Application of miRNA in promoting in-vitro proliferation of human corneal stromal mesenchymal stem cells

Abstract

The invention belongs to the technical field of molecular stem cell proliferation, and relates to application of miRNA in promoting in-vitro proliferation of human corneal stromal mesenchymal stem cells. The miR-19b-1-5p can be used as a target to screen the culture medium additive capable of promoting the in-vitro proliferation of the human corneal stroma mesenchymal stem cells. The method is expected to realize industrialization, and has important significance for providing'seed 'cells in regenerative medicine. The invention also finds that the co-incubation of the human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p and the cardiac fibroblasts can obviously influence the improvement of the expression of PAX6 in the cardiac fibroblasts and inhibit the expression of a profibrosis factor TGF beta; therefore, the human corneal stroma mesenchymal stem cells with high expression of miR-19b-1-5p are expected to be used as a favorable tool for delaying cardiac fibroblast fibrosis in vitro, and a foundation is also laid for exploring a stem cell therapy for treating cardiac fibrosis in the future.

Description

Technical Field

[0001] The present invention belongs to the technical field of stem cell proliferation, and more specifically, relates to the application of miRNA in promoting the in vitro proliferation of human corneal stromal mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells (MSCs) have the ability to promote tissue regeneration and accelerate wound healing, can inhibit the body's inflammatory response by regulating the proliferation functions of innate and acquired immune cells, and have self-renewal, multi-directional differentiation, and low immunogenicity. Research has found that MSCs not only exist widely in bone marrow, placenta, and amniotic tissue, but also can be isolated from adipose tissue, umbilical cord blood, peripheral blood, skeletal muscle, liver, gingival and dental tissues, skin, milk, cartilage, and limbal stroma.

[0003] In recent years, studies have shown that the stem cells in the corneal stroma are mesenchymal stem cells, which are mainly located in the anterior part of the limbal stroma near the limbal stem cells, are part of the limbal microenvironment, play an important role in maintaining the proliferative potential of limbal stem cells (LSCs), and jointly maintain the transparency and stability of the stroma with corneal epithelial and endothelial cells. Corneal Mesenchymal Stem Cells (CMSCs) are a type of stem cells existing in the corneal stroma and have the potential for self-renewal and multi-directional differentiation. They play important roles in maintaining corneal homeostasis, repairing injuries, and participating in immune regulation.

[0004] Due to the shortage of corneal donor resources, human corneal stromal mesenchymal stem cells are extremely scarce. Therefore, exploring the proliferation method of human corneal stromal mesenchymal stem cells has broad and practical application values. The existing technology still lacks practical and industrialized methods for the proliferation of human corneal stromal mesenchymal stem cells. Summary of the Invention

[0005] In order to overcome the deficiencies of the prior art, the purpose of the present invention is to provide the application of miRNA in promoting the in vitro proliferation of human corneal stromal mesenchymal stem cells.

[0006] The second purpose of the present invention is to provide the application of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in inhibiting the fibrosis of cardiac fibroblasts.

[0007] The purpose of the present invention is achieved by the following technical solutions:

[0008] The inventors found through research that transfection of miR-19b-1-5p mimics into human corneal stromal mesenchymal stem cells, which increases the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells, can significantly promote the in vitro proliferation and migration of human corneal stromal mesenchymal stem cells.

[0009] Therefore, the present invention first protects the use of miR-19b-1-5p mimics or its promoters in the preparation of a preparation for promoting the proliferation and / or migration of human corneal stromal mesenchymal stem cells in vitro, and the sequence of the miR-19b-1-5p is AGUUUUGCAGGUUUGCAUCCAGC.

[0010] Specifically, the miR-19b-1-5p is of human origin, or chemically or biosynthetically synthesized.

[0011] Similarly, an artificial synthetic miR-19b-1-5p inhibitor was transfected into human corneal stromal mesenchymal stem cells, which significantly inhibited the in vitro proliferation and migration of human corneal stromal mesenchymal stem cells. Therefore, the present invention also protects the use of miR-19b-1-5p inhibitors in the preparation of a preparation for inhibiting the proliferation and / or migration of human corneal stromal mesenchymal stem cells in vitro, and the sequence of the miR-19b-1-5p inhibitor is: 5'-GCUGGAUGCAAACCUGCAAAAACU-3'.

[0012] The present invention also provides the use of a method for increasing the expression level of miR-19b-1-5p in promoting the in vitro proliferation of human corneal stromal mesenchymal stem cells.

[0013] Preferably, the application is to use genetic engineering methods to transfect miR-19b-1-5p into human corneal stromal mesenchymal stem cells, and the sequence of the miR-19b-1-5p is AGUUUUGCAGGUUUGCAUCCAGC.

[0014] The present invention found that miR-19b-1-5p has an obvious promoting effect on the proliferation and migration of human corneal stromal mesenchymal stem cells. Therefore, the in vitro proliferation and migration can be promoted by intervening in the method of increasing the expression of miR-19b-1-5p in human corneal stromal mesenchymal stem cells, and culture medium additives with the ability to promote the in vitro proliferation and migration of human corneal stromal mesenchymal stem cells can be screened using miR-19b-1-5p as a target.

[0015] Therefore, the present invention also provides the use of a method for increasing the expression level of miR-19b-1-5p in screening culture medium additives for the in vitro proliferation of human corneal stromal mesenchymal stem cells.

[0016] It is known in the prior art that PAX6 can be used as a target for treating cardiac fibrosis. After constructing human corneal stromal mesenchymal stem cells overexpressing miR-19b-1-5p, the present invention found that co-incubating them with cardiac fibroblasts can significantly affect the expression of PAX6 in cardiac fibroblasts. Specifically, the mRNA level of PAX6 in cardiac fibroblasts co-incubated with the human corneal stromal mesenchymal stem cells highly expressing miR-19b-1-5p of the present invention is significantly increased, and the mRNA level of TGFβ is significantly decreased. It can be seen that the human corneal stromal mesenchymal stem cells highly expressing miR-19b-1-5p can inhibit the fibrosis process of cardiac fibroblasts in vitro, and thus it is expected to use the human corneal stromal mesenchymal stem cells highly expressing miR-19b-1-5p as a favorable tool for delaying the fibrosis of cardiac fibroblasts in vitro.

[0017] Therefore, the present invention also protects the application of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in the preparation of a drug for inhibiting the fibrosis of cardiac fibroblasts.

[0018] The present invention also protects the application of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in increasing the expression level of PAX6 in cardiac fibroblasts for non-disease diagnosis and treatment purposes.

[0019] The present invention also protects the application of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in decreasing the expression level of TGFβ in cardiac fibroblasts for non-disease diagnosis and treatment purposes.

[0020] Preferably, in the above application, the specific operation is to co-incubate the human corneal stromal mesenchymal stem cells with increased expression of miR-19b-1-5p and cardiac fibroblasts.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention found that increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells can significantly promote the in vitro proliferation and migration of human corneal stromal mesenchymal stem cells, and culture medium additives promoting the in vitro proliferation of human corneal stromal mesenchymal stem cells can be screened using miR-19b-1-5p as a target. This method is expected to be industrialized, which is of great significance for providing "seed" cells for regenerative medicine.

[0023] In addition, the present invention also found that co-incubating human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p and cardiac fibroblasts can significantly affect and increase the expression of PAX6 in cardiac fibroblasts and inhibit the expression of the profibrotic factor TGFβ. It can be seen that human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p can inhibit the fibrotic process of cardiac fibroblasts in vitro, so it is expected to use human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p as a favorable tool to delay the fibrosis of cardiac fibroblasts in vitro, and also lay a foundation for future exploration of stem cell therapy for treating cardiac fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Flow cytometry detection results of isolated human corneal mesenchymal stem cells;

[0025] Figure 2 Bar graph of the expression levels of miR-19b-1-5p in HCS-MSC transfected with miR-19b-1-5p and the control group;

[0026] Figure 3 Showing that miR-19b-1-5p promotes the proliferation and migration of human corneal stromal mesenchymal stem cells;

[0027] Figure 4 Cell morphology of HCS-MSC-miR-19b-1-5p and the control group under the microscope; the upper figure is the NC mimic, and the lower figure is miR-19b-1-5p;

[0028] Figure 5 Cell growth curve of HCS-MSC-miR-19b-1-5p and the control group;

[0029] Figure 6 Showing that rno-miR-19b-1-5p inhibitor inhibits the proliferation of human corneal stromal mesenchymal stem cells;

[0030] Figure 7 Comparison of the gray values of immunoblotting bands after co-incubation of HCS-MSC-miR-19b-1-5p and cardiac fibroblasts. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific drawings and embodiments. In the embodiments, the experimental methods used are all conventional methods unless otherwise specified, and the materials, reagents, etc. used can be obtained from commercial channels unless otherwise specified.

[0032] Example 1: Isolation, culture and identification of human corneal stromal mesenchymal stem cells (HCS-MSCs)

[0033] Isolation and culture: Referring to the prior art, the limbal tissue was obtained from human organ donation. The isolation process of human corneal stromal mesenchymal stem cells was as follows: The remaining limbal tissue after corneal transplantation was taken. Under aseptic conditions, it was repeatedly rinsed with PBS containing double antibiotics. Epithelial and endothelial tissues were removed using ophthalmic surgical forceps, scissors, blades, etc. The stroma was cut into pieces of 1 mm×2 mm in size and attached to the bottom of a culture dish with a diameter of 3 cm. The culture medium prepared according to the requirements of the mesenchymal stem cell medium kit MSC SFM (ThermoFisher, USA) was added, and it was cultured in an incubator at 37°C and 5% (v / v) CO2. Half of the medium was changed on the 3rd day, and then the whole medium was changed every 3 days; Every day, it was observed under an inverted microscope whether cells crawled out around the tissue mass. When spindle-shaped or fusiform cells growing in colonies were observed under the microscope, the tissue mass could be removed and new culture medium was added for continuous culture; When the cells reached 90% confluence after about 14 days, they were digested with a digestive solution containing 0.2 g / L EDTA and 2.5 g / L trypsin, and passaged at a density of 2×10 4 / cm 2 for subculture.

[0034] Identification: The third-generation corneal stromal mesenchymal stem cells were taken, digested with 0.25% trypsin and the cell density was adjusted to 1×10 6 cells / mL. 1 mL of cell suspension was added to each centrifuge tube, washed twice with sterile PBS, centrifuged at 1000 g for 5 min, the supernatant was discarded, and after resuspending the cells with 100 μL PBS, appropriate amounts of CD73, CD90, CD105, CD14, CD19, CD45, PAX6 antibodies and their respective isotype controls were added to each single-cell suspension. It was incubated at room temperature in the dark for 30 min, centrifuged at 1000 g for 5 min, washed twice with PBS, resuspended with 500 μL PBS to make a single-cell suspension, and detected by flow cytometry.

[0035] The results of flow cytometry detection were as Figure 1 shown, indicating that the positive expression of CD73, CD90, CD105, and PAX6 was more than 96%, and the negative expression of CD14, CD19, and CD45 was less than 2%, which was in line with the surface marker characteristics of mesenchymal stem cells.

[0036] Example 2: Detection of the expression level of miR-19b-1-5p

[0037] I. Amplification and recovery of miR-19b-1-5p:

[0038] Extract total RNA from plasma samples (using TRIzol kit), then enrich small RNAs through a small RNA enrichment column, and reverse transcribe miRNAs into cDNA using a specific reverse transcriptase (such as M-MLV or SuperScript IV). Then perform cDNA amplification by real-time fluorescence quantitative PCR, and select specific primers (forward and reverse primers) to amplify the target miRNA. Finally, recover the miRNA from the amplification products, and use Thermo Fisher's TRIzol RNA extraction reagent or electrophoresis method to isolate the purified miRNA amplification products.

[0039] The sequence of miR-19b-1-5p is as follows: AGUUUUGCAGGUUUGCAUCCAGC.

[0040] II. Transfect miR-19b-1-5p into human corneal stromal mesenchymal stem cells: Culture human corneal stromal mesenchymal stem cells with 2000 transfection reagent at a concentration of 100 nM, and transfect miR-19b-1-5p to obtain human corneal stromal mesenchymal stem cells transfected with miR-19b-1-5p (HCS-MSC-miR-19b-1-5p). The control group was transfected with NC mimic.

[0041] The sequence of the NC mimic is as follows: AGAGACGAGTTTTGCAGGTTTGC.

[0042] III. Extract the RNA of HCS-MSC-miR-19b-1-5p using TRIzol reagent according to the instructions, and perform Q-PCR to detect the expression level of miR-19b-1-5p in the cells.

[0043] The primers used are as follows:

[0044] NC mimic:

[0045] SEQ ID NO: 1: AGAGACGAGTTTTGCAGGTTTGC

[0046] SEQ ID NO: 2: ATCCAGTGCAGGGTCCGAGG

[0047] miR-19b-1-5p

[0048] SEQ ID NO: 3: AGTTTTGCAGGTTTGCATCCAGC

[0049] SEQ ID NO: 4: TACTCAGGACTCATCGTC

[0050] RNA extraction by Trizol method: (1) Aspirate the culture medium in the six-well plate, wash twice with PBS to remove residual culture medium as much as possible, then add 1 mL of Trizol reagent (Life Technologies) to each well to lyse the cells, and pipette continuously until uniform. Transfer the lysate into a 1.5 mL EP tube and let it stand at room temperature for 5 min; (2) Add 200 μL of chloroform to each tube, mix well, and let it stand at room temperature for 3 min; (3) Centrifuge at 12,000 g for 15 min at 4 °C, and aspirate 0.4 mL of the upper aqueous phase into a new 1.5 mL EP tube; (4) Add 0.4 mL of isopropanol to each tube and mix well, then let it stand on ice for 10 min; (5) Centrifuge at 12,000 g for 10 min at 4 °C, discard the supernatant, and the RNA precipitates at the bottom of the tube; (6) Add 1 mL of 75% ethanol to each tube, shake the centrifuge tube, and centrifuge at 7,500 g for 5 min at 4 °C, discard the supernatant; (7) Invert and air-dry at room temperature for about 15 min, and dissolve the RNA with 20 - 50 μL of DEPC water; (8) Detect the RNA concentration with a ultra-micro biological detector.

[0051] Use TaqMan TM Reverse transcribe miRNA using the MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific). The reverse transcription reaction conditions are: 16 °C for 30 min, 42 °C for 30 min, end after 85 °C for 5 min, and store at 4 °C. The reverse transcription reaction system is shown in Table 1.

[0052] Table 1 Reverse transcription reaction system

[0053] Component 1 sample volume RT primer 6.00 μL dNTPs 0.30 μL Reverse transcriptase (50 U / μL) 3.00 μL 10×RT buffer 1.50 μL Ribonuclease inhibitor (20 U / μL) 0.19 μL Sterile water 1.01 μL Total 12.00 μL

[0054] Use Amplify and detect the expression of the reverse transcribed fragments by RT-PCR using the Universal Master Mix II kit. The transcription conditions are shown in Table 2, and the reaction system is shown in Table 3.

[0055] Table 2 RT-PCR reaction conditions

[0056]

[0057]

[0058] Table 3 RT-PCR reaction system

[0059]

[0060] The experimental results showed that: compared with the control group, the expression level of miR-19b-1-5p in HCS-MSCs transfected with miR-19b-1-5p increased significantly ( Figure 2 ).

[0061] Example 3 miR-19b-1-5p Promotes the Proliferation Ability of Human Corneal Stromal Mesenchymal Stem Cells

[0062] After transfection of the HCS-MSC isolated in Example 1 (experimental group) with NC mimics (control group) and amplified and recovered miR-19b-1-5p respectively, the changes in cell proliferation were observed by electron microscopy.

[0063] The specific experimental operations are as follows: (1) Inoculate cells on the culture plate to make them grow into a monolayer without gaps between cells. At the same time, inoculate cells in a 16-well plate, add culture medium and then culture; (2) Use a pipette tip or other hard objects to draw a line in the center of the cells on the culture plate to remove part of the cells, leaving a scratch with a certain width. The cells in the 16-well plate are not treated otherwise; (3) Take electron microscopy photos at regular intervals to record the changes in the scratch on the culture plate, measure the width of the scratch, and analyze the speed and degree of cell migration. At the same time, electron microscopy photos and records are also made of the proliferation changes of the cells cultured in the 16-well plate.

[0064] The results are as Figure 3 shown. It can be seen that after 12 h, the migration and proliferation abilities of HCS-MSC transfected with miR-19b-1-5p are significantly better than those of the control group. Figure 4 are the numbers of HCS-MSC in the control group and the experimental group after 12 h under the microscope. Figure 5 is the proliferation curve. It can be clearly seen that the proliferation quantity of HCS-MSC transfected with miR-19b-1-5p is significantly better than that of the control group.

[0065] The above results indicate that miR-19b-1-5p significantly promotes the migration and proliferation of human corneal stromal mesenchymal stem cells. That is, human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p have higher in vitro proliferation activity.

[0066] Example 4 miR-19b-1-5p Inhibitor Inhibits the Proliferation Ability of Human Corneal Stromal Mesenchymal Stem Cells

[0067] After transfection of the HCS-MSC isolated in Example 1 (experimental group) with NC inhibitor (control group) and rno-miR-19b-1-5p inhibitor respectively, the changes in cell proliferation were observed by electron microscopy.

[0068] The sequence of the NC inhibitor is as follows: 5'-CCTCGGACCCTGCACTGGAT-3'.

[0069] The sequence of the rno-miR-19b-1-5p inhibitor is as follows: 5'-GCUGGAUGCAAACCUGCAAAAACU-3'.

[0070] The specific experimental operations are as follows: (1) Inoculate cells on a culture plate until they grow into a monolayer with no gaps between cells; (2) Use a pipette tip or other hard object to draw a line in the center of the cells on the culture plate to remove a part of the cells, leaving a scratch of a certain width; (3) Take electron microscope photos at regular intervals to record the changes of the scratch on the culture plate, measure the width of the scratch, and analyze the speed and degree of cell migration.

[0071] The results are as Figure 6 shown. It can be seen that after 12 h, the migration and proliferation abilities of HCS-MSCs transfected with rno-miR-19b-1-5p inhibitor were significantly inferior to those of the control group, indicating that the miR-19b-1-5p inhibitor significantly inhibited the migration and proliferation of human corneal stromal mesenchymal stem cells.

[0072] Example 5 Co-incubation of human corneal stromal mesenchymal stem cells transfected with miR-19b-1-5p and cardiac fibroblasts

[0073] Isolation and culture of adult mouse cardiac fibroblasts: Decapitate male C57 / BL6 mice at about 8 weeks of age, quickly soak them in 75% alcohol for about half a minute, immediately open the chest to remove the heart in a laminar flow hood, place it in PBS buffer at 4 °C and wash twice, cut off the blood vessels of the atrium and the bottom of the heart, then cut the ventricle into small pieces, wash once with PBS to remove residual blood. Add 0.1% type II collagenase (330 U, Worthington, Columbia, NJ, USA / Sigma, St. Louis, MO, USA) prepared with PBS balanced salt solution for digestion. The whole digestion process is carried out under constant stirring at 36-37 °C. After every 8 minutes of digestion, take the supernatant digestion solution and add it to an equal volume of DMEM culture medium containing 10% FBS, and mix well. Repeat this process about 7-8 times until the tissue blocks are completely digested. Centrifuge the collected tubes of cells at 1000 rpm for 5 minutes at room temperature, discard the supernatant, resuspend the cells with DMEM culture medium containing 10% FBS, combine the myocardial cell suspensions obtained each time, inoculate them in a culture dish with a diameter of 100 mm, and place them in an incubator at 37 °C and 5% CO2 for 2 hours to allow the fibroblasts to adhere basically. Aspirate the culture medium in the culture dish, add fresh DMEM culture medium containing 10% FBS and continue to culture. After 3 days, the cells grow confluently, passage and carry out subsequent experiments.

[0074] The passage 3 cardiac fibroblasts were transferred into a 6-well plate and cultured overnight at 37 °C in an environment of 5% carbon dioxide to ensure the spreading of the fibroblast morphology. Early in the morning of the same day, the experiment was carried out. The cardiac fibroblasts in the 6-well plate were gently washed with pre-warmed PBS at 37 °C, and the washing was repeated three times to ensure the complete removal of the culture medium. Then, the HCS-MSC-miR-19b-1-5p obtained in Example 3 was added to each well as the experimental group, so that the number ratio of cardiac fibroblasts to HCS-MSC-miR-19b-1-5p in the added mixed system was 1:1. The control group was added with the same number of human corneal mesenchymal stem cells not transfected with miR-19b-1-5p. The mixed fibroblast and HCS-MSC-miR-19b-1-5p system was cultured in DMEM medium containing 10% fetal bovine serum for 3 days, and the control group was cultured in DMEM medium containing 10% fetal bovine serum for 3 days according to the same operation.

[0075] Western blot experiment: After electrophoresis with a 10% SDS-PAGE gel, the membrane was transferred to a nitrocellulose membrane, blocked with 5% skimmed milk at room temperature for 1 hour, and incubated with primary antibodies overnight at 4 °C in a cold room. The primary antibodies were TGFβ (10804-MM33, Sinobiological, Beijing, China), PAX6 (ab5790, abcam, Cambridge, MA, USA), and GAPDH (2118S, CST). After washing the membrane three times with TBST, the corresponding secondary antibody of the same species was replaced and incubated at room temperature for 1 hour. After washing the membrane with TBST again, the membrane was developed. The membrane was placed in the developing solution (Millipore Corporation), and then dried and exposed in a luminescence detection machine.

[0076] The results showed that the mRNA level of PAX6 in cardiac fibroblasts co-incubated with the human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p according to the present invention was significantly increased, and the mRNA level of TGFβ was significantly decreased ( Figure 7 ).

[0077] It is known in the prior art that PAX6 can be used as a target for treating cardiac fibrosis. After constructing human corneal stromal mesenchymal stem cells overexpressing miR-19b-1-5p, the present invention found that co-incubating them with cardiac fibroblasts can significantly affect the expression of PAX6 in cardiac fibroblasts. Specifically, the mRNA level of PAX6 in cardiac fibroblasts co-incubated with the human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p of the present invention is significantly increased, and the mRNA level of TGFβ is significantly decreased. It can be seen that human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p can inhibit the fibrosis process of cardiac fibroblasts in vitro, so it is expected to use human corneal stromal mesenchymal stem cells with high expression of miR-19b-1-5p as a beneficial tool for delaying the fibrosis of cardiac fibroblasts in vitro, and also lay a foundation for exploring stem cell therapy for treating cardiac fibrosis in the future.

[0078] Examples 3 and 4 fully illustrate the role of miR-19b-1-5p in human corneal stromal mesenchymal stem cells. Increasing the expression level of miR-19b-1-5p can effectively promote the in vitro proliferation of human corneal stromal mesenchymal stem cells.

[0079] Example 5 shows that corneal stromal mesenchymal stem cells with increased expression level of miR-19b-1-5p play an important role in inhibiting the fibrosis process of cardiac fibroblasts in vitro.

[0080] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of miR-19b-1-5p mimics or its promoters in the preparation of a preparation for promoting the proliferation and / or migration of human corneal stromal mesenchymal stem cells in vitro, characterized in that, The sequence of the miR-19b-1-5p is: AGUUUUGCAGGUUUGCAUCCAGC.

2. Use of miR-19b-1-5p inhibitor in the preparation of a preparation for inhibiting the proliferation and / or migration of human corneal stromal mesenchymal stem cells in vitro, characterized in that, The sequence of the miR-19b-1-5p inhibitor is: GCUGGAUGCAAACCUGCAAAAACU.

3. Use of a method for increasing the expression level of miR-19b-1-5p in promoting the in vitro proliferation of human corneal stromal mesenchymal stem cells.

4. The application according to claim 3, characterized in that It is by means of genetic engineering to transfect miR-19b-1-5p into human corneal stromal mesenchymal stem cells, and the sequence of the miR-19b-1-5p is AGUUUUGCAGGUUUGCAUCCAGC.

5. Use of a method for increasing the expression level of miR-19b-1-5p in screening culture medium additives for the in vitro proliferation of human corneal stromal mesenchymal stem cells.

6. Use of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in the preparation of a drug for inhibiting the fibrosis of cardiac fibroblasts.

7. Use of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in increasing the expression level of PAX6 in cardiac fibroblasts for non-disease diagnosis and treatment purposes.

8. Use of a method for increasing the expression level of miR-19b-1-5p in human corneal stromal mesenchymal stem cells in decreasing the expression level of TGFβ in cardiac fibroblasts for non-disease diagnosis and treatment purposes.

9. The application according to claim 6 or 7, or 8, characterized in that, The said use is to co-incubate human corneal stromal mesenchymal stem cells with increased expression of miR-19b-1-5p and cardiac fibroblasts.

Images