCCAGAGTCATCCAGC-3'(SEQ ID NO:12)

[0086] Reverse primer: 5'-AGAGGTGTAGAGGGTGCTGGTGAAG-3'(SEQ ID NO:13)

[0087] The primer sequences were provided with standard overhangs (adapter sequences) for next-generation sequencing (NGS) techniques well known to those skilled in the art. By using standard NGS (Illumina MiSeq TMSystem; Illumina, Inc., San Diego, CA, United States of America) quantified the insertions / deletions present in the WT allele. The results indicated that four of the candidate gRNAs (i.e., rhoNG3, rhoNG6, rhoNG8, and rhoSA1) showed little to no activity (<3.6%) at the WT allele, and two other gRNAs (i.e., rhoNG4 and rhoNG5) showed only very low activity levels (6.3% - 7.3%) at the WT allele. In contrast, rhoNG1, rhoNG2, rhoNG7, and rhoVQR showed higher activity levels at the WT allele, ranging from 49.7% (rhoVQR) to 91.1% (rhoNG7), demonstrating the inherent unpredictability of avoiding off-target CRISPR activity. Notably, for each of the four gRNAs that showed little to no off-target activity against the WT allele, the mutation site within the target mutant allele corresponded to a nucleotide located at or near the 3' end of the corresponding gRNA (e.g., within 6 or fewer nucleotides). Also interestingly, the results obtained using rhoNG5 and rhoVQR with the same gRNA sequence were quite different, indicating that the SpCas9-VQR endonuclease may not be well-suited for this application targeting only disease-causing alleles.

[0088] Activity analysis at mutant alleles

[0089] To determine the specific targeting activity of the gRNAs at the RHOP23H allele sequence, the CRISPR "search and replace" prime editing method (see, e.g., Anzalone A et al., Nature 576:149 - 157, 2019) was used to generate ADRP disease model HEK293T cells; that is, HEK293T cells containing the RHOP23H allele. The disease model cells are referred to herein as HEK293T RHOP23H / + cells. Then, in the same manner as described above, HEK293T RHOP23H / + cells were transfected with each of the CRISPR expression constructs of each of the gRNAs, rhoNG3, rhoNG6, rhoNG8, and rhoSA1. TM Quantification of the PCR amplification of the target site and the insertions / deletions present in the RHOP23H and WT alleles was performed using the Illumina MiSeq Figure 1BSurprisingly, a substantial reduction of the RHOP23H allele (from 50%) was observed for rhoNG3 (remaining only 2.2%), rhoNG6 (remaining 5.9%), rhoNG8, and rhoSA1 (both remaining only 1.3% of the RHOP23H allele), and the edited alleles (i.e., alleles including insertions / deletions) were close to 50%. In contrast, the WT allele frequency remained close to 50%.

[0090] The results indicate that a CRISPR-Cas system can be identified and developed using a Cas endonuclease that binds to an NG or NNGRRT PAM sequence and a gRNA targeting the RHOP23H mutant allele to specifically ablate the RHOP23H mutant allele with minimal off-target activity.

[0091] Example 2 Results in CRISPR-Based Editing of the NR2E3 Allele of ADRP

[0092] Identification of candidate guide RNAs

[0093] A method substantially the same as the method described in Example 1 was used to identify candidate gRNA sequences for allele-specific targeting of the human NR2E3G56R allele sequence. Eight (8) gRNAs of SpCas9-NG (i.e., nrNG1-8) were identified, one of which was also compatible with SpCas9 (SpCas9-3) that binds to NGG PAM. When the canonical-length gRNA does not start with G, an additional G is appended to the 5' end of the gRNA to enhance transcription under the U6 RNA polymerase III promoter. In some cases, the G naturally exists in the target sequence (SEQ ID NO:17 and 21); otherwise, the additional G does not match the target DNA sequence (SEQ ID No:14, 16, and 20). These NR2E3 gRNAs are Figure 2A shown schematically in and the sequences targeting the alleles (i.e., gRNA spacer sequences) are shown in Table 2.

[0094] Table 2

[0095] gRNA 5'→3' targeting nucleotide sequence nrNG1* AGGAAGCACUAUGGCAUCUA(SEQ ID NO:14) nrNG2 GCAGCAGCAGGAAGCACUAU(SEQ ID NO:15) nrNG3* AGCAGCAGCAGGAAGCACUA(SEQ ID NO:16) nrNG4* CGGAGACAGCAGCAGCAGGA(SEQ ID NO:17) nrNG5 GUGCGGAGACAGCAGCAGCA(SEQ ID NO:18) nrNG6 GCCAUAGUGCUUCCUGCUGC(SEQ ID NO:19) nrNG7* AUAGUGCUUCCUGCUGCUGC(SEQ ID NO:20) nrNG8* CUUCCUGCUGCUGCUGUCUC(SEQ ID NO:21) SpCas9-3* AGCAGCAGCAGGAAGCACUA(SEQ ID NO:16)

[0096] (*An additional G nucleotide was added to the 5' end of the given sequence to enhance transcription of the U6 promoter)

[0097] Screening of off-target activities of candidate gRNAs

[0098] Each of the candidate gRNA molecules was screened to ensure that their cleavage activity was restricted to the NR2E3G56R allele sequence and no significant cleavage was observed in the wild-type (WT) allele.

[0099] Construction of CRISPR expression constructs

[0100] The CRISPR expression constructs were prepared in a manner similar to that described in Example 1. Briefly, custom oligonucleotide sequences encoding the gRNAs (SEQ ID NOs: 14–21) in Table 2 were inserted into the Cas9-NG-puro plasmid according to standard methods known to those skilled in the art to generate eight (8) expression constructs targeting NR2E3G56R. The gRNA of SEQ ID NO: 16 is also compatible with SpCas9. However, the plasmids for expressing SpCas9 and PuroR were also modified to change a stretch of thymine (T) nucleotides in the gRNA scaffold, which was expected to have a negative effect on the amount of gRNA transcription; the modified construct is hereinafter referred to as SpCas9-puro-V3 and encodes a scaffold having the nucleotide sequence according to SEQ ID NO: 24. Subsequently, an oligonucleotide sequence encoding SpCas9-3 gRNA (SEQ ID NO: 16) was inserted into SpCas9-puro-V3 according to standard methods known to those skilled in the art.

[0101] Transfection of cells with CRISPR expression constructs

[0102] HEK293T cells (for successfully transfected cells) were transfected and enriched using the same method described in Example 1. The transfected cells were grown until approximately 90% confluent and then harvested. DNA extraction was performed according to standard methods known to those skilled in the art.

[0103] Analysis of WT alleles

[0104] The target site, i.e., nucleotides 18,675 to 18,985 of the NR2E3 gene (covering exon 2 and part of intron 1), was amplified using the following primers and standard methods known to those skilled in the art:

[0105] Forward primer: 5'-ATGCACAGTGAGGGAGACACTTC-3' (SEQ ID NO: 22)

[0106] Reverse primer: 5'-CACCGCACTCACCTGTAGAT-3' (SEQ ID NO: 23)

[0107] The primer sequences were provided with standard overhangs (adapter sequences) for next-generation sequencing (NGS) techniques well known to those skilled in the art. By using standard NGS (Illumina MiSeq TMThe (system) quantifies insertions / deletions present in the WT allele. Some gRNAs are unable to edit the WT allele even when perfectly matched to the allele (i.e., gRNAs designed to target the WT allele rather than NR2E3G56R); thus, they are considered inefficient and excluded from further analysis. The gRNAs nrNG1, nrNG4, nrNG5, and SpCas9-3 (SEQ ID NOs: 14, 17, 18, and 16) were selected for testing. The results indicated that one of the candidate gRNAs (i.e., nrNG4) showed little activity (<1.5%) at the WT allele, while another of the candidate gRNAs (i.e., nrNG5) showed only a very low activity level (<10%) at the WT allele. In contrast, the other candidate gRNAs showed higher activity levels at the WT allele, ranging from 36.8% (nrNG1) to 81.4% (SpCas9-3). Interestingly, the results obtained using nrNG5 and SpCas9-3 (81.4%) with the same gRNA sequence were very different, indicating that the SpCas9 endonuclease may not be well-suited for this application targeting only the disease-causing allele.

[0108] Activity analysis at mutant alleles

[0109] To determine the specific targeting activity of the gRNAs at the NR2E3G56R allele sequence, the CRISPR prime editing method was used to generate ADRP disease model HEK293T cells; that is, HEK293T contains the NR2E3G56R allele. The disease model cells are referred to herein as HEK293 NR2E3G56R / + cells. Then, in the same manner as above, each of the HEK293 NR2E3G56R / + cells was transfected with each of the CRISPR expression constructs of the gRNAs, nrNG4, and nrNG5. The PCR amplification of the target site and quantification of insertions / deletions present in the NR2E3G56R and WT alleles were quantified using the Illumina MiSeq TM system. The results are shown in Figure 2B . A substantial reduction of the NR2E3G56R allele (from 50%) was observed for nrNG4 (remaining 6.9%) and nrNG5 (remaining 9.9%).

[0110] The results suggest that a CRISPR-Cas system can be identified and developed using a Cas endonuclease that binds to the NG or NGG PAM sequence and a gRNA targeting the NR2E3G56R mutant allele to specifically ablate the NR2E3G56R mutant allele with minimal off-target activity.

[0111] Throughout the specification and the appended claims, unless the context requires otherwise, the words "comprise", "include" and variations such as "comprising" and "including" will be understood to imply the inclusion of the stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0112] Any reference in this specification to any prior art is not and should not be taken as an admission that such prior art forms part of the common general knowledge in any form.

[0113] Those skilled in the art will readily appreciate that the agents, pharmaceutical compositions, methods and uses of the present disclosure are not limited to the specific applications described. The agents, pharmaceutical compositions, methods and uses are not limited to their preferred embodiments with respect to the specific elements and / or features described or depicted herein. Furthermore, it should be readily understood that the agents, pharmaceutical compositions, methods and uses are not limited to the disclosed embodiments but can be subject to many rearrangements, modifications and substitutions without departing from the scope of the present disclosure.

Claims

1. An agent for treating a common form of autosomal dominant retinitis pigmentosa (ADRP) in a subject, wherein the agent comprises: (i) a first nucleotide sequence encoding a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT protospacer adjacent motif (PAM) sequence; and (ii) a second nucleotide sequence encoding or comprising a guide RNA (gRNA) capable of forming a CRISPR-Cas complex with the Cas endonuclease, wherein the gRNA specifically targets a target mutant allele selected from RHOP23H and NR2E3G56R.

2. The agent according to claim 1, wherein the first nucleotide sequence encodes any Cas endonuclease that binds to the PAM sequence NG.

3. The agent according to claim 2, wherein the first nucleotide sequence encodes the SpCas9-NG endonuclease.

4. The agent according to claim 1, wherein the first nucleotide sequence encodes any Cas endonuclease that binds to the PAM sequence NNGRRT.

5. The agent according to claim 4, wherein the first nucleotide sequence encodes the SaCas9 endonuclease.

6. The agent according to any one of claims 1 to 4, wherein the target mutant allele is RHOP23H, and the second nucleotide sequence encodes or comprises a gRNA that comprises a targeting nucleotide sequence selected from those shown in SEQ ID NOs: 1-9.

7. The agent according to claim 6, wherein the gRNA comprises a targeting nucleotide sequence selected from SEQ ID NOs: 3, 6, 8, and 9.

8. The agent according to claim 6, wherein the gRNA comprises a targeting nucleotide sequence selected from SEQ ID NOs: 3, 6, and 8.

9. The agent according to claim 3, wherein the gRNA comprises a targeting nucleotide sequence of any one of SEQ ID NOs: 3, 6, and 9, which is operably linked to the scaffold nucleotide sequence of SEQ ID NO:

29.

10. The agent according to claim 5, wherein the gRNA comprises the targeting nucleotide sequence of SEQ ID NO: 9, which is operably linked to the scaffold nucleotide sequence of SEQ ID NO:

24.

11. The agent according to any one of claims 1 to 3, wherein the target mutant allele is NR2E3G56R, and the second nucleotide sequence encodes or comprises a gRNA that comprises a targeting nucleotide sequence selected from those shown in SEQ ID NOs: 14-21.

12. The agent according to claim 11, wherein the gRNA comprises a targeting nucleotide sequence selected from SEQ ID NOs: 17 and 18.

13. The agent according to any one of claims 1 to 12, wherein the first nucleotide sequence and the second nucleotide sequence are provided on one or two viral vectors.

14. The medicament according to any one of claims 1 to 12, wherein the first nucleotide sequence and the second nucleotide sequence are provided in a delivery vehicle comprising nanoparticles made of a polymeric material or other organic material.

15. A pharmaceutical composition comprising a combination of the medicament according to any one of claims 1 to 14 with a pharmaceutically acceptable carrier, diluent, and / or excipient.

16. The pharmaceutical composition according to claim 15, which is suitable for administration by subretinal injection.

17. A method of treating a subject suffering from or predisposed to autosomal dominant retinitis pigmentosa (ADRP), wherein the method comprises administering to the subject the medicament according to any one of claims 1 to 14 or the pharmaceutical composition according to claim 16 or 17.

18. The method according to claim 17, wherein the method begins at puberty.

19. The method according to claim 17, wherein the method begins before the onset of ADRP disease and / or the appearance of ADRP symptoms in childhood.

20. Use of the medicament according to any one of claims 1 to 14 for the treatment or prevention of autosomal dominant retinitis pigmentosa (ADRP) caused by the RHOP23H or NR2E3G56R mutant allele.

21. Use of the medicament according to any one of claims 1 to 14 for the manufacture of a medicament for the treatment or prevention of autosomal dominant retinitis pigmentosa (ADRP) caused by the RHOP23H or NR2E3G56R mutant allele.

22. A CRISPR-Cas complex (ribonucleoprotein complex; RNP) comprising a CRISPR-associated (Cas) endonuclease that binds to an NG or NNGRRT PAM (protospacer adjacent motif) sequence and a guide RNA (gRNA), wherein the gRNA specifically targets a target mutant allele selected from RHOP23H or NR2E3G56R.

23. The CRISPR-Cas endonuclease according to claim 22, wherein the Cas endonuclease is SpCas9-NG, SpCas9-VQR, or SaCas9.

24. The CRISPR-Cas complex according to claim 22 or 23, wherein the gRNA comprises a targeting nucleotide sequence selected from SEQ ID NOs: 1-9 and SEQ ID NOs: 14-21.

25. The CRISPR-Cas complex according to claim 24, wherein the gRNA comprises the targeting nucleotide sequence of any one of SEQ ID NOs: 3, 6, and 9, which is operably linked to the scaffold nucleotide sequence of SEQ ID NO:

29.

26. The CRISPR-Cas complex according to claim 24, wherein the gRNA comprises the targeting nucleotide sequence of SEQ ID NO: 9, which is operably linked to the scaffold nucleotide sequence of SEQ ID NO: 24.

Images