InDel molecular marker related to wheat yield traits and application of InDel molecular marker
By developing InDel 509 markers and their primer pairs closely linked to the wheat TaPRR95 gene, the problem of slow wheat breeding process in the prior art was solved, efficient screening and identification of high-yield wheat materials was achieved, and breeding selection efficiency was improved.
Patent Information
- Application Number
- CN202510572355.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-06
- Publication Date
- 2025-07-29
AI Technical Summary
The lack of InDel marker closely linked to the wheat TaPRR95 gene in the prior art leads to slow wheat breeding process and low selection efficiency, making it difficult to effectively screen high-yield wheat materials.
A InDel molecular marker InDel 509, which is closely linked to the wheat TaPRR95 gene, was developed, and corresponding primer pairs InDel 509-F and InDel 509-R were designed. High yields of Hap Type II wheat materials were screened through PCR amplification and polyacrylamide gel electrophoresis detection.
It realizes efficient screening and identification of high-yield wheat, improves breeding selection efficiency, provides effective labeling resources, and can operate easily and conveniently under different environmental conditions.
Smart Images

Figure CN120384150A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular genetics, and particularly relates to an InDel molecular marker related to wheat yield traits and its application. Background Art
[0002] As one of the most important food crops in the world, the stability of wheat yield and the excellence of its quality have always been the focus of agricultural scientific research. In recent years, with the development of molecular biology, genetic engineering has been increasingly widely applied in wheat genetic breeding.
[0003] The TaPRR95 gene is a plant-specific Pseudo-Response Regulator (PRR) gene and belongs to a key component in the biological clock regulatory network. The expression of this gene is regulated by the biological clock and is involved in regulating the growth and development processes of plants, including important agronomic traits such as plant height and heading date. Research shows that the expression level of the TaPRR95 gene is closely related to the plant height of wheat. Therefore, using modern biotechnology means to precisely edit and verify the function of the TaPRR95 gene can provide useful information for high-yield and high-quality wheat breeding.
[0004] Molecular markers have the advantages of large quantity, simplicity, rapidity, and being unaffected by environmental conditions. At the same time, they can provide rich and complete genetic information and are widely used in germplasm resource identification, QTL mapping, and molecular marker-assisted selection. Insertion Deletion (InDel) markers are a commonly used type of molecular marker based on DNA level differences. It refers to the differences between two samples, that is, relative to one sample, the other sample has specific numbers of nucleotide insertions or deletions at certain genomic loci. Specific PCR primers are designed based on these insertion and deletion sites to amplify these sites. Using InDel markers tightly linked to the target gene can accelerate the breeding process and effectively improve the selection efficiency. However, there has been no report on InDel markers related to wheat yield traits that are tightly linked to the TaPRR95 gene. Summary of the Invention
[0005] Aiming at the above-mentioned existing technologies, the purpose of the present invention is to provide an InDel molecular marker related to wheat yield traits and its application.
[0006] To achieve the above purpose, the present invention adopts the following technical solutions:
[0007] In a first aspect of the present invention, there is provided an InDel molecular marker related to wheat yield traits, and the InDel molecular marker is molecular marker InDel 509; the nucleotide sequence of the molecular marker InDel 509 is as shown in SEQ ID No.1. Specifically as follows:
[0008] 5’-TTGAACAACTCT-3’. (SEQ ID No.1)
[0009] In a second aspect of the present invention, there is provided the application of the above InDel molecular marker in at least one of the following (1)-(3):
[0010] (1) Early screening or identification of wheat traits;
[0011] (2) Screening or breeding of high-yield wheat individual plants, lines, strains or varieties;
[0012] (3) Wheat molecular marker-assisted breeding.
[0013] In a third aspect of the present invention, there is provided a primer pair for amplifying the above InDel molecular marker, and the nucleotide sequences of the primer pair are as shown in SEQ ID No.2 and SEQ ID No.3 respectively; specifically as follows:
[0014] InDel 509-F: 5’-CTTCATCGCAGCAGAATGATCTGG-3’; (SEQ ID No.2)
[0015] InDel 509-R: 5’-ATGCGTTACACTGTTCAGTAGGA-3’. (SEQ ID No.3)
[0016] In a fourth aspect of the present invention, there is provided a kit containing the above primer pair.
[0017] Furthermore, the kit further includes: DNA template, Taq Master Mix and ddH2O.
[0018] In a fifth aspect of the present invention, there is provided the application of the above primer pair or kit in at least one of the following (1)-(3):
[0019] (1) Early screening or identification of wheat traits;
[0020] (2) Screening or breeding of high-yield wheat individual plants, lines, strains or varieties;
[0021] (3) Wheat molecular marker-assisted breeding.
[0022] In a sixth aspect of the present invention, there is provided a method for identifying wheat yield traits, including the following steps:
[0023] The genomic DNA of the wheat to be tested was used as a template, PCR amplification was performed using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3, the amplified products were analyzed by gel electrophoresis, and the yield trait of the wheat was identified according to the size of the electrophoretic band of the amplified product; the yield of the wheat with an electrophoretic band of 273 bp of the amplified product was higher than that of the wheat with an electrophoretic band of 285 bp of the amplified product.
[0024] Preferably, the reaction system for PCR amplification is: 1 μL of DNA template, 5 μL of 2×Taq Master Mix, 0.7 μL each of primers InDel 509-F and InDel 509-R at a concentration of 10 μmol / L, and double-distilled water to 10 μL.
[0025] The reaction conditions for PCR amplification were as follows: 95°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; and 72°C for 5 min.
[0026] A seventh aspect of the present invention provides a method for identifying wheat genotypes associated with yield traits, comprising the following steps:
[0027] Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3, and the PCR amplification product is detected;
[0028] If the size of the PCR amplification product is 285 bp, the wheat genotype is Hap I; if the size of the PCR amplification product is 273 bp, the wheat genotype is Hap II;
[0029] The yield of Hap II wheat is higher than that of Hap I wheat.
[0030] Beneficial effects of the present invention:
[0031] The present invention is unaffected by external environmental factors and is simple and convenient to operate. PCR amplification of the wheat TaPRR95-5A gene functional marker InDel 509 is performed, followed by polyacrylamide gel electrophoresis detection. Hap II-type germplasm is screened based on the size of the target band. This functional marker can provide an effective marker resource for wheat genetic improvement and molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 : Sequences of functional marker InDel 509 amplified from wheat germplasm resources (the arrows indicate primer sequences, and the boxes indicate deleted sequences).
[0033] Figure 2: Detection results of the functional marker Indel509 in wheat germplasm resources (M, DL2000 Marker bands are 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp in sequence; 1 - 32, wheat germplasm; Hap I reads as band type B, Hap II reads as band type A).
[0034] Figure 3 : T - test was used to evaluate the significance of trait differences between the two haplotypes, and the radar chart shows the normalized - log10 transformed P - values.
[0035] Figure 4 : The functional marker InDel 509 was used to evaluate the correlation between genotype and yield in wheat germplasm resources in two consecutive growing seasons. For the two genotypes identified by the InDel 509 marker, the yield of haplotype I was 5897.12 - 6217.35 kg / ha, and the yield of haplotype II was 6347.60 - 6814.89 kg / ha. The yield advantage was 450.38 - 597.54 kg / ha. Detailed implementation manners
[0036] It should be noted that the following detailed description is illustrative and aims to provide further explanation for this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.
[0037] As mentioned above, the TaPPD1 gene, as a typical gene of the PRR family, has been proven to improve the regional adaptability and early maturity of crops, and as a pseudo - response regulator of the circadian clock component. However, there are few reports on the correlation between the TaPPD1 gene and wheat yield traits.
[0038] The core challenges in developing InDel markers tightly linked to TaPRR95 - A lie in the complexity of the wheat genome, the accuracy of marker positioning, and the efficiency of experimental verification. It is necessary to combine genomics, experimental techniques, and statistical analysis, and improve the success rate through cross - validation of multi - omics data and population optimization.
[0039] The present invention developed and designed a functional marker InDel 509 tightly linked to the TaPRR95 - A gene, and analyzed the TaPRR95 genotype and phenotype using the InDel 509 functional marker. As a result, it was found that there are two haplotypes in wheat varieties during breeding utilization. The yield of Hap II type is higher than that of Hap I type. Selecting the haplotype that contributes to yield formation provides new ideas for wheat breeding and improvement.
[0040] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.
[0041] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.
[0042] Example 1: Development of molecular marker InDel 509
[0043] The present invention amplified TaPRR95-5A (TraesCS5A01G320300; Chinese_Spring1.0_chr5A: 533290702-533295125) from five wheat lines (Yanzhan No. 1, Yunnan wheat, Yutian rice and wheat, Hussar, and Chaya Zheda 29), and performed sequence comparative analysis using MEGA 7. TaPRR95-5A showed two different haplotypes in the five wheat lines and "Chinese Spring", among which Chinese Spring, Yunnan wheat, Yutian rice and wheat, and Hussar amplified one genotype, which was recorded as Hap I; Yanzhan No. 1 and Chaya Zheda 29 amplified another genotype, which was recorded as Hap II. Compared with Hap I, Hap II showed two non-synonymous single nucleotide polymorphisms (nsSNPs) and a 12-bp deletion ( Figure 1 ).
[0044] Developing molecular markers based on deletion sequences is more conducive to detection. Therefore, the present invention developed a dominant insertion-deletion (Indel) marker InDel 509 based on the 12-bp deletion, whose nucleotide sequence is shown in SEQ ID No. 1.
[0045] For the molecular marker InDel 509, the present invention designed primers for detecting the molecular marker, as follows:
[0046] InDel 509-F: CTTCATCGCAGCAGAATGATCTGG; (SEQ ID No. 2)
[0047] InDel 509-R:ATGCGTTACACTGTTCAGTAGGA. (SEQ ID No.3)
[0048] PCR amplification and polyacrylamide gel electrophoresis were performed using primers InDel 509-F and InDel 509-R. The specific steps are as follows:
[0049] (1) Genomic DNA of sample leaves was extracted using the CTAB method;
[0050] (2) PCR amplification was performed using the extracted DNA as a template. The PCR amplification reaction system was as follows: 1 μL DNA template, 5 μL 2× Taq Master Mix, 0.7 μL each of the primers InDel 509-F and InDel 509-R at a concentration of 10 μmol / L, and double-distilled water to 10 μL. The PCR amplification reaction conditions were: 95°C for 5 min, 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and 72°C for 5 min.
[0051] (3) Detection of PCR products by 8% polyacrylamide gel electrophoresis;
[0052] If a 285 bp DNA band is amplified, it indicates that the sample is of Hap I type; if a 273 bp DNA band is amplified, it indicates that the sample is of Hap II type.
[0053] Example 2: Utilization of the functional marker InDel 509 to assist in the selection and utilization of high-quality and high-yield wheat germplasm breeding.
[0054] To evaluate the agronomic value of TaPRR95-A and the practical application value of the marker verification molecular marker InDel 509, we evaluated a global wheat library consisting of approximately 2,000 varieties under field conditions for two consecutive growing seasons (2016-2017 and 2017-2018). Haplotypes of wheat materials in the global wheat library were genotyped using primers InDel 509-F and InDel 509-R designed in Example 1; and 12 yield-related traits were quantified, including three phenological stages (heading, flowering, and maturity) and three yield components (number of grains per ear, 1,000-grain weight, and grain yield per hectare). The haplotypes of wheat were then analyzed for association with yield-related traits.
[0055] The statistical results of agronomic traits of different haplotypes in two consecutive growing seasons (2016-2017 and 2017-2018) under field conditions are shown in Tables 1 and 2.
[0056] Table 1:
[0057]
[0058] Table 2:
[0059]
[0060] The significance of the differences in yield-related traits between the two haplotypes (Hap II and Hap I) of TaPRR95-A was estimated using a two-sided unpaired t-test. The results are shown in Tables 3 and 4.
[0061] Table 3:
[0062] Year Heading stage Flowering stage Maturity stage Plant height Panicle length Effective tiller number 2016-2017 0.0002092 5.258E-05 0.058565889 0.0666226 0.0118134 0.0442711 2017-2018 1.78E-08 9.008E-09 1.03151E-10 1.973E-05 0.006827 0.7593636
[0063] Table 4:
[0064] Year Spikelet number per panicle Sterile spikelet number Spikelet grain number Panicle grain number 1000-grain weight Yield per hectare 2016-2017 0.773658562 0.569728254 0.010796435 0.001230259 0.2117745 7.99688E-09 2017-2018 0.094623876 0.003128908 0.003814727 0.224938954 2.765E-05 1.52193E-10
[0065] The t-test was used to evaluate the significance of the trait differences between the two haplotypes. The radar chart shows the normalized -log10 transformed P-values ( Figure 3 ) for more intuitive comparison.
[0066] The results showed that: Typing the TaPRR95-A gene using the functional marker InDel 509, there was a significant association between the haplotype and the phenotype. Hap II showed excellent agronomic traits and the strongest association with grain yield ( Figure 4 ). Compared with HapI, the flowering period of Hap II was advanced by 0.51 - 0.73 days (p = 5.26×10 - 5 and 9.01×10 -9 ) and the yield advantage was 450.38 - 597.54 kg / ha (P = 1.52×10 -10 and 8.00×10 -9 ). It had the strongest association with grain yield (-log 10 [p] = 8.10 in 2016 - 2017; 9.82 in 2017 - 2018).
[0067] The above are only the preferred embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the protection scope of the present application.
Claims
1. An InDel molecular marker related to wheat yield traits, characterized in that, The InDel molecular marker is InDel 509; the nucleotide sequence of the molecular marker InDel 509 is shown in SEQ ID No.
1.
2. Use of the InDel molecular marker according to claim 1 in at least one of the following (1)-(3): (1) Early screening or identification of wheat traits; (2) Screening or breeding of high-yield wheat individual plants, lines, strains or varieties; (3) Wheat molecular marker-assisted breeding.
3. A primer pair for amplifying the InDel molecular marker according to claim 1, characterized in that, The nucleotide sequences of the primer pair are shown in SEQ ID No.2 and SEQ ID No.3 respectively.
4. A kit containing the primer pair according to claim 3.
5. The kit according to claim 4, characterized in that, The kit further includes: DNA template, TaqMaster Mix and ddH2O.
6. Use of the primer pair according to claim 3 or the kit according to claim 4 in at least one of the following (1)-(3): (1) Early screening or identification of wheat traits; (2) Screening or breeding of high-yield wheat individual plants, lines, strains or varieties; (3) Wheat molecular marker-assisted breeding.
7. A method for identifying wheat yield traits, characterized in that, Comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification with the primer pair shown in SEQ ID No.2 and SEQ ID No.3, performing gel electrophoresis analysis on the amplification product, and identifying the yield traits of the wheat according to the size of the electrophoresis band of the amplification product; the yield of wheat with an electrophoresis band of 273bp in the amplification product is higher than that of wheat with an electrophoresis band of 285bp in the amplification product.
8. The method according to claim 7, characterized in that, The reaction system for PCR amplification is: 1μL of DNA template, 5μL of 2×Taq Master Mix, 0.7μL each of primer InDel 509-F and InDel 509-R with a concentration of 10μmol / L, and adding double-distilled water to 10μL.
9. The method according to claim 7, wherein The reaction conditions for PCR amplification are: 95°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min.
10. A method for identifying wheat genotypes related to yield traits, characterized in that, Comprising the following steps: Using the genomic DNA of the wheat to be tested as a template, performing PCR amplification with the primer pair shown in SEQ ID No.2 and SEQ ID No.3, and detecting the PCR amplification product; If the size of the PCR amplification product is 285bp, the wheat genotype is Hap I type; if the size of the PCR amplification product is 273bp, the wheat genotype is Hap II type; The yield of Hap II type wheat is higher than that of Hap I type.
Citation Information
Cited By
Molecular marker of wheat MYB transcription factor family member TaRVE1-6B and application thereof
CN121896397A
Molecular marker of wheat MYB transcription factor family member tarve1-6b and application thereof
CN121896397B