DsRNA of hyphantria cunea detoxification metabolism genes CYP6B2 and CYP4G15 and application of dsRNA and terpin-4-ol in prevention and treatment of hyphantria cunea

Abstract

The invention relates to the technical field of pest control, in particular to dsRNA of hyphantria cunea detoxification metabolism genes CYP6B2 and CYP4G15 and application of the dsRNA and terpine-4-ol in control of hyphantria cunea. The dsRNA of the hyphantria cunea detoxification metabolism gene CYP6B2 is obtained by synthesizing a nucleotide sequence as shown in SEQ ID No.1 and a reverse complementary sequence; the dsRNA of the hyphantria cunea detoxification metabolism gene CYP4G15 is synthesized from a nucleotide sequence as shown in SEQ ID No.3 and a reverse complementary sequence as shown in SEQ ID No.3. By adopting the dsRNA provided by the invention, the sensitivity of the fall webworm to terpin-4-ol can be improved, and meanwhile, the death rate of the fall webworm can be remarkably improved after the dsRNA is combined with terpin-4-ol. Meanwhile, the technical bottleneck that a botanical insecticide has a poor lethal effect on the fall webworm can be solved, and a new thought and strategy are provided for green and efficient prevention and treatment of the fall webworm.

Description

Technical Field

[0001] The present invention relates to the technical field of pest control, in particular to dsRNAs of the detoxification and metabolism genes CYP6B2 and CYP4G15 of the fall webworm, Hyphantria cunea, and their application in combination with terpineol-4-ol in controlling the fall webworm, Hyphantria cunea. Background Art

[0002] The fall webworm, Hyphantria cunea (Drury), is native to North America and Mexico, but has now spread to most parts of Europe and Asia. There are various control methods for the fall webworm, including chemical methods, biological methods, utilization of natural enemies, sex pheromones, etc. In practice, the currently used chemical pesticides for controlling the fall webworm are the most effective methods. However, as is well known, the overuse of chemical pesticides has an extremely significant negative impact on the environment. It must be admitted that a large amount of chemically synthesized pesticides are released into the environment while controlling the fall webworm. Therefore, it is crucial to explore environmentally friendly pesticides for controlling the fall webworm.

[0003] The screening and application of plant-derived insecticides is an effective way to achieve the reduction of pesticide use. Some studies have found that plant secondary metabolites such as plant essential oil components like salicylaldehyde and limonene have good lethal effects on the fall webworm and have certain application potential as plant-derived pesticides for the fall webworm. However, there is still a large gap between the lethal dose of plant secondary metabolites to the fall webworm and that of chemical pesticides. For example, the LD50 of salicylaldehyde to the fall webworm is 20.4 μg / mg, and the lethal concentration of cytisine to the fall webworm is 25 g / L. At present, the screening of plant-derived compounds with lethal effects on the fall webworm is mainly based on the host plants of the fall webworm, ignoring the non-host plants of the fall webworm - Pinaceae plants. The most abundant secondary metabolites in Pinaceae plants are terpene compounds, which are defense compounds of Pinaceae plants and have good toxic and lethal effects on a variety of insects. The author screened a terpene compound - terpineol-4-ol with lethal effect on the fall webworm from Pinaceae plants in previous work, and its LD50 to the larvae of the fall webworm is 2.68 μg / mg, and its toxicity far exceeds that of currently reported compounds such as salicylaldehyde and cytisine. However, the lethal effect of this plant secondary metabolite on the fall webworm still has a certain gap with that of chemical pesticides, which is also a common problem faced by most plant-derived insecticides.

[0004] In recent years, the research on RNA interference (RNAi) in controlling the fall webworm has developed rapidly, which is a key technology for developing dsRNA drugs. The fall webworm mainly relies on the P450 gene family when detoxifying plant secondary metabolites. Using RNAi technology to interfere with the expression of related metabolic detoxification genes in insects will increase their sensitivity to plant secondary metabolites, resulting in an increase in mortality, thereby achieving the purpose of pest control. Summary of the Invention

[0005] To address these issues, the present invention provides dsRNA targeting the detoxification metabolic genes CYP6B2 and CYP4G15 of the cuneiform moth, and their use in combination with terpine-4-ol for controlling the cuneiform moth. The dsRNA provided by the present invention can increase the cuneiform moth's sensitivity to terpine-4-ol and, when combined with terpine-4-ol, significantly reduce the cuneiform moth's mortality rate. Furthermore, the present invention addresses the technical bottleneck of botanical insecticides' poor lethality against the cuneiform moth, providing new ideas and strategies for environmentally friendly and efficient control of the cuneiform moth.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a dsRNA of the HYP6B2 or CYP4G15 detoxification metabolic gene of the cunea, wherein the dsRNA of the HYP6B2 detoxification metabolic gene of the cunea is synthesized from the nucleotide sequence shown in SEQ ID No. 1 and the reverse complementary sequence shown in SEQ ID No. 2;

[0008] The dsRNA of the HYP4G15 detoxification metabolism gene of the cunea is synthesized from the nucleotide sequence shown in SEQ ID No. 3 and the reverse complementary sequence shown in SEQ ID No. 4.

[0009] Preferably, the nucleotide sequence of the upstream primer used to amplify the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2 is shown as SEQ ID No. 5, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 6.

[0010] Preferably, the system used to amplify the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2 is: PCR SuperMix 25 μl, 10 μM upstream and downstream primers 2 μl each, cDNA 2 μl, ddH2O to 50 μl;

[0011] The program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; and extension at 72°C for 8 min.

[0012] Preferably, the nucleotide sequence of the upstream primer used to amplify the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4 is shown in SEQ ID No. 7, and the nucleotide sequence of the downstream primer is shown in SEQ ID No. 8.

[0013] Preferably, the system used for amplifying the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4 is as follows: 25 μl of PCR SuperMix, 2 μl each of the upstream and downstream primers with a concentration of 10 μM, 2 μl of cDNA, and supplemented with ddH2O to 50 μl;

[0014] The procedure is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for 36 cycles; extension at 72°C for 8 min.

[0015] The present invention also provides the application of the dsRNA described in the above technical solution in the preparation of a reagent for silencing the detoxification metabolism genes CYP6B2 or CYP4G15 of Hyphantria cunea.

[0016] The present invention also provides the application of the dsRNA described in the above technical solution in combination with terpin-4-ol in the preparation of an insecticide for controlling Hyphantria cunea.

[0017] Preferably, when the dsRNA is injected into Hyphantria cunea, the dosage of the dsRNA is 3 μg / head;

[0018] The dosage of the terpin-4-ol is 15 μg / head, and the terpin-4-ol is applied by topical application to Hyphantria cunea.

[0019] Preferably, when the dsRNA is sprayed on Hyphantria cunea, the spraying concentration of the dsRNA is 1 μg / μl;

[0020] The dosage of the terpin-4-ol is 15 μg / head, and the terpin-4-ol is applied by topical application to Hyphantria cunea.

[0021] The present invention also provides an insecticide for controlling Hyphantria cunea, comprising the dsRNA and terpin-4-ol described in the above technical solution.

[0022] By using transcriptome technology to analyze the response of Hyphantria cunea larvae to terpin-4-ol, it was found that 2 key genes showed strong responses to terpin-4-ol, namely CYP6B2 and CYP4G15 from the P450 gene. Therefore, exploring the RNAi technology for silencing the detoxification ability of Hyphantria cunea and its combined use with plant secondary metabolites to control Hyphantria cunea can provide new strategies for the efficient prevention and control and green management of plant-derived insecticides against Hyphantria cunea.

[0023] Advantages of the present invention:

[0024] (1) The dsRNA prepared by the present invention can efficiently silence the detoxification metabolism genes of Hyphantria cunea to terpin-4-ol;

[0025] (2) The two dsRNAs prepared by the present invention can significantly increase the sensitivity of Hyphantria cunea to terpin-4-ol, and the present invention provides a new and effective way to control the larvae of Hyphantria cunea;

[0026] (3) The present invention provides a theoretical basis for understanding the interaction between Hyphantria cunea and non-host plant volatiles and creating new green pest control technologies. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0028] Figure 1 Electrophoresis diagram of dsRNAs of two detoxification and metabolism P450 genes of Hyphantria cunea;

[0029] Figure 2 Expression of CYP6B2 and CYP4G15 in larvae of Hyphantria cunea after injection of dsRNA;

[0030] Figure 3 Expression of CYP6B2 and CYP4G15 in larvae of Hyphantria cunea after spraying dsRNA;

[0031] Figure 4 Evaluation of the lethal effect of the combination of injection of two dsRNAs and terpin-4-ol on Hyphantria cunea;

[0032] Figure 5 Evaluation of the lethal effect of the combination of spraying two dsRNAs and terpin-4-ol on Hyphantria cunea. DETAILED DESCRIPTION OF THE INVENTION

[0033] The present invention provides a dsRNA of a detoxification and metabolism gene CYP6B2 or CYP4G15 of Hyphantria cunea, characterized in that the dsRNA of the detoxification and metabolism gene CYP6B2 of Hyphantria cunea is synthesized from the nucleotide sequence shown in SEQ ID No.1 and the reverse complementary sequence shown in SEQ ID No.2; the dsRNA of the detoxification and metabolism gene CYP4G15 of Hyphantria cunea is synthesized from the nucleotide sequence shown in SEQ ID No.3 and the reverse complementary sequence shown in SEQ ID No.4. In the present invention, the synthesis of the dsRNA preferably uses a dsRNA synthesis kit, preferably including the MEGAscript RNAi Kit. The present invention has no special limitation on the source of the MEGAscript RNAi Kit, and commercially available products well-known to those skilled in the art can be used.

[0034] SEQ ID No.1:

[0035] GCCCCTTTCTTTGGCGCTTTCTACGGCACGGAACCCGCCTTGGTCGTTCAAGATCCTGAAATCATTAAGTTAATTATGACAAAAGATTATAATTTCTTTGGTGGTCGTGAAGTTCTTAAATATGCCGATAGAGAACTGCTAACCCAGAACCTCTTCTTCTCTTACGGCGACAAATGGAAGATTTTCCGCAAAAATCTCTCTCCGTTATTCTCTACAGCCAAGATGAAGAATATGTACTATCTGATTGCGAATCATTCTCGAATATTTGAACAAATACTTGATCACGAAACGAAAACATCTGATGTGATCGATGTCAAAGCTATTATGTCAAGATATACAATGGACTGTATTTCTTCTTGTGCTTTTGGTGTCGATCCACAGGTGTTAGCGA;

[0036] SEQ ID No.2:

[0037] TCGCTAACACCTGTGGATCGACACCAAAAGCACAAGAAGAAATACAGTCCATTGTATATCTTGACATAATAGCTTTGACATCGATCACATCAGATGTTTTCGTTTCGTGATCAAGTATTTGTTCAAATATTCGAGAATGATTCGCAATCAGATAGTACATATTCTTCATCTTGGCTGTAGAGAATAACGGAGAGAGATTTTTGCGGAAAATCTTCCATTTGTCGCCGTAAGAGAAGAAGAGGTTCTGGGTTAGCAGTTCTCTATCGGCATATTTAAGAACTTCACGACCACCAAAGAAATTATAATCTTTTGTCATAATTAACTTAATGATTTCAGGATCTTGAACGACCAAGGCGGGTTCCGTGCCGTAGAAAGCGCCAAAGAAAGGGGC。

[0038] SEQ ID No.3:

[0039] AGGGTCACGATACTACGGCAGCTGGCTCTAGCTTTGTGCTTTGTCTACTGGGAATCTATCACGACATCCAAGACAAAGTTTATAATGAGTTATATAACATCTTCGGCGACTCCGACAGGCCCGTCAACTTTGCTGATACGTTGGAGATGAAATACCTCGAAAGAGTTATACTTGAGACTTTAAGATTGTACCCCCCAGTACCAATTATTGCTAGGAACCTAAACAGTGACGTCAAAATCGAAACCAATGACTACGTTCTTCCTAAGGGAACAACAGTAGTGATTGCCACGTATGCACTCCATCGCAGTCCCAAATACTACAAAAATCCTGACACTTTCGATCCTGATAATTTCCTGCCCGAGAATGCGTCAAGCAGACATTACTATAGCTATGTTCCATTCAGTGCTGGACC。

[0040] SEQ ID No.4:

[0041] GTCCAGCACTGAATGGAACATAGCTATAGTAATGTCTGCTTGAGCATTCTCGGGCAGGAAATTATCAGGATCGAAAGTGTCAGGATTTTTGTAGTATTTGGGACTGCGATGGAGTGCATACGTGGCAATCACTACTGTTGTTCCCTTAGGAAGAACGTAGTCATTGGTTTCGATTTTGACGTCACTGTTTAGGTTCCTAGCAATAATTGGTACTGGGGGGTACAATCTTAAAGTCTCAAGTATAACTCTTTCGAGGTATTTCATCTCCAACGTATCAGCAAAGTTGACGGGCCTGTCGGAGTCGCCGAAGATGTTATATAACTCATTATAAACTTTGTCTTGGATGTCGTGATAGATTCCCAGTAGACAAAGCACAAAGCTAGAGCCAGCTGCCGTAGTATCGTGACCCT。

[0042] In the present invention, the nucleotide sequence of the upstream primer used for amplifying the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 is as shown in SEQ ID No.5, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.6.

[0043] SEQ ID No.5:

[0044] TAATACGACTCACTATAGGGGCCCCTTTCTTTGGCGCTTTC. The underlined part is the T7 promoter sequence;

[0045] SEQ ID No.6:

[0046] TAATACGACTCACTATAGGG TCGCTAACACCTGTGGATCG. The underlined part is the T7 promoter sequence.

[0047] In the present invention, the preferred system for amplifying the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 is as follows: 25 μl of PCR SuperMix, 2 μl each of the upstream and downstream primers with a concentration of 10 μM, 2 μl of cDNA, and supplemented with ddH2O to 50 μl. In the present invention, the preferred program for amplifying the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 is as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, extension at 72 °C for 30 s, for 36 cycles; extension at 72 °C for 8 min.

[0048] In the present invention, the nucleotide sequence of the upstream primer used for amplifying the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 is as shown in SEQ ID No.7, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.8.

[0049] SEQ ID No.7:

[0050] TAATACGACTCACTATAGGG AGGGTCACGATACTACGGCA. The underlined part is the T7 promoter sequence.

[0051] SEQ ID No.8:

[0052] TAATACGACTCACTATAGGGG GTCCAGCACTGAATGGAACA. The underlined part is the T7 promoter sequence.

[0053] In the present invention, the preferred system for amplifying the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 is as follows: 25 μL of PCR SuperMix, 2 μL each of the forward and reverse primers at a concentration of 10 μM, 2 μL of cDNA, and supplemented with ddH2O to 50 μL. In the present invention, the program preferably used for amplifying the nucleotide sequences shown in SEQ ID No. 3 and SEQ ID No. 4 is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, for 36 cycles; extension at 72°C for 8 min.

[0054] The present invention also provides the use of the dsRNA described in the above technical solution in the preparation of a reagent for silencing the detoxification metabolism genes CYP6B2 or CYP4G15 of Hyphantria cunea.

[0055] The present invention also provides the use of the dsRNA described in the above technical solution in combination with terpineol-4-ol in the preparation of an insecticide for controlling Hyphantria cunea. In the present invention, when the dsRNA is preferably injected into Hyphantria cunea, the dosage of the dsRNA is 3 μg / head; the dosage of terpineol-4-ol is 15 μg / head, and terpineol-4-ol is applied by topical application to Hyphantria cunea. In the present invention, when the dsRNA is preferably sprayed on Hyphantria cunea, the spraying concentration of the dsRNA is 1 μg / μL; the dosage of terpineol-4-ol is 15 μg / head, and terpineol-4-ol is applied by topical application to Hyphantria cunea.

[0056] The present invention also provides an insecticide for controlling Hyphantria cunea, comprising the dsRNA and terpineol-4-ol described in the above technical solution.

[0057] In order to further illustrate the present invention, the present invention will be described in detail below with reference to examples, but they should not be construed as limiting the protection scope of the present invention.

[0058] Example 1

[0059] Synthesis of dsRNA of the P450 gene for detoxifying and metabolizing terpineol-4-ol in Hyphantria cunea

[0060] (1) RNA extraction

[0061] (a) Select Hyphantria cunea larvae with the same age, size, and treatment time, and select 3 biological replicates for subsequent operations after rapid freezing in liquid nitrogen: Mix the samples of each biological replicate into a group, grind them in a high-throughput sample grinder until they become powder, then use a spatula to transfer the samples into a 1.5 ml RNase-free centrifuge tube, and grind them again using an electric grinder.

[0062] (b) Add 1 ml of Trizol to the 1.5 ml RNase-free centrifuge tube and place it on ice, and use an electric grinder to grind the samples into a homogenate.

[0063] (c) Add 200 μL of chloroform to the centrifuge tube, shake for 15 s, let it stand at room temperature for 5 min, and then centrifuge at 12,000 rpm for 15 min in a 4 °C centrifuge.

[0064] (d) Transfer 400 μL of the supernatant after centrifugation, add 400 μL of pre-cooled isopropanol, mix well and transfer it to a -20 °C refrigerator for precipitation for 30 min, and then centrifuge at 12,000 rpm for 10 min in a 4 °C centrifuge.

[0065] (e) After centrifugation, discard the supernatant, add 1 mL of 75% ethanol, centrifuge at 7,500 rpm for 5 min in a 4 °C centrifuge, and then discard the supernatant. Repeat this twice.

[0066] (f) Use a pipette to suck out the solvent above the RNA precipitate, then place it in a laminar flow hood and dry it at room temperature for 2 - 5 min, and add 20 μL of DEPC H20 to dissolve the RNA precipitate.

[0067] (g) Carry out strictly according to the requirements of the experimental manual. For the total RNA sample obtained by extraction, measure the absorbance under a spectrophotometer, record the concentration, and use 1% agar gel electrophoresis to detect the quality of the total RNA ( Figure 1 ), and finally store it at -80 °C for later use.

[0068] (2) Reverse transcription to synthesize cDNA

[0069] (a) Removal of genomic DNA: Prepare in a RNase-free centrifuge tube as shown in Table 1:

[0070] Table 1 The first step of transcription

[0071] Reagent name Reagent volume (μL) Reagent name Reagent volume <![CDATA[DEPC H20]]> to5 <![CDATA[GoScript TM Reaction Buffer]]> 1 Template RNA Total RNA: 1 μg Total volume 5

[0072] After the above reaction system is prepared, gently pipette and mix well, and then react at 70 °C for 5 min.

[0073] (b) Prepare the reverse transcription reaction system: Add 5×HiScript III qRTSuperMix to the reaction tube of the first step, as shown in Table 2:

[0074] Table 2 The second step of reverse transcription

[0075]

[0076] (c) Carry out the reverse transcription reaction, and the reaction program is: react at 25 °C for 5 min, extend at 42 °C for 60 min, and end the reaction at 70 °C for 5 min.

[0077] (d) After taking out the PCR product, place it on ice and store it in a -20 °C refrigerator for later use.

[0078] (3) Synthesis of dsRNA

[0079] Based on the two P450 gene sequences of Hyphantria cunea larvae (shown in SEQ ID No.1-4), the designed and synthesized dsRNAs of P450 genes CYP6B2 and CYP4G15 of Hyphantria cunea larvae are primer pair 1 and primer pair 2 respectively. The nucleotide sequence of the upstream primer of primer pair 1 is as shown in SEQ ID No.5, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.6; the nucleotide sequence of the upstream primer of primer pair 2 is as shown in SEQ ID No.7, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.8.

[0080] Using the above cDNA as a template, the lengths of the fragments amplified by primer pairs 1-2 are dsCYP6B2 391bp (shown in SEQ ID No.1 and SEQ ID No.2), and dsCYP4G15 412bp (shown in SEQ ID No.3 and SEQ ID No.4). The dsRNAs of P450 genes of Hyphantria cunea larvae are obtained through an in vitro dsRNA synthesis kit.

[0081] The specific synthesis steps are as follows: Amplify the target band by PCR. The reaction system for PCR amplification is PCR SuperMix(+dye)(TransGen Biotech) 25 μl, 2 μl of each upstream and downstream primer (concentration 10 μM), 2 μl of cDNA, and ddH2O is added to make up to 50 μl;

[0082] When the primer pair is primer pair 1, the reaction program for PCR amplification is: Pre-denaturation at 94°C for 5 min; Denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; Extension at 72°C for 8 min;

[0083] When the primer pair is primer pair 2, the reaction program for PCR amplification is: Pre-denaturation at 94°C for 5 min; Denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; Extension at 72°C for 8 min;

[0084] After the amplified product is confirmed by electrophoresis detection, it is used as a template to synthesize dsRNA (refer to the instruction manual of MEGAscript RNAi Kit). The concentration of dsRNA is detected by a micro-spectrophotometer, and 1 μL of dsRNA is taken for detection by 1% agarose gel electrophoresis. Two kinds of dsRNAs, namely dsCYP6B2 and dsCYP4G15, are obtained and stored at -80°C for later use.

[0085] Example 2

[0086] Evaluation of the silencing effect of dsRNA delivered by injection on the P450 detoxification and metabolism genes of Hyphantria cunea

[0087] Thirty Hyphantria cunea larvae of the same size and in good growth condition were picked for dsRNA injection, and they were evenly divided into 3 groups: the dsCYP6B2 treatment group, the dsCYP4G15 treatment group, and the CK group. The dsCYP6B2 synthesized in Example 1 (dsCYP6B2 group), dsCYP4G15 (dsCYP4G15 treatment group), and dsEGFP (CK group, product number: ZS-DS0001-02, Shanghai Zhisheng Yougu Biotechnology Co., Ltd.) were microinjected into two groups of Hyphantria cunea larvae respectively, with an injection volume of 3 μg / larva. One day and two days later, three well-conditioned Hyphantria cunea larvae were selected from each of the two groups as a biological replicate, and this was repeated 3 times. The relative expression levels of the CYP6B2 gene were detected by real-time fluorescence quantitative PCR (qRT-PCR).

[0088] The method for the above fluorescence quantitative PCR was as follows: Total RNA was extracted using TRIzol (Invitrogen), and after reverse transcription was completed using the GoScript TM Reverse Transcription System kit (Promega), the expression levels of CYP6B2 and CYP4G15 in Hyphantria cunea after injection were detected by real-time fluorescence quantitative PCR (qRT-PCR). The specific method is as follows. The reagents related to fluorescence quantification used the SuperReal PreMix Plus kit (Tiangen) 。

[0089] The primer sequences involved in qRT-PCR were as follows:

[0090] CYP6B2-F: CTCGGTGAACTAAAGCGGGT (SEQ ID No.9); CYP6B2-R: CCCGCTAACGGGATATGTGA (SEQ ID No.10);

[0091] CYP4G15-F: CGCATCTACGCTGTGGATCT (SEQ ID No.11); CYP4G15-R: ACGCTACCGTACTTAGCAGC (SEQ ID No.12);

[0092] The qRT-PCR reaction system is shown in Table 3.

[0093] Table 3 qRT-PCR reaction system

[0094]

[0095] The fluorescence quantitative PCR reaction program is shown in Table 4:

[0096] Table 4 qRT-PCR reaction program

[0097]

[0098] In this example, dual internal reference genes were used for fluorescence quantification. Each time, the geometric mean of the expression levels of two internal reference genes of each tested insect was selected to obtain the standard internal reference gene. Subsequently, the expression levels of the target gene at different time points of different treatments were detected through the standardized internal reference gene. The internal reference genes of Hyphantria cunea were selected as Hyphantria cunea elongation factor 1α (HcEF1-α) and ribosomal protein L12 (HcRPL12). Specific qPCR primers were designed using NCBI and Primer Premier and synthesized by Shanghai Qingke Biotechnology Co., Ltd. After detecting the amplification efficiency (E) of different genes and meeting the requirements, a fluorescence quantitative qPCR experiment was carried out. After the experiment, the calculation was performed according to the following formula (1) (refer to Liu S, Wang M, Li X. Overexpression of Tyrosine hydroxylase and Dopa decarboxylase associated with pupal melanization in Spodoptera exigua[J]. Scientific Reports, 2015, 5(1).).

[0099]

[0100] The expression levels of the P450 gene in Hyphantria cunea larvae injected with dsRNA were as Figure 2 . At 24 h and 48 h after injecting dsRNA, the expression levels of the CYP6B2 gene and CYP4G15 gene in Hyphantria cunea changed. After injecting dsCYP6B2, the expression levels at 24 h and 48 h both decreased, and the difference was relatively significant compared with injecting dsEGFP, indicating that the gene was successfully silenced. After injecting dsCYP4G15, the CYP4G15 gene suddenly increased after 24 h, but decreased significantly after 48 h, also indicating that the gene was successfully interfered.

[0101] Example 3

[0102] Evaluation of the silencing effect of dsRNA delivered by spraying method on P450 detoxification and metabolism genes in Hyphantria cunea

[0103] Thirty Hyphantria cunea larvae of the same size and in good growth condition were selected for dsRNA spraying. They were evenly divided into 3 groups: the dsCYP6B2 treatment group, the dsCYP4G15 treatment group, and the CK group. The dsCYP6B2 synthesized in Example 1 (dsCYP6B2 group), dsCYP4G15 (dsCYP4G15 treatment group), and dsEGFP (CK group, product number: ZS-DS0001-02, Shanghai Zhisheng Yougu Biotechnology Co., Ltd.) were used to spray the test larvae with a micro-sprayer. The concentration of the sprayed dsRNA was 1 μg / μl. One day and two days later, 3 healthy Hyphantria cunea larvae were selected from each of the 2 groups as a biological replicate, and this was repeated 3 times. Real-time fluorescence quantitative PCR (qRT-PCR) was used to detect the relative expression level of the CYP6B2 gene.

[0104] The method for the above fluorescence quantitative PCR was as follows: Total RNA was extracted using TRIzol (Invitrogen), and the first strand of cDNA was synthesized using the GoScript TM Reverse Transcription System kit (Promega). Using this as a template, real-time fluorescence quantitative PCR (qRT-PCR) was used to detect the expression levels of CYP6B2 and CYP4G15 after injection. The specific method is as follows.

[0105] The primer sequences involved in qRT-PCR were as follows:

[0106] CYP6B2-F: CTCGGTGAACTAAAGCGGGT (SEQ ID No.9); CYP6B2-R: CCCGCTAACGGGATATGTGA (SEQ ID No.10);

[0107] CYP4G15-F: CGCATCTACGCTGTGGATCT (SEQ ID No.11); CYP4G15-R: ACGCTACCGTACTTAGCAGC (SEQ ID No.12);

[0108] The qRT-PCR reaction system is shown in Table 5.

[0109] Table 5 qRT-PCR reaction system

[0110]

[0111] The fluorescence quantitative PCR reaction program is shown in Table 6:

[0112] Table 6 qRT-PCR reaction program

[0113]

[0114] In this example, dual internal reference gene fluorescence quantification was used. The geometric mean of the expression levels of two internal reference genes for each tested insect was selected each time for detection to obtain the standard internal reference gene. Subsequently, the expression levels of the target gene at different time points under different treatments were detected through the standardized internal reference gene. The internal reference genes for the fall webworm were the fall webworm elongation factor 1α (HcEF1-α) and ribosomal protein L12 (HcRPL12).

[0115] Specific qPCR primers were designed using NCBI and Primer Premier and synthesized by Shanghai Qingke Biotechnology Co., Ltd. After detecting the amplification efficiency (E) of different genes and meeting the requirements, fluorescence quantitative qPCR experiments were carried out. After the experiments, calculations were performed according to the following formula (1) (the calculation method refers to Liu S, Wang M, Li X. Overexpression of Tyrosine hydroxylase and Dopa decarboxylase associated with pupal melanization in Spodoptera exigua[J]. Scientific Reports, 2015, 5(1)).

[0116]

[0117] The expression levels of two P450 genes in the fall webworm larvae sprayed with dsRNA were as Figure 2 . At 24 h and 48 h after spraying dsRNA, the expression levels of the CYP6B2 gene and CYP4G15 gene in the fall webworm changed. After injecting dsCYP6B2, the expression levels at 24 h and 48 h both decreased, and the difference was relatively significant compared with injecting dsEGFP, indicating that the gene was successfully silenced. Similarly, after spraying dsCYP4G15, the CYP4G15 gene decreased significantly at 24 h and 48 h, also indicating that the gene was successfully interfered with.

[0118] Example 4

[0119] Evaluation of the lethal effect of injecting dsRNA of two P450 genes and terpin-4-ol in combination on the fall webworm. Six treatments were prepared according to the test requirements as follows.

[0120] Treatment 1: CK treatment, which was the dsEGFP injection treatment group;

[0121] Treatment 2: The terpin-4-ol treatment group at the LD30 dose (15 μg / head);

[0122] Treatment 3: Inject dsCYP6B2 (3 μg / head);

[0123] Treatment 4: Inject dsCYP4G15 (3 μg / head);

[0124] Treatment 5: Inject dsCYP6B2 (3 μg / head) and co - treat with LD30 dose (15 μg / head) of terpin - 4 - ol;

[0125] Treatment 6: Inject dsCYP4G15 (3 μg / head) and co - treat with LD30 dose (15 μg / head) of terpin - 4 - ol;

[0126] The specific operations are as follows:

[0127] (1) Select 600 Hyphantria cunea larvae with consistent size and good growth status for dsRNA injection, divide them into 6 groups on average, and inject Hyphantria cunea according to the above treatments and dosage requirements in sequence;

[0128] (2) After injecting dsRNA, feed the insects normally for 12 h, and then use the topical application method to perform topical treatment on the terpin - 4 - ol solution in sequence according to the requirements of each treatment group. Specifically, configure the pure terpin - 4 - ol sample in an aqueous solution containing 1% sodium dodecyl sulfate surfactant, and the terpin - 4 - ol solution for topical treatment can be obtained after sufficient oscillation.

[0129] (3) After the above treatments are completed, raise the treated Hyphantria cunea larvae individually, provide artificial feed, and check the mortality of Hyphantria cunea under each treatment after 48 h.

[0130] From the analysis of the mortality of Hyphantria cunea (as Figure 4 ) it can be seen that treatment 1 (injecting dsEGFP) has basically no lethal effect on Hyphantria cunea; after treating Hyphantria cunea with treatment 2 (LD30 dose of terpin - 4 - ol) by topical application, it caused a 37% mortality within 48 h; treatment 3 (injecting dsCYP6B2) and treatment 4 (dsCYP4G15) have almost no lethal effect on Hyphantria cunea, indicating that the death of Hyphantria cunea cannot be caused after the two detoxification and metabolism genes are interfered; treatment 5 (injecting dsCYP6B2 and co - treating with LD30 dose of terpin - 4 - ol) caused the mortality of Hyphantria cunea to reach 87% within 48 h; treatment 6 (injecting dsCYP4G15 and co - treating with LD30 dose of terpin - 4 - ol) caused the mortality of Hyphantria cunea to reach 85% within 48 h. Therefore, the dsCYP6B2 and dsCYP4G15 provided by the present invention can improve the sensitivity of Hyphantria cunea larvae to terpin - 4 - ol through injection, and can increase the mortality of Hyphantria cunea by combining with terpin - 4 - ol.

[0131] Example 5

[0132] Evaluation of the lethal effect of the combination of dsRNA of two P450 genes and terpineol-4 on Hyphantria cunea. According to the test requirements, the following 6 treatments were prepared.

[0133] Treatment 1: CK treatment, which is the treatment group sprayed with dsEGFP (1 μg / μl);

[0134] Treatment 2: The treatment group with terpineol-4 at the LD30 dose (15 μg / head);

[0135] Treatment 3: Spray dsCYP6B2 (1 μg / μl);

[0136] Treatment 4: Spray dsCYP4G15 (1 μg / μl);

[0137] Treatment 5: The combined treatment of spraying dsCYP6B2 (1 μg / μl) and terpineol-4 at the LD30 dose (15 μg / head);

[0138] Treatment 6: The combined treatment of spraying dsCYP4G15 (1 μg / μl) and terpineol-4 at the LD30 dose (15 μg / head);

[0139] The specific operations are as follows:

[0140] (1) Select 600 Hyphantria cunea larvae with consistent size and good growth status for dsRNA spraying. Divide them into 6 groups on average, and successively spray Hyphantria cunea according to the above treatment and dosage requirements using a microsprayer;

[0141] (2) After spraying dsRNA, feed the insects normally for 12 h, and then use the drop method to successively perform drop treatments on terpineol-4 according to the requirements of each treatment group. Specifically, configure the pure sample of terpineol-4 in an aqueous solution containing 1% sodium dodecyl sulfate surfactant, and the terpineol-4 solution for drop treatment can be obtained after sufficient shaking.

[0142] (3) After the above treatments are completed, raise the treated Hyphantria cunea larvae individually, provide artificial feed, and check the mortality of Hyphantria cunea under each treatment after 48 h.

[0143] Analysis of the mortality of Hyphantria cunea (such as Figure 5)It can be seen that treatment 1 (spraying dsEGFP) had basically no lethal effect on Hyphantria cunea; after treatment 2 (terpinen-4-ol at LD30 dose) was topically applied to Hyphantria cunea, it caused a mortality rate of 33% within 48 h; treatment 3 (spraying dsCYP6B2) and treatment 4 (dsCYP4G15) had little lethal effect on Hyphantria cunea, indicating that the death of Hyphantria cunea could not be caused after the two detoxification and metabolism genes were interfered; treatment 5 (combined treatment of spraying dsCYP6B2 and terpinen-4-ol at LD30 dose) resulted in a mortality rate of 67% of Hyphantria cunea within 48 h; treatment 6 (combined treatment of spraying dsCYP4G15 and terpinen-4-ol at LD30 dose) led to a mortality rate of 75% of Hyphantria cunea within 48 h. Therefore, dsCYP6B2 and dsCYP4G15 provided by the present invention can improve the sensitivity of Hyphantria cunea larvae to terpinen-4-ol through spraying, and can increase the mortality rate of Hyphantria cunea by combining with terpinen-4-ol.

[0144] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments according to this embodiment without creative work, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A dsRNA of the detoxification and metabolism gene CYP6B2 or CYP4G15 of Hyphantria cunea, characterized in that, The dsRNA of the detoxification and metabolism gene CYP6B2 of the fall webworm is synthesized from the nucleotide sequence shown in SEQ ID No.1 and the reverse complementary sequence shown in SEQ ID No.2; The dsRNA of the detoxification and metabolism gene CYP4G15 of the fall webworm is synthesized from the nucleotide sequence shown in SEQ ID No.3 and the reverse complementary sequence shown in SEQ ID No.

4.

2. The dsRNA according to claim 1, wherein The nucleotide sequence of the upstream primer used for amplifying the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 is as shown in SEQ ID No.5, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.

6.

3. The dsRNA according to claim 2, wherein The system used for amplifying the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 is as follows: 25 μl of PCR SuperMix, 2 μl each of the upstream and downstream primers with a concentration of 10 μM, 2 μl of cDNA, and supplemented with ddH2O to 50 μl; The procedure is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; extension at 72°C for 8 min.

4. The dsRNA according to claim 1, wherein The nucleotide sequence of the upstream primer used for amplifying the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 is as shown in SEQ ID No.7, and the nucleotide sequence of the downstream primer is as shown in SEQ ID No.

8.

5. The dsRNA according to claim 1, wherein The reaction system for amplifying the nucleotide sequences shown in SEQ ID No.3 and SEQ ID No.4 is as follows: 25 μl of PCR SuperMix, 2 μl each of the upstream and downstream primers with a concentration of 10 μM, 2 μl of cDNA, and made up to 50 μl with ddH2O; The procedure is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; extension at 72°C for 8 min.

6. Use of the dsRNA according to any one of claims 1 to 5 in the preparation of a reagent for silencing the detoxification and metabolism gene CYP6B2 or CYP4G15 of the fall webworm.

7. Use of the dsRNA according to any one of claims 1 to 5 in combination with terpin-4-ol in the preparation of an insecticide for controlling the fall webworm.

8. The application according to claim 7, characterized in that, When the dsRNA is injected into the fall webworm, the dosage of the dsRNA is 3 μg / head; The dosage of the terpin-4-ol is 15 μg / head, and the terpin-4-ol is topically applied to the fall webworm.

9. The application according to claim 7, wherein When the dsRNA is sprayed on the fall webworm, the spraying concentration of the dsRNA is 1 μg / μl; The dosage of the terpin-4-ol is 15 μg / head, and the terpin-4-ol is topically applied to the fall webworm.

10. An insecticide for controlling Hyphantria cunea, characterized in that, Comprising the dsRNA according to any one of claims 1 to 5 and terpin-4-ol.

Images