Cyclic RNA compositions

Abstract

Provided herein are circular RNA constructs comprising an IRES and at least one expression sequence encoding a binding molecule, compositions thereof, and methods of treatment, including for cancer and autoimmune diseases. In particular, there is provided a circular RNA comprising an IRES and a CD19 binder, HER2 binder or BCMA binder, optionally formulated with a delivery vehicle. Also described herein are precursor polynucleotides comprising an IRES and at least one expression sequence encoding a CAR construct.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Application No. 63 / 423,760, filed on November 8, 2022, U.S. Provisional Application No. 63 / 501,820, filed on May 12, 2023, and U.S. Provisional Application No. 63 / 509,361, filed on June 21, 2023, each of which is hereby incorporated by reference in its entirety for any purpose.

[0003] Sequence Listing

[0004] This application is being filed with a sequence listing in electronic format. The sequence listing is provided as a file named "01318 - 0002 - 00PCT_SL.xml", created on October 31, 2023, and having a size of 213,220 bytes. The information in the electronic format sequence listing is hereby incorporated by reference in its entirety. Background of the Invention

[0005] Circular RNAs (circRNAs or oRNAs TM ) are known stable forms of RNA that offer advantages over linear RNAs in terms of structure and function, especially in cases of molecules that are prone to folding into inactive conformations (Wang and Ruffner, 1998). Circular RNA polynucleotides lack the free ends necessary for exonuclease - mediated degradation, rendering them resistant to several RNA degradation mechanisms and having an extended half - life when compared to equivalent linear RNAs. Cyclization can allow stabilization of RNA polynucleotides that are normally affected by short half - lives and can improve the overall efficacy of exogenous mRNAs in various applications. Circular RNAs can also be particularly interesting and useful for in vivo applications, especially in the research areas of RNA - based gene expression control and therapeutics including protein replacement therapy and vaccination.

[0006] Adoptive T cell immunotherapy is a rapidly evolving field, particularly in cancer treatment. Generally, the engagement of chimeric antigen receptor (CAR) T cells, or "CAR-T," with cancer cells expressing CD19 causes the proliferation and secretion of T cell activation, inflammatory cytokines, and chemokines, leading to tumor cell lysis. However, while CAR-T therapy has become an important tool in cancer treatment, it has toxic side effects and involves complex procedures. Treatment with CAR-T can cause a large and rapid release of cytokines into the bloodstream and can cause cytokine release syndrome (CRS) or CAR-T cell-related encephalopathy syndrome (CRES), also known as CAR-T-related neurotoxicity. CRS is the most common and well-described toxicity associated with CAR-T therapy, occurring in over 90% of patients at any grade and characterized by high fever, hypotension, hypoxia, and / or multi-organ toxicity, and can lead to death. Neurotoxicity is characterized by damage to neural tissue, which can cause tremors, encephalopathy, dizziness, or seizures. Additionally, patients typically undergo lymphodepletion prior to infusion. Lymphodepletion is known to increase CAR-T cell expansion and the enhanced efficacy of infused CAR-T cells by, for example, altering the tumor phenotype and microenvironment. However, lymphodepleting agents typically have side effects on patients. For example, lymphodepletion can cause neutropenia, anemia, thrombocytopenia, and immunosuppression, causing a greater risk of infection and other toxicities. In addition to the toxicities associated with targeted CAR-T therapy, there are also procedures, specific equipment, and costs involved in generating modified lymphocytes. CAR-T therapy requires a series of protocols to isolate, genetically modify, and selectively expand redirected cells, which are then infused back into the patient.

[0007] In a compassionate use anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus, autologous T cells from five SLE patients were "transduced with a lentiviral anti-CD19 CAR vector, expanded and reinfused... into patients following lymphodepletion with fludarabine and cyclophosphamide. In vivo expanded CAR T cells caused profound depletion of B cells, improvement of clinical symptoms and normalization of laboratory parameters, including seroconversion of anti-double-stranded DNA antibodies. SLE remission according to the DORIS criteria was achieved in all five patients after 3 months, and the median (range) systemic lupus erythematosus disease activity index score was 0 (2) after 3 months." See Mackensen et al., Anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus, Nature Medicine (2022); also see Nunez et al., Cytokine and reactivity profiles in SLE patients following anti-CD19 CAR T therapy, Molecular Therapy (2023).

[0008] Because circular RNAs are more stable and can be expressed in a tissue-specific manner, and because the use of circular RNAs obviates the lymphodepletion step of traditional therapies, circular RNAs provide a compelling alternative to traditional CAR therapies and other therapies. Accordingly, provided herein are circular RNA constructs comprising an internal ribosome entry site (IRES) and at least one expression sequence encoding a binding molecule. In certain embodiments, the binding molecule encodes a CAR targeting a cancer antigen for treating cancer. The circular RNAs can be formulated with a delivery vehicle to facilitate and / or enhance delivery and release of the circular RNAs to one or more target cells. Accordingly, lipid nanoparticles (LNPs) or other delivery vehicles containing ionizable lipids can be used to deliver the circular RNAs described herein to, for example, a patient in need of treatment. Summary of the Invention

[0009] The present disclosure provides circular RNAs encoding cancer-binding polypeptides paired with lipid transfer mediators for treating cancer. In particular, the present disclosure provides circular RNAs comprising an IRES and a nucleic acid encoding a binding molecule, wherein the IRES and the nucleic acid encoding the binding molecule are paired to achieve optimal expression of the polypeptide binding molecule. It has been unexpectedly found that certain IRES and nucleic acid combinations are better for optimal expression than others. It has further been found that certain transfer mediators can function better with certain IRES / binding molecule combinations. Accordingly, particularly preferred combinations of IRES / nucleic acid encoding the binding molecule / transfer mediator are provided herein. In some embodiments, the circular RNAs provided herein can be used to treat or prevent cancer. In some embodiments, the circular RNAs provided herein can be used to treat or prevent autoimmune diseases, such as B cell-mediated autoimmune diseases, such as lupus.

[0010] In some embodiments, the engineered chimeric antigen receptor (CAR) is encoded by a circular RNA and can be inserted into and expressed by immune cells including T cells, NK cells, macrophages, etc. after delivery via a lipid transfer mediator. In some embodiments, the CAR can recognize a specific antigen (e.g., CD19, HER2, or BCMA), and when bound to the antigen, activates the immune cells to attack and destroy the cells. The circular RNAs, compositions, and methods herein can thus be used to reduce known side effects associated with CAR-T therapy by programming circulating immune cells (e.g., T cells) with tumor recognition capabilities and by using a lipid transfer mediator (e.g., LNP) to deliver a circular RNA construct capable of efficiently introducing the CAR gene into immune cells. Also provided are methods for making such circularized RNA constructs, and methods of using the circular RNAs to treat a subject in need thereof. Linear precursor RNA polynucleotides are provided for preparing circular RNA constructs comprising core functional elements, the core functional elements comprising a translation initiation element (TIE). The TIE can comprise an untranslated region (UTR), an aptamer complex, or a combination thereof. The UTR can be wholly or partially from a virus or eukaryotic mRNA. The UTR can comprise a viral or eukaryotic internal ribosome entry site (IRES). Also provided are pharmaceutical compositions for linear precursors and circular RNA constructs comprising an IRES, an expression sequence, and optionally a transfer mediator. In certain embodiments, the circular RNA construct comprises an expression sequence encoding a CAR construct targeting a cancer antigen. The pharmaceutical compositions of the present disclosure are particularly suitable for efficient protein expression in immune cells in vivo. The transfer mediator can comprise, for example, an ionizable lipid capable of encapsulating the circular RNA, a PEG-modified lipid, a helper lipid, and / or a structural lipid.

[0011] Accordingly, the following embodiments are provided:

[0012] Embodiment 1. A circular RNA construct, the circular RNA construct comprising:

[0013] (A) An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0014] (B) At least one expression sequence encoding a binding molecule.

[0015] Embodiment 2. A circular RNA construct, the circular RNA construct comprising:

[0016] (A) An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0017] (B) At least one expression sequence encoding a chimeric antigen receptor (CAR) targeting a cancer antigen.

[0018] Embodiment 3. A circular RNA construct, the circular RNA construct comprising:

[0019] (A) An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0020] (B) At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

[0021] Embodiment 4. The circular RNA construct according to Embodiment 3, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

[0022] Embodiment 5. A circular RNA construct, the circular RNA construct comprising:

[0023] (A) An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0024] (B) At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

[0025] Embodiment 6. The circular RNA construct according to Embodiment 5, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

[0026] Embodiment 7. A circular RNA construct, the circular RNA construct comprising:

[0027] (A) An IRES selected from Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus, and

[0028] (B) At least one expression sequence encoding a binding molecule.

[0029] Embodiment 8. A circular RNA construct, the circular RNA construct comprising:

[0030] (A) An IRES selected from Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus, and

[0031] (B) At least one expression sequence encoding a chimeric antigen receptor (CAR) targeting a cancer antigen.

[0032] Embodiment 9. A circular RNA construct, the circular RNA construct comprising:

[0033] (A) An IRES selected from Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus, and

[0034] (B) At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

[0035] Embodiment 10. The circular RNA construct according to Embodiment 9, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

[0036] Embodiment 11. A circular RNA construct, the circular RNA construct comprising:

[0037] (A) An IRES selected from Enterovirus, Kobuvirus, Parechovirus, Hunnivirus, Passerivirus, Mischivirus, and Cardiovirus, and

[0038] (B) At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

[0039] Embodiment 12. The circular RNA construct as described in Embodiment 11, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NOs: 103 - 115.

[0040] Embodiment 13. A pharmaceutical composition, the pharmaceutical composition comprising:

[0041] (A) A circular RNA construct, which comprises:

[0042] i. An IRES, which comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NOs: 1 - 18, and

[0043] ii. At least one expression sequence encoding a binding molecule, and

[0044] (B) A delivery vehicle.

[0045] Embodiment 14. A pharmaceutical composition, the pharmaceutical composition comprising:

[0046] (A) A circular RNA construct, which comprises:

[0047] i. An IRES, which comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NOs: 1 - 18, and

[0048] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and

[0049] (B) A delivery vehicle.

[0050] Embodiment 15. A pharmaceutical composition, the pharmaceutical composition comprising:

[0051] (A) A circular RNA construct, which comprises:

[0052] i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0053] ii. At least one expression sequence encoding a binding molecule, and

[0054] (B) A delivery vehicle.

[0055] Embodiment 16. A pharmaceutical composition, the pharmaceutical composition comprising:

[0056] (A) A circular RNA construct, which comprises:

[0057] i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0058] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and

[0059] (B) A delivery vehicle.

[0060] Embodiment 17. A pharmaceutical composition comprising:

[0061] (A) A circular RNA construct comprising:

[0062] i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0063] ii. At least one expression sequence encoding a binding molecule, and

[0064] (B) A delivery vehicle comprising an ionizable lipid.

[0065] Embodiment 18. A pharmaceutical composition comprising:

[0066] (A) A circular RNA construct comprising:

[0067] i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0068] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and

[0069] (B) A delivery vehicle comprising an ionizable lipid.

[0070] Embodiment 19. A pharmaceutical composition comprising:

[0071] (A) A circular RNA construct comprising:

[0072] i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0073] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and

[0074] (B) A delivery vehicle comprising an ionizable lipid.

[0075] Embodiment 20. The pharmaceutical composition according to Embodiment 19, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

[0076] Embodiment 21. A pharmaceutical composition, the pharmaceutical composition comprising:

[0077] (A) A circular RNA construct, comprising:

[0078] i. An IRES, comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0079] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BMCA binder, and

[0080] (B) A delivery vehicle comprising an ionizable lipid.

[0081] Embodiment 22. The pharmaceutical composition according to Embodiment 21, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

[0082] Embodiment 23. A pharmaceutical composition, the pharmaceutical composition comprising:

[0083] (A) A circular RNA construct, comprising:

[0084] i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0085] ii. At least one expression sequence encoding a binding molecule, and

[0086] (B) A delivery vehicle comprising an ionizable lipid.

[0087] Embodiment 24. A pharmaceutical composition, the pharmaceutical composition comprising:

[0088] (A) A circular RNA construct, comprising:

[0089] i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0090] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and

[0091] (B) A delivery vehicle comprising an ionizable lipid.

[0092] Embodiment 25. A pharmaceutical composition, the pharmaceutical composition comprising:

[0093] (A) A circular RNA construct, comprising:

[0094] i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, passerivirus, mistivirus, and cardiovirus, and

[0095] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and

[0096] (B) A delivery vehicle comprising an ionizable lipid.

[0097] Embodiment 26. The pharmaceutical composition according to Embodiment 25, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19 - 34.

[0098] Embodiment 27. A pharmaceutical composition comprising:

[0099] (A) A circular RNA construct comprising:

[0100] i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, passerivirus, mistivirus, and cardiovirus, and

[0101] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BMCA binder, and

[0102] (B) A delivery vehicle comprising an ionizable lipid.

[0103] Embodiment 28. The pharmaceutical composition according to Embodiment 27, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103 - 115.

[0104] Embodiment 29. A pharmaceutical composition comprising:

[0105] (A) A circular RNA construct comprising:

[0106] i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1 - 18, and

[0107] ii. At least one expression sequence encoding a binding molecule, and

[0108] (B) A delivery vehicle comprising:

[0109] (i) An ionizable lipid of formula (I)

[0110]

[0111] wherein n is an integer between 1 and 4;

[0112] R a is hydrogen or a hydroxyl group; and

[0113] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of: 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group;

[0114] or

[0115] (ii) an ionizable lipid of formula (II)

[0116]

[0117] wherein each n is independently an integer from 2 to 15;

[0118] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0119] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of: 20 alkyl or C9-C 20Alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0120] R2 is selected from the group consisting of:

[0121]

[0122]

[0123] Embodiment 30. A pharmaceutical composition, the pharmaceutical composition comprising:

[0124] (A) A circular RNA construct, which comprises:

[0125] i. An IRES, which comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and

[0126] ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and

[0127] (B) A delivery vehicle comprising:

[0128] (i) An ionizable lipid of formula (I)

[0129]

[0130] wherein n is an integer between 1 and 4;

[0131] R a is hydrogen or a hydroxyl group; and

[0132] R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30Heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0133] or

[0134] (ii) an ionizable lipid of formula (II)

[0135]

[0136] wherein each n is independently an integer from 2 to 15;

[0137] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0138] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl; and

[0139] R2 is selected from the group consisting of

[0140]

[0141] Embodiment 31. A pharmaceutical composition, the pharmaceutical composition comprising:

[0142] (A) A circular RNA construct, comprising:

[0143] i. An IRES, comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and

[0144] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and

[0145] (B) A delivery vehicle comprising:

[0146] (i) An ionizable lipid of formula (I)

[0147]

[0148]

[0149] wherein n is an integer between 1 and 4;

[0150] R a is hydrogen or hydroxyl; and

[0151] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of: 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxyl, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0152] Or

[0153] (ii) An ionizable lipid of formula (II)

[0154]

[0155] where each n is independently an integer from 2 to 15;

[0156] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0157] R1 and R3 are each independently a straight-chain or branched-chain C9-C 20 alkyl or C9-C 20 alkenyl optionally substituted with one or more substituents selected from the group consisting of: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0158] R2 is selected from the group consisting of:

[0159]

[0160] Embodiment 32. A pharmaceutical composition, the pharmaceutical composition comprising:

[0161] (A) A circular RNA construct, which comprises:

[0162] i. An IRES, which comprises a sequence having at least 80% identity to any one of the sequences selected from SEQ ID NO: 1-18, and

[0163] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the expression sequence comprises a sequence having at least 80% identity to any one of the sequences selected from SEQ ID NO: 19-34, and

[0164] (B) A delivery vehicle comprising:

[0165] (i) An ionizable lipid of formula (I)

[0166]

[0167] where n is an integer between 1 and 4;

[0168] R a is hydrogen or a hydroxyl group; and

[0169] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group;

[0170] or

[0171] (ii) an ionizable lipid of formula (II)

[0172]

[0173] where each n is independently an integer from 2 to 15;

[0174] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0175] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20Alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0176] R2 is selected from the group consisting of:

[0177]

[0178]

[0179] Embodiment 33. A pharmaceutical composition, the pharmaceutical composition comprising:

[0180] (A) A circular RNA construct, which comprises:

[0181] i. An IRES, which comprises a sequence having at least 80% identity with any one of the sequences selected from SEQ ID NO: 1-18, and

[0182] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder, and

[0183] (B) A delivery vehicle comprising:

[0184] (i) An ionizable lipid of formula (I)

[0185]

[0186] wherein n is an integer between 1 and 4;

[0187] R a is hydrogen or hydroxy; and

[0188] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30Heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0189] or

[0190] (ii) an ionizable lipid of formula (II)

[0191]

[0192] wherein each n is independently an integer from 2 to 15;

[0193] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0194] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 Alkenyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl; and

[0195] R2 is selected from the group consisting of

[0196]

[0197] Embodiment 34. A pharmaceutical composition, the pharmaceutical composition comprising:

[0198] (A) A circular RNA construct, which comprises:

[0199] i. An IRES, which comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and

[0200] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-BCMA binder, and wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 103-115, and

[0201] (B) A delivery vehicle comprising:

[0202] (i) An ionizable lipid of formula (I)

[0203]

[0204]

[0205] wherein n is an integer between 1 and 4;

[0206] R a is hydrogen or hydroxy; and

[0207] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0208] or

[0209] (ii) An ionizable lipid of formula (II)

[0210]

[0211] wherein each n is independently an integer from 2 to 15;

[0212] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0213] R1 and R3 are each independently a straight-chain or branched-chain C9-C 20 alkyl or C9-C 20 alkenyl optionally substituted with one or more substituents selected from the group consisting of: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkyl sulfoxide, alkyl sulfoxide alkyl, alkylsulfonyl and alkylsulfone alkyl; and

[0214] R2 is selected from the group consisting of:

[0215]

[0216] Embodiment 35. A pharmaceutical composition, the pharmaceutical composition comprising:

[0217] (A) a circular RNA construct comprising:

[0218] i. an IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, picornavirus, mistyvirus and cardiovirus, and

[0219] ii. at least one expression sequence encoding a binding molecule, and

[0220] (B) a delivery vehicle comprising:

[0221] (i) an ionizable lipid of formula (I)

[0222]

[0223] wherein n is an integer between 1 and 4;

[0224] R a is hydrogen or a hydroxyl group; and

[0225] R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group;

[0226] or

[0227] (ii) the ionizable lipid of formula (II)

[0228]

[0229]

[0230] wherein each n is independently an integer from 2 to 15;

[0231] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0232] R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20Alkenyl: oxo group, halo group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0233] R2 is selected from the group consisting of:

[0234]

[0235] 36. A pharmaceutical composition, the pharmaceutical composition comprising:

[0236] (A) A circular RNA construct, which comprises:

[0237] i. An IRES selected from enterovirus, kobuvirus, parechovirus, henipavirus, passerivirus, mistivirus and cardiovirus, and

[0238] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, and

[0239] (B) A delivery vehicle comprising:

[0240] (i) An ionizable lipid of formula (I)

[0241]

[0242] wherein n is an integer between 1 and 4;

[0243] R a is hydrogen or hydroxyl; and

[0244] R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of: 30 alkyl, C6-C 30 alkenyl or C6-C 30Heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0245] or

[0246] (ii) an ionizable lipid of formula (II)

[0247]

[0248] wherein each n is independently an integer from 2 to 15;

[0249] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0250] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl; and

[0251] R2 is selected from the group consisting of

[0252]

[0253] Embodiment 37. A pharmaceutical composition, the pharmaceutical composition comprising:

[0254] (A) A circular RNA construct, comprising:

[0255] i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, passerivirus, mistivirus, and cardiovirus, and

[0256] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and

[0257] (B) A delivery vehicle comprising:

[0258] (i) An ionizable lipid of formula (I)

[0259]

[0260] wherein n is an integer between 1 and 4;

[0261] R a is hydrogen or hydroxy; and

[0262] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0263] or

[0264] (ii) An ionizable lipid of formula (II)

[0265]

[0266] wherein each n is independently an integer from 2 to 15;

[0267] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0268] R1 and R3 are each independently a straight-chain or branched C9-C 20 alkyl or C9-C 20 alkenyl optionally substituted with one or more substituents selected from the group consisting of: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminocarbonylaminoalkyl, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl; and

[0269] R2 is selected from the group consisting of:

[0270]

[0271] Embodiment 38. A pharmaceutical composition, the pharmaceutical composition comprising:

[0272] (A) a circular RNA construct comprising:

[0273] i. an IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picovirus, mistivirus, and cardiovirus, and

[0274] ii. at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-CD19 binder, and wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34, and

[0275] (B) a delivery vehicle comprising:

[0276] (i) an ionizable lipid of formula (I)

[0277]

[0278] wherein n is an integer between 1 and 4;

[0279] Ra is hydrogen or a hydroxyl group; and

[0280] R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group;

[0281] or

[0282] (ii) an ionizable lipid of formula (II)

[0283]

[0284] wherein each n is independently an integer from 2 to 15;

[0285] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0286] R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20Alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0287] R2 is selected from the group consisting of:

[0288]

[0289] Embodiment 39. A pharmaceutical composition, the pharmaceutical composition comprising:

[0290] (A) A circular RNA construct, which comprises:

[0291] i. An IRES selected from enterovirus, cretovirus, parechovirus, henipavirus, picornavirus, mistivirus and cardiovirus, and

[0292] ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder, and

[0293] (B) A delivery vehicle comprising:

[0294] (i) An ionizable lipid of formula (I)

[0295]

[0296] wherein n is an integer between 1 and 4;

[0297] R a is hydrogen or hydroxyl; and

[0298] R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30Heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0299] or

[0300] (ii) an ionizable lipid of formula (II)

[0301]

[0302] wherein each n is independently an integer from 2 to 15;

[0303] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0304] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl; and

[0305] R2 is selected from the group consisting of

[0306]

[0307] Embodiment 40. A pharmaceutical composition, the pharmaceutical composition comprising:

[0308] (A) a circular RNA construct, comprising:

[0309] i. an IRES selected from enterovirus, crestovirus, parechovirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0310] ii. at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-BCMA binder, and wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115, and

[0311] (B) a delivery vehicle comprising:

[0312] (i) an ionizable lipid of formula (I)

[0313]

[0314]

[0315] wherein n is an integer between 1 and 4;

[0316] R a is hydrogen or hydroxy; and

[0317] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of: 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclicalkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocycliccarbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl, and alkylsulfonylalkyl;

[0318] or

[0319] (ii) an ionizable lipid of formula (II)

[0320]

[0321] wherein each n is independently an integer from 2 to 15;

[0322] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0323] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxide alkyl group, alkylsulfonyl group and alkylsulfone alkyl group; and

[0324] R2 is selected from the group consisting of:

[0325]

[0326] Embodiment 41. The pharmaceutical composition according to any one of Embodiments 1-4, 7-10, 13-20, 23-26, 29-32 and 35-38, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence having at least 80% identity to any one of the sequences selected from SEQ ID NOs: 50-61.

[0327] Embodiment 42. The pharmaceutical composition according to any one of Embodiments 1-4, 7-10, 13-20, 23-26, 29-32 and 35-38, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence selected from any one of SEQ ID NOs: 50-61.

[0328] Embodiment 43. The pharmaceutical composition according to embodiment 42, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NO: 50, 51, 52, 54, 55, 56, 58, and 59.

[0329] Embodiment 44. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 50 - 61.

[0330] Embodiment 45. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NO: 50 - 61.

[0331] Embodiment 46. The pharmaceutical composition according to embodiment 45, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NO: 50, 51, 52, 54, 55, 56, 58, and 59.

[0332] Embodiment 47. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 50 - 61, and wherein the delivery vehicle comprises:

[0333] (i) an ionizable lipid of formula (I)

[0334]

[0335] wherein n is an integer between 1 and 4;

[0336] R a is hydrogen or hydroxy; and

[0337] R1 and R2 are each independently a straight-chain or branched-chain C6 - C 30 alkyl optionally substituted with one or more substituents selected from the group consisting of 30Alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkyl sulfoxide, alkyl sulfoxide alkyl, alkylsulfonyl and alkylsulfone alkyl;

[0338] or

[0339] (ii) an ionizable lipid of formula (II)

[0340]

[0341] wherein each n is independently an integer from 2 to 15;

[0342] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0343] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkyl sulfoxide, alkyl sulfoxide alkyl, alkylsulfonyl and alkylsulfone alkyl; and

[0344] R2 is selected from the group consisting of

[0345]

[0346] Embodiment 48. A pharmaceutical composition, the pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, wherein the circular RNA comprises a sequence selected from any one of SEQ ID NOs: 50-61, and wherein the delivery vehicle comprises:

[0347] (i) an ionizable lipid of formula (I)

[0348]

[0349] wherein n is an integer between 1 and 4;

[0350] R a is hydrogen or hydroxy; and

[0351] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminoalkylcarbonylamino, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0352] or

[0353] (ii) an ionizable lipid of formula (II)

[0354]

[0355]

[0356] wherein each n is independently an integer from 2 to 15;

[0357] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0358] R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxide alkyl group, alkylsulfonyl group and alkylsulfone alkyl group; and

[0359] R2 is selected from the group consisting of:

[0360]

[0361] Embodiment 49. The pharmaceutical composition according to Embodiment 48, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NO: 50, 51, 52, 54, 55, 56, 58 and 59.

[0362] Embodiment 50. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1-49, wherein the circular RNA construct comprises SEQ ID NO: 50.

[0363] Embodiment 51. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 51.

[0364] Embodiment 52. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 52.

[0365] Embodiment 53. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 54.

[0366] Embodiment 54. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 55.

[0367] Embodiment 55. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 56.

[0368] Embodiment 56. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 58.

[0369] Embodiment 57. The circular RNA construct or pharmaceutical composition according to any one of Embodiments 1 to 49, wherein the circular RNA construct comprises SEQ ID NO: 59.

[0370] Embodiment 58. The pharmaceutical composition according to any one of Embodiments 5-6, 21-22, 27, 28, 33-34 or 39-40, wherein the IRES comprises the sequence of SEQ ID NO: 8, wherein the CAR construct comprises a BCMA binder, and wherein the BCMA binder comprises a sequence selected from any one of SEQ ID NOs: 104-115.

[0371] Embodiment 59. The pharmaceutical composition according to any one of Embodiments 13-58, wherein the delivery vehicle comprises an ionizable lipid of formula (I).

[0372] Embodiment 60. The pharmaceutical composition according to Embodiment 59, wherein the delivery vehicle comprises a helper lipid, a structural lipid and a PEG lipid.

[0373] Embodiment 61. The pharmaceutical composition according to any one of Embodiments 59-60, wherein the delivery vehicle has a lipid molar ratio formulation as described in Table 4b.

[0374] Embodiment 62. The pharmaceutical composition according to any one of Embodiments 13-58, wherein the delivery vehicle comprises an ionizable lipid of formula (II).

[0375] Embodiment 63. The pharmaceutical composition according to Embodiment 62, wherein the ionizable lipid is selected from ionizable lipids selected from the following:

[0376]

[0377]

[0378] Embodiment 64. The pharmaceutical composition according to embodiment 63, wherein the ionizable lipid is:

[0379]

[0380] Embodiment 65. The pharmaceutical composition according to any one of embodiments 13-64, wherein the delivery vehicle further comprises at least one lipid selected from helper lipids, structural lipids, and PEG-modified lipids.

[0381] Embodiment 66. The pharmaceutical composition according to embodiment 65, wherein the delivery vehicle comprises PEG-DSPC.

[0382] Embodiment 67. The pharmaceutical composition according to any one of embodiments 13-66, wherein the delivery vehicle is a lipid nanoparticle.

[0383] Embodiment 68. The pharmaceutical composition according to any one of embodiments 13-67, wherein the delivery vehicle further comprises a targeting moiety.

[0384] Embodiment 69. The pharmaceutical composition according to embodiment 68, wherein the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bicyclic peptide or tricyclic peptide, minibody, polynucleotide aptamer, engineered scaffold protein, heavy chain variable region, light chain variable region, or a fragment thereof.

[0385] Embodiment 70. The pharmaceutical composition according to any one of embodiments 13-69, the pharmaceutical composition further comprises a pharmaceutical salt, buffer, diluent, or a combination thereof.

[0386] Embodiment 71. The circular RNA construct or pharmaceutical composition according to any one of the foregoing embodiments, wherein the circular RNA further comprises a polyA region.

[0387] Embodiment 72. The circular RNA construct or pharmaceutical composition according to any one of the foregoing embodiments, wherein the circular RNA further comprises at least one miRNA binding site.

[0388] Embodiment 73. The circular RNA construct or pharmaceutical composition according to embodiment 72, wherein the circular RNA comprises at least one miR-122 binding site.

[0389] Embodiment 74. The circular RNA construct or pharmaceutical composition according to any one of the foregoing embodiments, wherein the at least one expression sequence encoding a CAR is codon-optimized.

[0390] Embodiment 75. The circular RNA construct or pharmaceutical composition as described in any one of the foregoing embodiments, wherein the RNA construct further comprises a 5' enhanced intron element, a 5' enhanced exon element, a 3' enhanced exon element, and a 3' enhanced intron fragment.

[0391] Embodiment 76. A method for preparing the circular RNA construct or pharmaceutical composition as described in any one of the foregoing embodiments.

[0392] Embodiment 77. A method for treating cancer in a subject, the method comprising administering an effective amount of a composition comprising the circular RNA construct or pharmaceutical composition as described in any one of Embodiments 1-75, thereby treating the cancer. Additionally, a method for treating an autoimmune disease in a subject, the method comprising administering an effective amount of a composition comprising the circular RNA construct or pharmaceutical composition as described in any one of Embodiments 1-75, thereby treating the autoimmune disease.

[0393] Embodiment 78. Use of a composition comprising the circular RNA construct or pharmaceutical composition as described in any one of Embodiments 1-75 for treating cancer. Additionally, use of a composition comprising the circular RNA construct or pharmaceutical composition as described in any one of Embodiments 1-75 for treating an autoimmune disease.

[0394] Embodiment 79. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0395] (A) An IRES, which comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0396] (B) At least one expression sequence encoding a binding molecule.

[0397] Embodiment 80. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0398] (A) An IRES, which comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0399] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen.

[0400] Embodiment 81. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0401] (A) An IRES, which comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0402] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

[0403] Embodiment 82. The linear precursor RNA polynucleotide according to embodiment 81, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

[0404] Embodiment 83. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0405] (A) An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and

[0406] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

[0407] Embodiment 84. The linear precursor RNA polynucleotide according to embodiment 83, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

[0408] Embodiment 85. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0409] (A) An IRES selected from the group consisting of enterovirus, cripavirus, parechovirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0410] (B) At least one expression sequence encoding a binding molecule.

[0411] Embodiment 86. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0412] (A) An IRES selected from the group consisting of enterovirus, cripavirus, parechovirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0413] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen.

[0414] Embodiment 87. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0415] (A) An IRES selected from the group consisting of enterovirus, cripavirus, parechovirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and

[0416] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

[0417] Embodiment 88. The linear precursor RNA polynucleotide according to embodiment 87, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

[0418] Embodiment 89. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising:

[0419] (A) An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picovirus, mistivirus, and cardiovirus, and

[0420] (B) At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

[0421] Embodiment 90. The linear precursor RNA polynucleotide according to embodiment 89, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

[0422] Embodiment 91. The linear precursor RNA polynucleotide according to any one of embodiments 79 to 90, wherein the expression sequence is codon-optimized.

[0423] Embodiment 92. The linear precursor RNA polynucleotide according to any one of embodiments 79 to 91, the linear precursor RNA polynucleotide further comprising a 5' enhanced intron element, a 5' enhanced exon element, a 3' enhanced exon element, and a 3' enhanced intron fragment.

[0424] Embodiment 93. The linear precursor RNA polynucleotide according to embodiment 92, the linear precursor RNA polynucleotide comprising the following order:

[0425] (A) The 5' enhanced intron element,

[0426] (B) The 5' enhanced exon element,

[0427] (C) A core functional element comprising an IRES and an expression sequence encoding at least one CAR construct targeting a cancer antigen and optionally a stop codon or a stop cassette,

[0428] (D) The 3' enhanced exon element, and

[0429] (E) The 3' enhanced intron element.

[0430] Embodiment 94. The linear precursor RNA polynucleotide as described in any one of Embodiments 79 to 93, the linear precursor RNA polynucleotide further comprising at least one miRNA binding site.

[0431] Embodiment 95. The linear precursor RNA polynucleotide as described in Embodiment 94, wherein the precursor RNA comprises at least one miR-122 binding site.

[0432] Embodiment 96. A DNA vector encoding the RNA polynucleotide as described in any one of Embodiments 79 - 95.

[0433] Embodiment 97. A method for preparing a circular RNA construct, the method comprising incubating the linear RNA polynucleotide as described in any one of Embodiments 79 - 95 under conditions suitable for cyclization.

[0434] Embodiment 98. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NO:1, 2, 4, and 8, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder comprising a sequence selected from any one of SEQ ID NO:19 and 20, and wherein the delivery vehicle is a lipid nanoparticle.

[0435] Embodiment 99. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NO:8, 16, 17, and 18, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder comprising SEQ ID NO:115, and wherein the delivery vehicle is a lipid nanoparticle.

[0436] Embodiment 100. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NO:8, 16, 17, and 18, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a HER2 binder comprising a nucleotide sequence selected from any one of SEQ ID NO:132 or 133, and wherein the delivery vehicle is a lipid nanoparticle.

[0437] Embodiment 101. The pharmaceutical composition according to any one of embodiments 98 to 100, wherein the lipid nanoparticles comprise: (i) an ionizable lipid of formula (I)

[0438]

[0439] wherein n is an integer between 1 and 4;

[0440] R a is hydrogen or hydroxy; and

[0441] R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo, halo, hydroxy, cyano, alkyl, alkenyl, aldehyde, heterocyclic alkyl, hydroxyalkyl, dihydroxyalkyl, hydroxyalkylaminoalkyl, aminoalkyl, alkylaminoalkyl, dialkylaminoalkyl, (heterocyclic)(alkyl)aminoalkyl, heterocyclic, heteroaryl, alkylheteroaryl, alkynyl, alkoxy, amino, dialkylamino, aminocarbonylaminoalkyl, aminocarbonylalkylamino, (aminocarbonylalkyl)(alkyl)amino, alkenylcarbonylamino, hydroxycarbonyl, alkoxycarbonyl, aminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, dialkylaminoalkylaminocarbonyl, heterocyclic alkylaminocarbonyl, (alkylaminoalkyl)(alkyl)aminocarbonyl, alkylaminoalkylcarbonyl, dialkylaminoalkylcarbonyl, heterocyclic carbonyl, alkenylcarbonyl, alkynylcarbonyl, alkylsulfoxide, alkylsulfoxidealkyl, alkylsulfonyl and alkylsulfonylalkyl;

[0442] or

[0443] (ii) an ionizable lipid of formula (II)

[0444]

[0445] wherein each n is independently an integer from 2 to 15;

[0446] L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3;

[0447] R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20Alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and

[0448] R2 is selected from the group consisting of:

[0449]

[0450] Embodiment 102. The pharmaceutical composition according to Embodiment 101, wherein the lipid nanoparticle transfer mediator comprises an ionizable lipid, and the ionizable lipid is

[0451]

[0452] Embodiment 103. The pharmaceutical composition according to any one of Embodiments 98 - 102, wherein the lipid nanoparticle transfer mediator further comprises at least one lipid selected from co - lipids, structural lipids and PEG - modified lipids.

[0453] Embodiment 104. A method for treating cancer, the method comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of Embodiments 98 - 103.

[0454] Embodiment 105. A method for treating an autoimmune disease, the method comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of Embodiments 98 - 103.

[0455] Embodiment 106. Use of a composition comprising a circular RNA construct for treating cancer, the use comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of Embodiments 98 - 103.

[0456] Embodiment 107. Use of a composition comprising a circular RNA construct for treating an autoimmune disease, the use comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of Embodiments 98 - 103.

[0457] Embodiment 108. The method according to Embodiment 77 or Embodiment 104 or 105 or the use according to Embodiment 106 or 107, wherein the administration is carried out daily, every other day, twice a week, weekly, every ten days, every two weeks, every three weeks, every four weeks, once a month, every six weeks, every eight weeks, every three months, every four months, every six months, every eight months, every nine months or annually. Description of the Drawings

[0458] Figure 1A A schematic diagram showing the sequence insertion sites of an exemplary IRES / codon plasmid. The IRES and codon (expression sequence) are synthesized together and inserted into a circular RNA of a plasmid "backbone" containing a bacterial sequence and 5'-merged auxiliary elements and 3'-merged auxiliary elements. The auxiliary elements may include (but are not limited to) promoters, introns, exons, internal and external spacers, internal double-stranded regions, and polyA extensions. Figure 1B Depicts the general sequence construct of a linear RNA polynucleotide precursor (10). The sequences provided are shown in the 5' to 3' order of a 5'-enhanced intron element (20), a 5'-enhanced exon element (30), a core functional element (40), a 3'-enhanced exon element (50), and a 3'-enhanced intron element (60). Figure 1C Shows an exemplary linear RNA polynucleotide precursor (10) which, in the following 5' to '3 order, comprises: a leader untranslated sequence (21), a 5'-affinity tag (22), a 5'-external spacer (26), a 3'-intron fragment (28), a 3'-exon fragment (32), a 5'-internal double-stranded region (34), a 5'-internal spacer (36), a TIE (42), a coding element (46), a termination region (48), a 3'-internal spacer (52), a 3'-internal double-stranded region (54), a 5'-exon fragment (56), a 5'-intron fragment (62), a 3'-external spacer (64), a 3'-affinity tag (68), and a terminal untranslated sequence (69). Figure 1D Illustrates the exemplary positions of auxiliary elements (70) (e.g., miRNA binding sites) included in a linear RNA polynucleotide within the core functional element (40), for example where 42 is the TIE (translation initiation element), 46 is the coding region, 47 is the non-coding region, and 48 is the termination region (stop codon or termination cassette).

[0459] Figure 2A and Figure 2B Depicts a schematic diagram of a preliminary process by which a combination of IRES and codons is selected for a circular RNA construct.

[0460] Figure 3A and Figure 3BThe effects of three different codon optimization algorithms are depicted. For each construct in two different donors (donor 4003 and donor 609C), CD19 CAR+ is evaluated via flow cytometry and expressed (gMFI) and drawn in the sorted order of all sequences and encoded by codon optimization algorithms. The white bar on the right indicates the expression (positive control) of the CD19 CAR sequence without codon optimization.

[0461] Figure 4A 、 Figure 4B and Figure 4C The effects of three different codon optimization algorithms are depicted. After electroporation, the three algorithms were used to evaluate MFI (total T cells), percentage of CD3+ cells (CAR-T cell frequency), and total cell count (CAR-T cell number) compared to positive and mock negative controls over time.

[0462] Figure 5A 、 Figure 5B 、 Figure 5C 、 Figure 5D 、 Figure 5E 、 Figure 5F 、 Figure 5G 、 Figure 5H 、 Figure 5I and Figure 5J Shown are T cell MFI (expression) through the IRES over time (5 days) for two donors (donor 4003 and donor 609C) of circular RNA constructs comprising a combination of an IRES and an expression sequence. Each point on the x-axis is an IRES from Table 1A and each dot is a different expression sequence from Table 2A (codon-optimized; anti-CD19 28-ζ).

[0463] Figure 6A 、 Figure 6B 、 Figure 6C 、 Figure 6D 、 Figure 6E 、 Figure 6F 、 Figure 6G 、 Figure 6H 、 Figure 6I and Figure 6J Show CAR positive cells% over time by IRES, i.e., the percentage of cells expressed over time (5 days) or the average signal of cells for two donors (donor 4003 and donor 609C) of circular RNA constructs comprising a combination of IRES and expression sequences. Each point on the X-axis is an IRES from Table 1A and each dot is a different expression sequence from Table 2A (codon-optimized; anti-CD1928-ζ).

[0464] Figure 7A and Figure 7BShow the effect of changing the IRES on the % Nalm6 lysis data at 24 hours and 48 hours. Generate combinations of different constructs containing the basal CD19 codon (3276) with different IRESs, including IRES numbers 1-1, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-11, 1-12, 1-13, 1-14, and 1-15 in Table 1A (containing SEQ ID NO:1, 4-15), compared to the mock negative control, the IRES of the basal CD19 CAR control, and individual Nalm6 in two different donors (609C and 4003).

[0465] Figure 8A and Figure 8B Show the cytotoxicity data of 69 CD19 CAR oRNA constructs identified by the IRES / CO construct number in Table 5 for two different donors (609C and 4003) at 24-hour and 48-hour time points, compared to the mock negative control, the basal CD19 CAR control, and individual Nalm6.

[0466] Figure 9A 、 Figure 9B 、 Figure 9C and Figure 9D Reflect the % Nalm6 killing cytotoxicity data of the CD19 CAR oRNA constructs for the two donors on Day 1 and Day 2 as in Figure 8A and Figure 8B , but presented in a different visual format. Each point on the x-axis is an IRES containing the SEQ ID NO:1-15 sequences (IRES numbers 1-1 to 1-15, described in Table 1A). Each dot is a different codon containing the SEQ ID NO 19-23 sequences (codon numbers 2A-19 to 2A-23, described in Table 2A, codon-optimized; anti-CD19 28-ζ). The control is the IRES of the basal CD19 CAR control (3276).

[0467] Figure 10A 、 Figure 10B 、 Figure 10C and Figure 10D Reflect IFNγ expression, and Figure 10E 、 Figure 10F 、 Figure 10G and Figure 10H Reflect the IL-2 expression of 69 CD19 CAR circular RNA constructs at 24 hours and 48 hours after electroporation in two different donors (609C and 4003).

[0468] Figure 11Shows Annexin V+ Nalm6 (percentage of Nalm6) for the CD19 CAR construct of IRES / CO clone number 37 (SEQ ID NO:52), compared to CD19 CAR constructs (3276) containing non-optimized CAR sequences, HER2 circular RNA constructs (containing HER2_9), mock negative controls, and Nalm6 alone.

[0469] Figure 12A Shows T cell % of 12 CD19 CAR constructs (identified by IRES / CO clone number) of donor 9003 after 96 hours. Figure 12B Shows CAR+ MFI of donor 9003 for 12 constructs within 48 hours after electroporation. Figure 12C Shows Annexin V+ Nalm6 after 72 hours compared to the basal CD19 CAR control (3276), mock negative control, Nalm6 alone, and HER2.

[0470] Figure 13A and Figure 13B Shows IRES expression by luminescence for 12 different IRESs in 293 cell and Jurkat cell types.

[0471] Figure 14 Shows in vivo anti-tumor efficacy of CD19 oCAR constructs containing IRES / CO clone numbers 7, 37, and 87 (SEQ ID NO:50, 52, 55 respectively) compared to the basal CD19 CAR control (3276), PBS, and HER2 control at doses of 1.0 mg / kg, 0.3 mg / kg, and 0.1 mg / kg. Multiple Mann-Whitney tests with Holm-Sidak correction, *p≤0.05, **p≤0.01, ***p≤0.001.

[0472] Figure 15 Shows in vivo anti-tumor efficacy of CD19 oCAR constructs containing IRES / CO clone numbers 97, 17, 164, and 87 (SEQ ID NO:56, 51, 58, 55 respectively) compared to the basal CD19 CAR control (3276), PBS, and HER2 control at doses of 1.0 mg / kg, 0.3 mg / kg, and 0.1 mg / kg.

[0473] Figure 16Show the total flux (photons / second) of different lipid compositions for the circular RNA constructs comprising HER2 and CD19 after 4 doses of LNP / oCAR compared to the control. HER2 and CD19 lipid compositions include the ionizable lipids 126, 128, 16, 45, and 86 of Table 3. The ionizable lipids 126 and 128 of Table 3 are lipids of Formula II, and the ionizable lipids 16, 45, and 86 of Table 3 are lipids of Formula I. " / 3" name indicates the lipid composition comprising PEG-modified lipids. Lipid (3-128) / 3, (3-16) / 3, (3-45) / 3, and (3-86) / 3 contain PEG-modified lipids. Lipid (3-128) / 3L contains the ionizable lipid 128 of Table 3 and PEG-modified lipids.

[0474] Figure 17 Shown are the % cytotoxicity of circular RNA constructs containing HER2_9 and HER2_10 over time compared to a basal CD19 CAR control (3276) and a mock negative control (IncuCyte cytotoxicity assay).

[0475] Figure 18A 、 Figure 18B and Figure 18C Demonstrated in the use of engineered HER2 / K562 cell lines ( Figure 18A )、CD19 / K562( Figure 18B ) and Nalm6(CD19+ / HER2-)( Figure 18C ) Target lysis % of HER2.BBζoCAR construct and HER2 28ζoCAR construct compared to CD19oCAR construct, basal CD19 CAR control and mock negative control assessed using FACS-based cytotoxicity assay after 24 hours of cell co-culture.

[0476] Figure 19A 、 Figure 19B and Figure 19C Target-specific cytotoxicity is demonstrated for oCAR constructs containing the sequence of BCMA-16 compared to the basic CD19 CAR (3276) and mock negative controls in MM.1S cells, U266B1 cells, and Nalm 6 cells.

[0477] Figure 20 Tumor control as measured by total flux (photons / second) following Nalm6 implantation is demonstrated using once-weekly dosing at 0.1 mg / kg (mpk) and 0.3 mg / kg (mpk).

[0478] Figure 21A 、 Figure 21B and Figure 21CShows tumor control measured by total flux (photons / second) following Nalm6 engraftment using dosing at 0.1 mg / kg and 0.3 mg / kg every other week (biweekly or q2w). Lipid 86 (“3-86”) of Table 3 was used for these oRNA CAR constructs.

[0479] Figure 22 Shows in vivo tumor control using dosing at 0.1 mg / kg and 0.3 mg / kg every other week.

[0480] Figure 23A and Figure 23B Shows quantitative tumor measurements over time following Nalm6 engraftment. In Figure 23A , gray circles show response to control and black squares show response to treatment with the CD19 oRNA CAR constructs described herein. In Figure 23B , whole body images show untreated and treated mice over time.

[0481] Figure 24A Depicts BCMA CAR expression detected with soluble BCMA.PE following electroporation with an exemplary circular RNA (circRNA) encoding BCMA-41BBζ CAR at a dose of 10 ng, 30 ng, or 100 ng per 0.1X10 6 T cells compared to “mock” control T cells without any circular RNA electroporation. T cell expression was analyzed 24 hours, 48 hours, and 72 hours after introduction of the circular RNA. Figure 24B Depicts BCMA CAR expression quantified using geometric mean fluorescence intensity (gMFI) activity within 24 hours after introduction of a circular RNA encoding BCMA-41BBζ CAR at a dose of 10 ng, 30 ng, or 100 ng per 0.1x10 6 T cells. “A”, “B”, and “C” correspond to “DNA template A”, “DNA template B”, and “DNA template C” in Table α1, respectively, i.e., circular RNA construct “A” contains the IRES sequence of DNA template A and the BCMA sequence of DNA template A; circular RNA construct “B” contains the IRES sequence of DNA template B and the BCMA sequence of DNA template B; circular RNA construct “C” contains the IRES sequence of DNA template C and the BCMA sequence of DNA template C; etc.

[0482] Figures 25A to 25GDepiction of anti-BCMA chimeric antigen receptor (CAR) expression of an exemplary circular RNA encoding BCMA-41BBζ CAR after electroporation of the circular RNA into T cells. "A", "B", "C", "D", and "E" correspond to "DNA template A", "DNA template B", "DNA template C", "DNA template D", and "DNA template E" in Table α1, respectively. "Mock" in the figures represents data of control T cells without electroporation of circular RNA. Figure 25A Depiction of the percentage of CAR expression detected by soluble BCMA-PE detection reagent within 24 - 72 hours after electroporation of circular RNA formed by DNA template A, DNA template B, and DNA template C and administered at 10 ng, 30 ng, or 100 ng per 0.1 X 10 6 T cells. Figure 25B Depiction of the geometric mean fluorescence intensity (gMFI) of T cells detected by soluble BCMA-PE detection reagent within 24 - 72 hours after electroporation of circular RNA formed by DNA template A, DNA template B, and DNA template C and administered at 10 ng, 30 ng, or 100 ng per 0.1 X 10 6 T cells. Figure 25C Provided is fluorescence-activated cell sorting (FACS) imaging after introducing the circular RNA depicted in Figure 25A and 25B into T cells at a dose of 30 ng after 24 hours. Figure 25D Depiction of the percentage of CAR expression detected by soluble BCMA-PE detection reagent within 24 - 96 hours after electroporation of circular RNA formed by DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and administered at 10 ng, 30 ng, or 100 ng per 0.1 X 10 6 T cells. Figure 25E Depiction of the percentage of CAR expression detected by anti-Whitlow-PE detection reagent within 24 - 96 hours after electroporation of circular RNA formed by DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and administered at 10 ng, 30 ng, or 100 ng per 0.1 X 10 6 T cells. Figure 25E Depiction of the percentage of CAR expression detected by anti-G4S detection reagent within 24 - 96 hours after electroporation of circular RNA formed by DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and administered at 10 ng, 30 ng, or 100 ng per 0.1 X 10 6 T cells. Figure 25GDepicts the average MFI (%) of T cells detected by soluble BCMA PE detection reagent within 24 - 96 hours after circular RNA electroporated into T cells formed by DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and administered at 10 ng, 30 ng, or 100 ng per 0.1X10 6 T cells.

[0483] Figure 26 Depicts an exemplary gating method for analyzing flow cytometry results of T cells electroporated with circular RNA encoding BCMA CAR at a dose of 10 ng x10. BCMA CAR expression was detected using soluble BCMA PE, anti-Whitlow PE, or anti-G4S linker.

[0484] Figure 27 Shows target protein expression on multiple myeloma positive cells (such as MM1S, NCI-H929, and RPMI-8226) and negative target cell lines (such as Nalm6 target cell line).

[0485] Figure 28 Depicts the percentage of live T cells collected 24 hours after electroporation of circular RNA containing BCMA-41BBζCAR or CD19-CD28ζCAR compared to a "mock" solution containing no circular RNA and only electroporation buffer. "F", "C", "G", "H", "A", "I", and "J" correspond to "DNA template F", "DNA template C", "DNA template G", "DNA template H", "DNA template A", "DNA template I", and "DNA template J" used to form the circular RNA.

[0486] Figures 29A to 29D Provides the gMFI collected from various circular RNA constructs encoding BCMA-41BBζ or BCMA-CD28ζCAR or CD19-CD28ζCAR electroporated onto T cells at a dose of 50 ng per 0.1X10 6 T cells compared to "mock" control T cells lacking any circular RNA (containing only electroporation buffer). Soluble BCMA (sBCMA-PE), anti-Whitlow-PE, or anti-G4S linker PE (G4S-AF647) detection reagents were added to each circular RNA solution. Figure 29A Shows a histogram of gMFI collected from cells. Figures 29B to 29D Provides the gMFI per cell, where sBCMA-PE( Figure 29B ), anti-Whitlow-PE( Figure 29C ), and G4S-AF647( Figure 29D) The detection reagent is used to collect gMFI. "F", "C", "G", "H", "A", "I", and "J" correspond to "DNA template F", "DNA template C", "DNA template G", "DNA template H", "DNA template A", "DNA template I", and "DNA template J" for forming circular RNA.

[0487] Figure 30 Depicts an exemplary gating process of oCAR-T cells 24 hours after electroporation. The top row of boxes (left to right) provides FACS imaging of lymphocytes, CD3-negative cells, live T cells, and BCMA-positive cells. The bottom two boxes are histograms of BCMA CAR detected by soluble BCMA or anti-Whitlow detection reagent (bottom left) or anti-GS4-PE fluorescence (bottom right).

[0488] Figures 31A to 31C Depicts the detection reagents used (i.e., soluble BCMA PE (indicated by "sBCMA" in Figure 31A ), anti-Whitlow-PE (indicated by "Whitlow" in Figure 31B ), and anti-G4S linker PE (indicated by "G4S" in Figure 31C )) in terms of the percentage of expression. Twenty-four hours after electroporation of circular RNA encoding BCMA-41BBζ, BCMA-CD28ζ, or HER2 CAR, the percentage of expression is calculated based on the presence of the relevant detection reagent gated on live T cells. "F", "C", "G", "H", "A", "I", and "J" correspond to "DNA template F", "DNA template C", "DNA template G", "DNA template H", "DNA template A", "DNA template I", and "DNA template J" for forming circular RNA. "Mock" in the figure represents data of control T cells without electroporation of circular RNA.

[0489] Figures 32A to 32E Shows BCMA expression obtained via gMFI for CD3+ cell gating ([[]] Figure 32A , Figure 32B and Figure 32D ) or the percentage of soluble BCMA PE detection (indicated as "sBCMA-PE%") ( Figure 32C or Figure 32E ) after electroporation of circular RNA encoding BCMA-41BBζ, BCMA-CD-CD28ζ, or CD19-CD28ζ. "Mock" indicates a T cell solution without electroporation of the circular RNA construct. Figure 32A Provides histograms of the collection at 24 hours and 48 hours for soluble BCMA-PE or anti-Whitlow.PE detection of the circular RNA construct.Figure 32B and Figure 32C Provide the gMFI and sBCMA-PE expression % within 24 - 72 hours for each construct after CD3+ cells containing circular RNA have been co-cultured with multiple myeloma (MM1S) cells. Figure 32D and Figure 32E Provide the gMFI and sBCMA-PE expression % at 72 hours after electroporation for each construct after CD3+ cells containing circular RNA have been co-cultured with multiple myeloma (MM1S) cells, NCI-H929 (designated as "H929" in the figures), Nalm6, or K562.CD19 cells. "C", "G", "H", "A", "I", and "J" correspond to "DNA template C", "DNA template G", "DNA template H", "DNA template A", "DNA template I", and "DNA template J" used to form circular RNA. "Mock" in the figures represents data of control T cells not electroporated with circular RNA.

[0490] Figures 33A to 33C Depict the cytotoxicity of circular RNA constructs encoding BCMA-41BBζ chimeric antigen receptor (CAR) against various cell types within 0 to 72 or 96 hours after co-culture, wherein the circular RNA contains BCMA sequences and IRES sequences from Table α1, β, or γ CD19-CD28ζ CAR or HER2-CD28ζ CAR. Figure 33A Provide the cytotoxicity of each circular RNA encoding a CAR construct against MM1S cells at a dose of 10 or 30 ng per 0.1X10 6 T cells. Mock T cells (i.e., T cells not electroporated with circular RNA designated as "Mock" in the figures) and Figure 33A MM1S cells not co-cultured with T cells designated as "MM1S" in the figures are used as controls. Figure 33B Provide the cytotoxicity of each circular RNA encoding a CAR construct against Nalm6 cells at a dose of 10 or 30 ng per 0.1X10 6 T cells. Mock T cells (i.e., T cells not electroporated with circular RNA designated as "Mock" in the figures) and Figure 33B Nalm6 cells not co-cultured with T cells designated as "Nalm6" in the figures are used as controls. Figure 33C Provide the cytotoxicity of each circular RNA encoding a CAR construct against CD19 T stable cell line at a dose of 20 ng per 0.1X10 6 T cells. Mock T cells (i.e., tumor T cells not electroporated with circular RNA designated as "Mock" in the figures) and Figure 33CThe CD19 T stable cells not co-cultured with T cells, referred to as "tumors" in the text, were used as controls. The cytotoxicity percentage was calculated as (green area + red area / green area) generated by live cell analysis combined with system imaging. "A", "B", "C", "F", and "K" correspond to "DNA template A", "DNA template B", "DNA template C", "DNA template F", and "DNA template K" used to form circular RNAs.

[0491] Figures 34A to 34C Cytotoxicity analysis of various engineered circular RNAs across multiple cell types is depicted. Figure 34A FACS imaging of cells (such as lymphocytes, CD3-negative cells, live cells, and BCMA-positive cells) is provided 24 hours after co-culturing oCAR-T cells formed by introducing circular RNAs containing 3' Anabeana exon, Caprine Kobuvirus internal ribosome entry site (IRES), BCMA-41BBζ CAR, and 5' Anabeana exon. Figure 34B Shows Figure 24B the percentage of cytotoxicity obtained from circular RNAs encoding BCMA-41BBζ, CD19-CD28ζ, or HER2-CD28ζ CAR on MM1S ( Figure 34B ) or Nalm6 (Figure 24C). As Figure 34C depicted in

[0492] Figure 35A "MM1S + mimic" and "MM1S" refer to MM1S cells co-cultured with T cells not transfected with circular RNAs. As Figure 35B depicted in

[0493] Figures 36A to 36D FACS imaging of "mimic + MM1S" (i.e., MM1S tumor cells co-cultured with T cells not electroporated with circular RNAs), "mimic + Nalm6" (i.e., Nalm6 tumor cells co-cultured with T cells not electroporated with circular RNAs), "mimic + H929" (i.e., NCI-H929 tumor cells co-cultured with T cells not electroporated with circular RNAs), and "mimic + K562.CD19" (i.e., K562.CD19 tumor cells co-cultured with T cells not electroporated with circular RNAs) is depicted. Figure 35B FACS imaging of CD19+CD3+ cells is depicted.

[0493] Figures 36A to 36DDepicting circular RNA electroporation that has originated from DNA templates in Table α1, Table β, and / or Table γ1 and later co-cultured with target cells (such as MM1S( Figure 36A ), NCI-H929 (depicted as “H929” in Figure 36B ), Nalm6( Figure 36C ), or K562.CD19.36D)), the percentage of target cell survival (top) and the percentage of target cell killing by T cells (bottom) at 24 (left) or 48 (right) hours after co-culture. “Mock+MM1S” (i.e., MM1S tumor cells co-cultured with T cells not electroporated with circular RNA), “Mock+Nalm6” (i.e., Nalm6 tumor cells co-cultured with T cells not electroporated with circular RNA), “Mock+H929” (i.e., NCI-H929 tumor cells co-cultured with T cells not electroporated with circular RNA), and “Mock+K562.CD19” (i.e., K562.CD19 tumor cells co-cultured with T cells not electroporated with circular RNA). “A”, “G”, “C”, “F”, “H”, “I”, and “J” correspond to “DNA template A”, “DNA template G”, “DNA template C”, “DNA template F”, “DNA template H”, “DNA template I”, and “DNA template J” used to form circular RNA.

[0494] Figure 37A and Figure 37B Depicting the INγ cytokine secretion produced by circular RNAs encoding BCMA-41BBζ, CD19-CD28ζ, and HER2-CD28ζ CARs at doses of 10, 30, or 100 ng per 0.1X10 6 T cells on MM1S( Figure 37A ) or Nalm6( Figure 37B ) cells after co-culture of MM1S or Nalm6 with T cells containing circular RNA. The cytotoxicity level was calculated by a cytokine and chemokine kit (such as MSD). “MM1S+Mock” refers to MM1S tumor cells co-cultured with T cells not electroporated with circular RNA. “MM1S” refers to tumor cells not co-cultured with T cells. “Nalm6+Mock” refers to Nalm6 tumor cells co-cultured with T cells not electroporated with circular RNA. “Nalm6” refers to tumor cells not co-cultured with T cells. “A”, “B”, “C”, “F”, and “K” correspond to “DNA template A”, “DNA template B”, “DNA template C”, “DNA template F”, and “DNA template K” used to form circular RNA.

[0495] Figures 38A to 38PDepict cytokine levels (pg / mL) in co-cultured T cells and target cells containing circular RNAs encoding BMCA-41BBζ, BCMA-CD28ζ, or CD19-CD28ζ CAR at 24 hours and 48 hours (left and right, respectively, in each figure). Target cells include MM1S( Figure 38A , Figure 38E , Figure 38I and Figure 38M ), NCI-H929 (designated as “H929”)( Figure 38B , Figure 38F , Figure 38J , Figure 38N ), Nalm6( Figure 38C , Figure 38G , Figure 38K , Figure 38O ), and K562.CD19( Figure 38D , Figure 38H , Figure 38L , Figure 38P ). Figures 38A to 38D Provide INFγ cytokine levels, Figures 38E to 38H Provide TNFα cytokine levels, Figures 38I to 38L Provide IL-2 cytokine levels, and Figures 38M to 38P GM-CSF levels. “A”, “G”, “C”, “F”, “H”, “I”, and “J” correspond to “DNA template A”, “DNA template G”, “DNA template C”, “DNA template F”, “DNA template H”, “DNA template I”, and “DNA template J” used to form the circular RNAs.

[0496] Figure 39 Depict the percentage of apoptosis of target cells (e.g., Nalm6) collected from a live cell analysis combination system (e.g., IncuCyte) within 72 hours after introduction of circular RNAs encoding HER2 CAR (e.g., apoptotic target cell % = (green area + red area) / green area). The green area indicates the target cells. The red area indicates the annexin V reagent present in apoptotic cells. For the control, Nalm6 without circular RNAs was used.

[0497] Figures 40A to 40C Depict the annexin V / phase % after introduction of circular RNAs encoding HER2.28ζ, HER2.BBζ, or CD19.28ζ CAR into activated PBMC T cells and co-culture in HER2-positive cells of BT474( Figure 40A ), SKBR3( Figure 40B ), and JIMT1( Figure 40C ). For comparison purposes, activated PBMC T cells lacking any circular RNAs (designated as “mock”) were used.Figures 40A to 40C The "Annexin V / % positive" mentioned in [[ ]] refers to the percentage of apoptotic cells / % positive. "K", "L", and "M" correspond to "DNA template K", "DNA template L", and "DNA template M" for forming circular RNA.

[0498] Figure 41A Depicts CAR expression of cryopreserved and fresh LNP delivery of three different circular RNA constructs encoding HER2 CAR. "Mock" cells are T cells given empty LNP (without circular RNA). Figure 41B Provides the cytotoxicity % collected from live cell analysis of a combined system (e.g., IncuCyte) of T cells containing circular RNA constructs encoding HER2-28ζ, HER2-BBζ, or CD19-28ζ CAR co-cultured with BT-474 target cells at a 1:1 E:T ratio, where the circular RNA is delivered with fresh or cryopreserved LNP. Fresh and cryopreserved LNP contain the ionizable lipids from Table 3. Figure 41C Provides cytokine release ([[]] Figure 41C Top panel: INFγ and [[ ]] Figure 41C Bottom panel: TNFα) produced by T cells co-cultured in BT-474 for each of the circular RNA constructs. "K", "L", and "F" correspond to "DNA template K", "DNA template L", and "DNA template F" for forming circular RNA. "Fresh" indicates that the LNP was not previously cryopreserved. "Cryopreserved" indicates that the LNP was previously cryopreserved.

[0499] Figures 42A to 42L Depicts anti-HER2 expression of circular RNA encoding HER2.28ζ, HER2.BBζ, or CD19.28ζ CAR delivered intravenously and using lipid nanoparticles to JIMT-1 ([[ ]] Figures 42A to 42L ) and BT-474 ([[ ]] Figures 42G to 42L ) mouse models. Figures 42C to 42F Is [[ ]] Figures 42A to 42B Some spider plots of the data collected in [[ ]]. Figures 42I to 42L Is [[ ]] Figure 42G And [[ ]] Figure 42H Spider plots of the data collected in [[ ]]. "K", "L", and "F" correspond to "DNA template K", "DNA template L", and "DNA template F" for forming circular RNA. "Fresh" indicates that the LNP was not previously cryopreserved. "Cryopreserved" indicates that the LNP was previously cryopreserved.

[0500] Figure 43A -D shows CAR expression after electroporation in circular RNA constructs containing an IRES sequence, anti-HER2 CAR, and 28z domain (HER2_9, HER2_1, HER2_3, HER2_4, described herein in Table 9).

[0501] Figure 44A -D shows CAR expression after electroporation in circular RNA constructs containing an IRES sequence, an anti-HER2 CAR, and a BBz domain (HER2_10, HER2_5, HER2_7, HER2_8, described herein in Table 9).

[0502] Figure 45A and Figure 45B shows the performance of circular RNA constructs containing an IRES sequence, an anti-HERx CAR, and a 28z or BBz domain (HER2_10, HER2_5, HER2_7, HER2_8) compared to controls (3273 (baseline) and mock) in BT474 target cells.

[0503] Figure 46 shows an exemplary method for evaluating the ability of circular RNA containing an anti-CD19 CAR (in situ CAR or isCAR TM ) to deplete human B cells in a CD34+ engrafted humanized mouse model.

[0504] Figure 47 shows an exemplary flow cytometry panel for autoimmune research.

[0505] Figure 48A -C shows B cell depletion mediated by circular RNA containing an anti-CD19 CAR.

[0506] Figure 49A -C shows splenic B cells depleted in mice treated with circular RNA encoding a reporter gene (mWasabi) encapsulated in lipid nanoparticles as described herein.

[0507] Figure 50 shows an exemplary method for evaluating RAJI controls in NK cells in NOG-IL15 mice using circular RNA containing an anti-CD19 CAR.

[0508] Figure 51 Shows NOG-IL15 mice implanted with the CD19+ Raji-luc cell line on day 0. On day 3, primary human NK cells were purified from peripheral blood and implanted into recipient animals. On day 8, mice were left untreated or treated i.v. with vehicle, LNP-1 mg / kg mOX40L CAR, or 1 mg / kg LNP-CD19 CAR. Mice were treated every two days for 10 doses. Tumor burden was imaged using IVIS imaging. Data show that mice treated with LNP-CD19 CAR exhibited tumor control until the study endpoint at day 24.

[0509] Figure 52 Disclosed are exemplary methods for evaluating circular RNAs in macrophages.

[0510] Figure 53 Disclosed is an exemplary FACS gating strategy for establishing delivery of circular RNAs to monocytes as applied elsewhere herein.

[0511] Figure 54A -D shows mOX40L expression in myeloid cells in the bone marrow.

[0512] Figure 55A -G shows mOX40L expression in CD33+CD14+ and CD14- cells in the bone marrow.

[0513] Figure 56A -G shows mOX40L expression in CD33+CD64+ and CD64- cells in the bone marrow.

[0514] Figure 57A -D shows mOX40L expression in myeloid cells in the spleen.

[0515] Figure 58A -G shows mOX40L expression in CD33+CD14+ and CD14- cells in the spleen.

[0516] Figure 59A -G shows mOX40L expression in CD33+CD64+ and CD64- cells in the spleen.

[0517] Figure 60A and Figure 60B Shows in vivo tumor control of circular RNAs encoding BCMA CAR (BCMA oCAR, BCMA_7, and BCMA_3) when administered EOD in two donors compared to HER2 and untreated controls.

[0518] Figure 61A and Figure 61B Shows in vivo tumor control of circular RNAs encoding BCMA CAR (BCMA oCAR, BCMA_7) when administered once a week (QW) in multiple donors compared to HER2 and untreated controls.

[0519] Figure 62 Shows in vivo tumor control of circular RNAs encoding BCMA CAR (BCMA oCAR, BCMA_7, and BCMA_3) in exemplary IVIS images when administered every other day (EOD) and once a week (QW) compared to HER2 and untreated controls. Detailed Description

[0520] Reference will now be made in detail to certain embodiments of the present invention, examples of which are illustrated in the accompanying drawings. While the invention is described in connection with the illustrated embodiments, it is understood that it is not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents as may be included within the invention as defined by the appended claims and the included embodiments.

[0521] Before the present teachings are described in detail, it is to be understood that this disclosure is not limited to particular compositions or method steps, and may thus vary. It should be noted that, unless the context clearly dictates otherwise, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents. Thus, for example, reference to "a guide" includes a plurality of guides, and reference to "a cell" includes a plurality of cells and the like.

[0522] Numeric ranges include the numbers defining the range. Measured and measurable values should be understood as approximate, taking into account significant figures and errors associated with measurements. In addition, the use of "comprise / comprises / comprising", "contain / contains / containing", and "include / includes / including" is not intended to be limiting. It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and do not limit the teachings.

[0523] Unless specifically stated otherwise in this specification, an embodiment recited in this specification as "comprising" various components also encompasses an embodiment "consisting of" or "consisting essentially of" the recited components; an embodiment recited in this specification as "consisting of" various components also encompasses an embodiment "comprising" the recited components or "consisting essentially of" the recited components; and an embodiment recited in this specification as "consisting essentially of" various components also encompasses an embodiment "consisting of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). Unless the context clearly dictates otherwise, the term "or" is used in an inclusive sense, i.e., equivalent to "and / or".

[0524] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter required in any way. In the event of any conflict between any material incorporated by reference and any term defined in this specification or any other statement of this specification, this specification shall govern. While the present teachings are described in connection with various embodiments, it is not intended to limit the present teachings to such embodiments. On the contrary, as will be appreciated by those skilled in the art, the present teachings cover various alternatives, modifications, and equivalents.

[0525] I. Definitions

[0526] Unless otherwise indicated, the following terms and phrases as used herein are intended to have the following meanings:

[0527] As used herein, the terms "circular RNA", "circular polynucleotide", "circular RNA", "circularized RNA", or "circRNA" are used interchangeably and refer to a single-stranded RNA polynucleotide in which the 3' and 5' ends that are typically present in a linear RNA polynucleotide have been joined together.

[0528] As used herein, the term "DNA template" refers to a DNA sequence capable of transcribing a linear RNA polynucleotide. By way of example and not limitation, a DNA template can include a DNA vector, a PCR product, or a plasmid.

[0529] As used herein, the term "3' group I intron fragment" refers to a sequence having 75% or greater similarity to the 3'-proximal end of a native group I intron including the splice site dinucleotide and optionally a run of native exon sequences. In some embodiments, the circular RNA contains a spliced 3' group I intron fragment. In some embodiments, the spliced 3' group I intron fragment in the circular RNA is a spliced extension of an exon sequence. In some embodiments, the circular RNA further contains a desired expression sequence, and the spliced extension of the exon sequence (e.g., designed) is part of the desired expression sequence, adjacent to the desired expression sequence, and / or in frame with the desired expression sequence.

[0530] As used herein, the term "5' group I intron fragment" refers to a sequence having 75% or greater similarity to the 5'-proximal end of a native group I intron including the splice site dinucleotide and optionally a run of native exon sequences. In some embodiments, the circular RNA contains a spliced 5' group I intron fragment. In some embodiments, the spliced 5' group I intron fragment in the circular RNA is a spliced extension of an exon sequence. In some embodiments, the circular RNA further contains a desired expression sequence, and the spliced extension of the exon sequence (e.g., designed) is part of the desired expression sequence, adjacent to the desired expression sequence, and / or in frame with the desired expression sequence.

[0531] As used herein, the term "permutation site" refers to a site in a group I intron where cleavage occurs prior to intron permutation. This cleavage generates 3' and 5' group I intron fragments that are permuted to be on either side of a stretch of precursor RNA to be circularized.

[0532] As used herein, the term "splice site" refers to a dinucleotide that is partially or fully included within a Group I intron and between which the phosphodiester bond is cleaved during RNA cyclization. (As used herein, a "splice site" refers to one or more dinucleotides at which phosphodiester bond cleavage occurs during a splicing reaction. A "5' splice site" refers to the native 5' dinucleotide of an intron, such as a Group I intron, and a "3' splice site" refers to the native 3' dinucleotide of an intron).

[0533] As used herein, the term "expression sequence" refers to a nucleic acid sequence that encodes a product such as a peptide or polypeptide, a regulatory nucleic acid, or a non-coding nucleic acid. Exemplary expression sequences encoding a peptide or polypeptide may comprise a plurality of nucleotide triplets, each of which may encode an amino acid and is referred to as a "codon".

[0534] As used herein, a "coding element" or "coding region" is a region that is located within and encodes for one or more proteins or polypeptides (e.g., a therapeutic protein).

[0535] As used herein, a "noncoding element", "noncoding region", or "non-coding nucleic acid" is a region that is located within an expression sequence. This sequence does not itself encode a protein or polypeptide, but may have other regulatory functions, including (but not limited to) allowing the entire polynucleotide to serve as a biomarker or adjuvant for a particular cell.

[0536] As used herein, the term "therapeutic protein" refers to any protein that has a therapeutic, diagnostic, and / or prophylactic effect and / or elicits a desired biological and / or pharmacological effect when administered directly or indirectly to a subject in the form of a translated nucleic acid.

[0537] As used herein, the term "immunogenic" refers to the potential to induce an immune response against a substance. An immune response can be induced when the immune system of an organism or a particular type of immune cell is exposed to an immunogenic substance. The term "non-immunogenic" refers to the absence or lack of an immune response against a substance above a detectable threshold. No immune response is detected when the immune system of an organism or a particular type of immune cell is exposed to a non-immunogenic substance. In some embodiments, when measured by an immunogenicity assay, the non-immunogenic circular polynucleotides provided herein do not induce an immune response above a predetermined threshold. In some embodiments, no innate immune response is detected when the immune system of an organism or a particular type of immune cell is exposed to the non-immunogenic circular polynucleotides provided herein. In some embodiments, no adaptive immune response is detected when the immune system of an organism or a particular type of immune cell is exposed to the non-immunogenic circular polynucleotides provided herein.

[0538] As used herein, the term "translation efficiency" refers to the rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as the amount of protein or peptide produced per a given amount of transcript encoding the protein or peptide.

[0539] The term "nucleotide" refers to ribonucleotides, deoxyribonucleotides, their modified forms or analogs thereof. Nucleotides include substances that contain purines such as adenine, hypoxanthine, guanine and their derivatives and analogs, and pyrimidines such as cytosine, uracil, thymine and their derivatives and analogs. Nucleotide analogs include nucleotides having modifications in the chemical structure of the base, sugar and / or phosphate moiety, including but not limited to modification of the pyrimidine at the 5' position, modification of the purine at the 8' position, modification of the exocyclic amine of cytosine and substitution of 5-bromo-uracil; and modification of the sugar at the 2' position, including but not limited to ribonucleotides with sugar modifications, where the 2'-OH is replaced by a group such as H, OR, R, halogen, SH, SR, NH2, NHR, NR2 or CN, where R is an alkyl moiety as defined herein. Nucleotide analogs are also intended to include nucleotides having: bases such as inosine, Q nucleoside, xanthine; sugars such as 2'-methyl ribose; non-natural phosphodiester linkages such as methylphosphonate, phosphorothioate and peptide linkages. Nucleotide analogs include 5-methoxyuridine, 1-methylpseudouridine and 6-methyladenosine.

[0540] "Polynucleotide", "nucleic acid", and "nucleic acid molecule" are used interchangeably herein to refer to a polymeric compound containing nucleosides or nucleoside analogs having nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, hybrid RNA-DNA, and polymers that are analogs thereof. The term can be used to describe polymers of any length, for example greater than about 2 bases, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, greater than 1000 bases, or up to about 10,000 or more bases, composed of nucleotides such as deoxyribonucleotides or ribonucleotides, and can be produced enzymatically or synthetically (e.g., as described in U.S. Patent No. 5,948,902 and references cited therein), which can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to the way two naturally occurring nucleic acids do, e.g., can participate in Watson-Crick base pairing interactions. The nucleic acid "backbone" can consist of multiple linkages, including one or more of sugar-phosphate diester linkages, peptide-nucleic acid bonds ("peptide nucleic acid" or PNA; PCT WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or a similar compound having substitutions (e.g., 2'-methoxy or 2'-halo substitutions). The nitrogenous bases can be conventional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine or others), inosine; derivatives of purines or pyrimidines (e.g., N 4-Methyldeoxyguanosine, deazapurine or azapurine, deazapyrimidine or azapyrimidine, pyrimidine bases having substituents at the 5- or 6-position (e.g., 5-methylcytosine), purine bases having substituents at the 2-, 6- or 8-position, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O4-alkyl-pyrimidine; U.S. Patent No. 5,378,825 and PCT No. WO 93 / 13121). For general discussion, see The Biochemistry of the Nucleic Acids 5-36, edited by Adams et al., 11th Edition, 1992). Nucleic acids may include one or more “abasic” residues where the backbone does not include a nitrogenous base for a polymer position (U.S. Patent No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may include both conventional components and substitutions (e.g., conventional bases with 2'-methoxy linkages, or polymers containing both conventional bases and one or more base analogs). All nucleotide sequences disclosed herein may be represented as RNA sequences or corresponding DNA sequences. It should be understood that deoxythymidine (dT or T) in DNA is transcribed as uridine (U) in RNA. Thus, in nucleotide sequences, “T” and “U” may be used interchangeably herein.

[0541] An “oligonucleotide” is a polynucleotide containing fewer than 1000 nucleotides, e.g., a polynucleotide containing fewer than 500 nucleotides or fewer than 100 nucleotides.

[0542] As used herein, the terms "single intron", "single intron sequence", or "single intron element" are used interchangeably to refer to a precursor RNA polynucleotide segment located at the 5' or 3' end of a polynucleotide, i.e., from the 5' or 3' end of an intervening region. A single intron element refers to a sequence having 70% or greater similarity to a native group I or II intron (including the splice site dinucleotide). In some embodiments, the single intron is capable of conferring ribonuclease activity that permits its enzymatic self-cleavage. In some embodiments, the single intron is capable of forming a phosphodiester bond with a terminal sequence (i.e., a sequence containing the splice site dinucleotide and optionally a native exon sequence or a fragment thereof). In some embodiments, the terminal sequence is upstream of the single intron in the linear precursor. In some embodiments, the single intron sequence is upstream of the terminal sequence in the linear precursor. When the terminal sequence is upstream of the single intron in the linear precursor, the single intron can undergo two transesterification reactions, such as sequential self-cleavage and formation of a phosphodiester bond with the terminal sequence. In embodiments where the terminal sequence is upstream of the single intron in the linear precursor, (a) the single intron is capable of interacting with a nucleophile capable of cleaving at the splice site dinucleotide at or near the 5' end of the single intron, and (b) the cleavage product of (a) (i.e., the 5' splice site nucleotide, e.g., having a 3' hydroxyl) engages in a transesterification reaction (cleavage) at the splice site nucleotide of the terminal sequence, resulting in a circular RNA or oRNA. In these embodiments, the single intron interacts with the nucleophile by forming a binding pocket for the nucleophile (e.g., guanosine, e.g., free guanosine introduced into the precursor), and the linear precursor is capable of adopting a conformation in which the nucleophile is proximate to the splice site dinucleotide at or near the 5' end of the single intron and is capable of cleaving at the splice site dinucleotide. When the single intron is upstream of the terminal sequence in the linear precursor, the single intron can also undergo two transesterification reactions. In embodiments where the single intron is upstream of the terminal sequence in the linear precursor, (a) the single intron is capable of interacting with a nucleophile capable of cleaving at the splice site nucleotide of the terminal element, and (b) the cleavage product of (a), i.e., the 5' splice site nucleotide, e.g., having a 3' hydroxyl, undergoes a transesterification reaction (cleavage) at or near the 3' end of the single intron at the splice site dinucleotide, yielding a circular RNA or oRNA. In these embodiments, the single intron interacts with the nucleophile by forming a binding pocket for the nucleophile (e.g., guanosine, e.g., free guanosine introduced into the precursor), and the linear precursor is capable of adopting a conformation in which the nucleophile is proximate to the splice site nucleotide of the terminal element and is capable of cleaving the splice site nucleotide of the terminal element.

[0543] In some embodiments, a single intron comprises the 5'-proximal end of a native group I or group II intron, including the splice site dinucleotide and optionally a native exon sequence or a fragment thereof. In some embodiments, the 5'-end of a single intron refers to the nucleotides within the 5'-half of the single intron. In some embodiments, the 3'-end of a single intron refers to the nucleotides within the 3'-half of the single intron. In some embodiments, at or near the 5'-end of a single intron refers to within the 5'-half of the single intron. In some embodiments, at or near the 5'-end of a single intron refers to within the first ten 5'-positions in the single intron. In some embodiments, at the 5'-end of a single intron refers to the first 5'-positions in the single intron. In some embodiments, at or near the 3'-end of a single intron refers to within the 3'-half of the single intron. In some embodiments, at or near the 3'-end of a single intron refers to within the last ten 3'-positions in the single intron. In some embodiments, at the 3'-end of a single intron refers to the last 3'-positions in the single intron.

[0544] As used herein, the terms "terminal sequence" or "terminal element" are used interchangeably to refer to an RNA sequence capable of complexing with a single intron sequence or a single intron element. The terminal sequence comprises the splice site nucleotides from a native group I or group II intron present in the single intron. In some embodiments, the terminal sequence further comprises a native exon or a fragment thereof and / or a synthetic sequence.

[0545] The term "nucleophile" refers to a nucleophilic nucleotide or nucleoside capable of initiating a nucleophilic attack at the splice site and / or undergoing a transesterification reaction (cleavage) at the splice site.

[0546] As used herein, "polyA" means a polynucleotide or a portion of a polynucleotide composed of nucleotides containing adenine. As used herein, "polyT" means a polynucleotide or a portion of a polynucleotide composed of nucleotides containing thymine. As used herein, "polyAC" means a polynucleotide or a portion of a polynucleotide composed of nucleotides containing adenine or cytosine.

[0547] "Isolated" or "purified" generally refers to the isolation of a substance (e.g., in some embodiments, a compound, polynucleotide, protein, polypeptide, polynucleotide composition, or polypeptide composition) such that the substance comprises a significant percentage of the sample in which it is present (e.g., greater than 1%, greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, typically up to about 90%-100%). In certain embodiments, the substantially purified component comprises at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the sample. In additional embodiments, the substantially purified component comprises about 80%-85% or 90%-95%, 95%-99%, 96%-99%, 97%-99%, or 95%-100% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion-exchange chromatography, affinity chromatography, and density-based sedimentation. Generally, a substance is purified when it is present in a sample in an amount that exceeds its naturally occurring amount relative to other components of the sample.

[0548] As used herein, "unstructured" with respect to an RNA refers to an RNA sequence that is not predicted by an RNA structure prediction tool to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule. In some embodiments, unstructured RNAs can be functionally characterized using nuclease protection assays.

[0549] As used herein, "structured" with respect to an RNA refers to an RNA sequence that is predicted by RNAFold software or a similar prediction tool to form a structure (e.g., a hairpin loop) with itself or other sequences in the same RNA molecule.

[0550] As used herein, two "duplex sequences", "duplex region / duplex regions", "homologous arms", or "homologous regions" can be any two regions that are thermodynamically favorable for cross-pairing in a sequence-specific interaction. In some embodiments, the two duplex sequences, duplex regions, homologous arms, or homologous regions share a sufficient level of sequence identity with the reverse complementary sequences of each other to serve as substrates for a hybridization reaction. As used herein, a polynucleotide sequence has "homology" when it is identical or shares sequence identity with a reverse complementary sequence or "complementary" sequence. The percentage of sequence identity between a homologous region and the reverse complementary sequence of the corresponding homologous region can be any percentage of sequence identity that permits hybridization to occur. In some embodiments, the internal duplex regions of the polynucleotides of the present invention are capable of forming duplexes with another internal duplex region and not with an external duplex region.

[0551] As used herein, an "affinity sequence" or "affinity tag" is a region of a polynucleotide sequence that contains a repetitive set of nucleotides, in the range of 1 nucleotide to hundreds or thousands of nucleotides, for the purpose of facilitating the purification of a polynucleotide sequence. For example, an affinity sequence can include, but is not limited to, polyA or polyAC sequences. In some embodiments, an affinity tag is used in a purification method referred to herein as "affinity purification," where selective binding of a binder to a molecule containing the affinity tag facilitates separation from molecules that do not contain the affinity tag. In some embodiments, the affinity purification method is a "negative selection" purification method, where unwanted materials such as linear RNA are selectively bound and removed, and desired materials such as circular RNA are eluted and separated from the unwanted materials.

[0552] As used herein, a "spacer" refers to a region of a polynucleotide sequence that separates two other elements, in the range of 1 nucleotide to hundreds or thousands of nucleotides. The sequence can be defined or can be random. A spacer is typically non-coding. In some embodiments, a spacer includes a duplex region.

[0553] A linear nucleic acid molecule is said to have a "5'-end" and a "3'-end" because of the presence of nucleic acid phosphodiester linkages at the 5'- and 3'-carbons of the sugar moiety of the substituent mononucleotide. The terminal nucleotide of a polynucleotide with a new linkage at the 5'-carbon is its 5'-terminal nucleotide. The terminal nucleotide of a polynucleotide with a new linkage at the 3'-carbon is its 3'-terminal nucleotide. As used herein, a terminal nucleotide is a nucleotide at the terminal position of a 3'-end or 5'-end.

[0554] As used herein, a "leader untranslated sequence" is a region of a polynucleotide sequence, in the range of 1 nucleotide to hundreds of nucleotides, located at the uppermost 5'-end of the polynucleotide sequence. The sequence can be defined or can be random. A leader untranslated sequence is non-coding.

[0555] As used herein, a "terminal untranslated sequence" is a region of a polynucleotide sequence, in the range of 1 nucleotide to hundreds of nucleotides, located at the lowermost 3'-end of the polynucleotide sequence. The sequence can be defined or can be random. A terminal untranslated sequence is non-coding.

[0556] "Transcription" means the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template. The present disclosure is not limited with respect to the RNA polymerase used for transcription. For example, in some embodiments, a T7-type RNA polymerase can be used.

[0557] "Translation" means the formation of polypeptide molecules by ribosomes based on an RNA template.

[0558] As used herein, "internal ribosome entry site" or "IRES" refers to an RNA sequence or structural element, ranging in size from 10 nt to 1000 nt or greater, that is capable of initiating polypeptide translation in the absence of a typical RNA cap structure. The length of an exemplary IRES can be from about 500 nt to about 700 nt.

[0559] As used herein, the term "about" or "approximately" means an acceptable error of a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. Unless explicitly stated or obvious from the context, as used herein, the term "about" is understood to be within the normal tolerances in the art, e.g., within 2 standard deviations of the mean. All numerical values provided herein are modified by the term "about" unless the context clearly dictates otherwise.

[0560] As used herein, the term "encode" broadly refers to any method of using the information in a polymeric macromolecule to direct the production of a second molecule that is different from the first molecule. The second molecule can have a chemical structure that is different from the chemical properties of the first molecule.

[0561] As used herein, an "aptamer" generally refers to an oligonucleotide of a single defined sequence or a mixture of such nucleotides, where the mixture retains the property of specifically binding to a target molecule (e.g., eukaryotic initiation factors, 40S ribosomes, polyC-binding protein, polyA-binding protein, polypyrimidine tract-binding protein, argonaute protein family, heterogeneous nuclear ribonucleoprotein K and La, and related RNA-binding proteins). Thus, as used herein, "aptamer" refers to both single and multiple sequences of nucleotides as defined above. The term "aptamer" is intended to refer to single-stranded or double-stranded nucleic acids capable of binding to a protein or other molecule. Generally, aptamers preferably comprise from about 10 to about 100 nucleotides, more preferably from about 15 to about 40 nucleotides, and even more preferably from about 20 to about 40 nucleotides, since oligonucleotides of lengths within these ranges are readily prepared by conventional techniques. Optionally, an aptamer can also comprise at least approximately 6 nucleotides, preferably 10, and more preferably 14 or 15 nucleotides necessary to achieve specific binding.

[0562] As used herein, "miRNA site" or "miRNA binding site" refers to an extension of nucleotides within a polynucleotide that is capable of forming a duplex with at least 8 nucleotides of a native miRNA sequence.

[0563] As used herein, "bicistronic RNA" refers to a polynucleotide comprising two expression sequences encoding two different proteins. These expression sequences may be separated by a nucleotide sequence encoding a cleavable peptide, such as a protease cleavage site. They may also be separated by a ribosomal skipping element.

[0564] As used herein, the term "ribosomal skipping element" refers to a nucleotide sequence encoding a short peptide sequence that enables the translation of two peptide chains from one RNA molecule. Without wishing to be bound by theory, it is hypothesized that ribosomal skipping elements act by: (1) terminating the translation of the first peptide chain and reinitiating the translation of the second peptide chain; or (2) cleavage of the peptide bond in the peptide sequence encoded by the ribosomal skipping element by an internal protease activity of the encoded peptide or by another protease in the environment (e.g., cytosol).

[0565] As used herein, the term "transfect" or "transfection" refers to the intracellular introduction of one or more encapsulated materials (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably into a target cell. The term "transfection efficiency" refers to the relative amount of such encapsulated materials (e.g., polynucleotides) taken up by and / or expressed by the target cells transfected by the introduction. In some embodiments, the transfection efficiency can be estimated by the amount of reporter polynucleotide product produced by the target cells after transfection. In some embodiments, the transfer vehicle has a high transfection efficiency. In some embodiments, the transfer vehicle has a transfection efficiency of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0566] As used herein, "transfer vehicle" includes any of the standard pharmaceutical carriers, diluents, excipients, etc. commonly contemplated for use in the administration of bioactive agents including nucleic acids.

[0567] As used herein, the phrase "nanoparticle" refers to a delivery or transfer vehicle having, for example, a diameter of less than about 1000 nm. Nanoparticles may be "lipid nanoparticles", and in certain instances herein, the terms may be used interchangeably.

[0568] As used herein, the phrase "LNP" or "lipid nanoparticle" refers to a transfer vehicle comprising one or more cationic lipids or ionizable lipids, stabilizing lipids, structural lipids, and helper lipids.

[0569] As used herein, the phrase "cationic lipid" or "ionizable lipid" refers to any of a variety of lipid substances that carry a net positive charge at a selected pH, such as physiological pH 4, and a neutral charge at other pHs, such as physiological pH 7.

[0570] In some embodiments, the lipids, such as ionizable lipids, disclosed herein include one or more cleavable groups. The terms "cleave" and "cleavable" are used herein to mean that one or more chemical bonds (e.g., one or more of covalent bonds, hydrogen bonds, van der Waals' forces, and / or ionic interactions) between atoms in or adjacent to the subject functional group break (e.g., hydrolyze) or are capable of breaking after exposure to selected conditions (e.g., after exposure to enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in specific embodiments, a disulfide group that is capable of cleaving after exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional group that is capable of cleaving after exposure to selected biological conditions. For example, a disulfide group can be cleaved enzymatically or by hydrolysis, oxidation, or reduction reactions. After cleavage of this disulfide functional group, one or more functional moieties or groups (e.g., one or more of a head group and / or a tail group) bound thereto can be released. Exemplary cleavable groups can include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl and aryl esters). In certain embodiments, the cleavable group is not an ester group or an ether group. In some embodiments, the cleavable group is bound (e.g., by one or more of hydrogen bonds, van der Waals' forces, ionic interactions, and covalent bonds) to one or more functional moieties or groups (e.g., at least one head group and at least one tail group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head group containing one or more of imidazole, guanidine, amino, imine, enamine, optionally substituted alkylamino, and pyridyl).

[0571] As used herein, the term "liposome" generally refers to a vesicle composed of lipids (such as amphiphilic lipids) arranged in one or more spherical bilayers. Such liposomes can be unilamellar or multilamellar vesicles having a membrane formed of a lipophilic material and an aqueous interior containing the encapsulated circular RNA to be delivered to one or more target cells, tissues, and organs. In certain embodiments, the compositions described herein comprise one or more lipid nanoparticles. Examples of suitable lipids (such as ionizable lipids) that can be used to form the liposomes and lipid nanoparticles encompassed herein include one or more of the compounds disclosed herein (such as HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005). Such liposomes and lipid nanoparticles can also comprise additional ionizable lipids such as C12-200, DLin-KC2-DMA, and / or HGT5001, co-lipids, structural lipids, PEGylated lipids, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE, HGT5000, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLin carbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0572] As used herein, the phrase "biodegradable lipid" or "degradable lipid" refers to any of a variety of lipid substances that decompose in a host environment on the order of minutes, hours, or days, thereby desirably making them less toxic and less likely to accumulate in the host over time. Common modifications of lipids include, in particular, ester bonds and disulfide bonds to enhance the biodegradability of the lipids.

[0573] As used herein, the term "structural lipid" refers to sterols and lipids containing a sterol moiety.

[0574] As defined herein, "sterol" is a subgroup of steroids composed of steroids.

[0575] As used herein, the term "PEG" means any polyethylene glycol or other polyalkylene ether polymer. As commonly defined herein, "PEG-OH lipid" (also referred to herein as "hydroxy-polyethylene glycolylated lipid") is a polyethylene glycolylated lipid having one or more hydroxyl groups (-OH) on the lipid. As used herein, the phrase "biodegradable PEG lipid" or "degradable PEG lipid" refers to any of a variety of lipid species in which the PEG moiety is cleaved from the lipid in a host environment on the order of minutes, hours, or days, thereby desirably rendering it less immunogenic. Common modifications of PEG lipids include, in particular, ester and disulfide bonds to enhance the biodegradability of the lipid.

[0576] As used herein, the term "hydrophilic" is used to qualitatively indicate that a functional group prefers water and generally such groups are water-soluble. For example, compounds are disclosed herein that contain a cleavable disulfide (S-S) functional group attached to one or more hydrophilic groups (e.g., a hydrophilic head group), where such hydrophilic groups include or are selected from the group consisting of imidazole, guanidine, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino such as dimethylamino), and pyridyl.

[0577] In certain embodiments, at least one of the functional groups that includes a moiety of a compound disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail group that includes a naturally occurring lipid such as cholesterol). As used herein, the term "hydrophobic" is used to qualitatively indicate that a functional group avoids water and generally such groups are insoluble in water. For example, compounds are disclosed herein that contain a cleavable functional group (e.g., a disulfide (S-S) group) attached to one or more hydrophobic groups, where such hydrophobic groups include one or more naturally occurring lipids such as cholesterol, and / or optionally substituted, variably saturated or unsaturated C6-C20 alkyl and / or optionally substituted, variably saturated or unsaturated C6-C20 acyl groups.

[0578] The compounds described herein may also contain one or more isotope substitutions. For example, H may be in any isotopic form, including 1H, 2H (D or deuterium), and 3H (T or tritium); C may be in any isotopic form, including 12C, 13C, and 14C; O may be in any isotopic form, including 16O and 18O; F may be in any isotopic form, including 18F and 19F; and so forth.

[0579] Unless otherwise specified, as used herein, the following terms (if any) have the following meanings. It should be understood that when described herein, any of the moieties defined below can be substituted by a variety of substituents, and the corresponding definitions are intended to include such substituted moieties within their scope as described below. Unless otherwise stated, the term "substituted" is defined as set forth below. It should be further understood that the terms "group" and "radical" are considered interchangeable when used herein.

[0580] When a range of values is recited, it is intended to cover each value and subrange within the recited range. For example, "C1-6 alkyl" is intended to cover C1, C2, C3, C4, C5, C6, C1-6, C1-5, C1-4, C1-3, C1-2, C2-6, C2-5, C2-4, C2-3, C3-6, C3-5, C3-4, C4-6, C4-5, and C5-6 alkyls.

[0581] As used herein, the term "alkyl" refers to straight-chain and branched C1-C40 hydrocarbons (such as C6-C20 hydrocarbons), and includes saturated and unsaturated hydrocarbons. In certain embodiments, the alkyl can contain one or more cycloalkyls and / or one or more heteroatoms such as oxygen, nitrogen, or sulfur, and can optionally be substituted with substituents (such as one or more of alkyl, halo, alkoxy, hydroxy, amino, aryl, ether, ester, or amide). In certain embodiments, the alkyls contemplated include (9Z,12Z)-octadeca-9,12-diene. For example, the use of the name "C6-C20" is intended to refer to alkyls having the recited number of carbon atoms (such as straight-chain or branched and including olefins and alkyls). In some embodiments, the alkyl has 1 to 10 carbon atoms ("C1-10 alkyl"). In some embodiments, the alkyl has 1 to 9 carbon atoms ("C1-9 alkyl"). In some embodiments, the alkyl has 1 to 8 carbon atoms ("C1-C8 alkyl"). In some embodiments, the alkyl has 1 to 7 carbon atoms ("C1-7 alkyl"). In some embodiments, the alkyl has 1 to 6 carbon atoms ("C1-6 alkyl"). In some embodiments, the alkyl has 1 to 5 carbon atoms ("C1-5 alkyl"). In some embodiments, the alkyl has 1 to 4 carbon atoms ("C1-4 alkyl"). In some embodiments, the alkyl has 1 to 3 carbon atoms ("C1-3 alkyl"). In some embodiments, the alkyl has 1 to 2 carbon atoms ("C1-2 alkyl"). In some embodiments, the alkyl has 1 carbon atom ("C1 alkyl"). Examples of C1-6 alkyls include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0582] As used herein, "alkenyl" refers to a straight-chain or branched hydrocarbon group having from 2 to 20 carbon atoms, one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds) and optionally one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds) ("C2-20 alkenyl"). In certain embodiments, the alkenyl does not contain any triple bonds. In some embodiments, the alkenyl has from 2 to 10 carbon atoms ("C2-10 alkenyl"). In some embodiments, the alkenyl has from 2 to 9 carbon atoms ("C2-9 alkenyl"). In some embodiments, the alkenyl has from 2 to 8 carbon atoms ("C2-8 alkenyl"). In some embodiments, the alkenyl has from 2 to 7 carbon atoms ("C2-7 alkenyl"). In some embodiments, the alkenyl has from 2 to 6 carbon atoms ("C2-6 alkenyl"). In some embodiments, the alkenyl has from 2 to 5 carbon atoms ("C2-5 alkenyl"). In some embodiments, the alkenyl has from 2 to 4 carbon atoms ("C2-4 alkenyl"). In some embodiments, the alkenyl has from 2 to 3 carbon atoms ("C2-3 alkenyl"). In some embodiments, the alkenyl has 2 carbon atoms ("C2 alkenyl"). One or more carbon-carbon double bonds may be internal (e.g., in 2-butenyl) or terminal (e.g., in 1-butenyl). Examples of C2-4 alkenyl include vinyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), etc. Examples of C2-6 alkenyl include the aforementioned C2-4 alkenyl as well as pentenyl (C5), pentadienyl (C5), hexenyl (C6), etc. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrieneyl (C8), etc.

[0583] As used herein, the term "aryl" refers to an aromatic group containing six to ten carbons in the ring portion (e.g., monocyclic, bicyclic, and tricyclic structures). The aryl may optionally be substituted via available carbon atoms and in certain embodiments may include one or more heteroatoms such as oxygen, nitrogen, or sulfur. In some embodiments, the aryl has six ring carbon atoms ("C6 aryl"; e.g., phenyl). In some embodiments, the aryl has ten ring carbon atoms ("C10 aryl"; e.g., naphthyl, such as 1-naphthyl and 2-naphthyl).

[0584] As used herein, "heteroaryl" refers to a 5- to 10-membered monocyclic or bicyclic 4n+2 aromatic ring system (e.g., having a total of 6 or 10 electrons in the cyclic array) in an aromatic ring system that provides ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("5- to 10-membered heteroaryl"). In a heteroaryl containing one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom when valence permits. A bicyclic heteroaryl system can include one or more heteroatoms in one or both rings. "Heteroaryl" includes ring systems in which a heteroaryl ring as defined above is fused to one or more carbocyclic or heterocyclic groups, where the point of attachment is on the heteroaryl ring, and in such cases, the number of ring members continues to indicate the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which a heteroaryl ring as defined above is fused to one or more aryl groups, where the point of attachment is on the aryl or heteroaryl ring, and in such cases, the number of ring members indicates the number of ring members in the fused (aryl / heteroaryl) ring system. The point of attachment of a bicyclic heteroaryl in which one ring is heteroatom-free (e.g., indolyl, quinolinyl, carbazolyl, etc.) can be on either ring, i.e., the ring with heteroatoms (e.g., 2-indolyl) or the ring without heteroatoms (e.g., 5-indolyl).

[0585] As used herein, "heterocyclyl" or "heterocycle" refers to a group of a 3- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("3- to 10-membered heterocyclyl"). In a heterocyclyl containing one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom when valence permits. A heterocyclyl can be monocyclic ("monocyclic heterocyclyl") or a fused, bridged, or spiro ring system, such as a bicyclic system ("bicyclic heterocyclyl"), and can be saturated or can be partially unsaturated. A bicyclic heterocyclyl system can include one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems in which a heterocyclyl ring as defined above is fused to one or more carbocyclic groups, where the point of attachment is on the carbocyclic or heterocyclyl ring, or in which a heterocyclyl as defined above is fused to one or more aryl or heteroaryl groups, where the point of attachment is on the heterocyclyl ring, and in such cases, the number of ring members continues to indicate the number of ring members in the heterocyclyl ring system. The terms "heterocycle", "heterocyclyl", "heterocyclyl ring", "heterocyclic group", "heterocyclic moiety", and "heterocyclic radical" are used interchangeably.

[0586] As used herein, "cyano" refers to -CN.

[0587] As used herein, the terms "halo" and "halogen" refer to an atom selected from fluorine (F), chlorine (Cl), bromine (Br), and iodine (I). In certain embodiments, the halo group is fluorine or chlorine.

[0588] As used herein, the term "alkoxy" refers to an alkyl group attached to another moiety via an oxygen atom (-O(alkyl)). Non-limiting examples include, for example, methoxy, ethoxy, propoxy, and butoxy.

[0589] As used herein, "oxo" refers to -C=O.

[0590] Generally, the term "substituted", whether preceded by the term "optionally" or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced by an admissible substituent, e.g., a substituent that results in a stable compound (e.g., a compound that does not spontaneously undergo transformation, e.g., by rearrangement, cyclization, elimination, or other reactions). Unless otherwise specified, a "substituted" group has a substituent at one or more of the substitutable positions of the group, and when more than one position in any given structure is substituted, the substituents are the same or different at each position.

[0591] As used herein, "pharmaceutically acceptable salts" refer to salts that, within the scope of reasonable medical judgment, are suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc. and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. described pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts include salts derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts formed by reacting an amino group with an inorganic acid (such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid) or an organic acid (such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid), or salts formed by using other methods used in the art (such as ion exchange). Other pharmaceutically acceptable salts include adipates, alginates, ascorbates, aspartates, benzenesulfonates, benzoates, bisulfates, borates, butyrates, camphorates, camphorsulfonates, citrates, cyclopentanepropionates, digluconates, dodecyl sulfates, ethanesulfonates, formates, fumarates, glucoheptanoates, glycerophosphates, gluconates, hemisulfates, heptanoates, hexanoates, hydroiodides, 2-hydroxyethanesulfonates, lactates, lactobionates, laurates, lauryl sulfates, malates, maleates, malonates, methanesulfonates, 2-naphthalenesulfonates, nicotinates, nitrates, oleates, oxalates, palmitates, pamoates, pectates, persulfates, 3-phenylpropionates, phosphates, picrates, pivalates, propionates, stearates, succinates, sulfates, tartrates, thiocyanates, p-toluenesulfonates, undecanoates, valerates, etc. Pharmaceutically acceptable salts derived from suitable bases include alkali metal, alkaline earth metal, ammonium, and N+(C1-4 alkyl)4 salts. Representative alkali metal or alkaline earth metal salts include sodium salts, lithium salts, potassium salts, calcium salts, magnesium salts, etc. Where appropriate, other pharmaceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide ions, hydroxide, carboxylate, sulfate, phosphate, nitrate, lower alkyl sulfonate, and aryl sulfonate.

[0592] The term "composition" or "formulation" refers to a formulation that is in a form that permits the bioactive ingredient(s) contained therein to be biologically active and that does not contain additional components that are unacceptably toxic to the subject to which the composition will be administered.

[0593] As used herein, "antigen" refers to any molecule that elicits an immune response or is capable of being bound by an antibody or antigen-binding molecule. The immune response can involve antibody production or activation of specific immune-competent cells or both. One of ordinary skill in the art will readily understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. An antigen can be expressed endogenously, i.e., from genomic DNA, or can be expressed recombinantly. An antigen can be specific for a particular tissue, such as cancer cells, or it can be widely expressed. Additionally, fragments of larger molecules can serve as antigens. In some embodiments, the antigen is a tumor antigen.

[0594] As used herein, "treatment" (and variations thereof, such as "treat" or "treating") refers to any administration or application of a therapeutic agent to a subject for a disease or disorder, and includes inhibiting the development of the disease or disorder (which can occur before or after formal diagnosis of the disease, such as in the case where a subject has a genotype that is likely or highly likely to result in the development of the disease), arresting its development, alleviating one or more symptoms of the disease, curing the disease, or preventing recurrence of one or more symptoms of the disease. As used herein, "treatment" can include the administration of a therapeutic agent or treatment regimen (including optional adjuvants or pretreatment regimens) to achieve a therapeutic or prophylactic benefit. As used herein, "treatment" also encompasses "remission," which refers to any beneficial effect on a phenotype or symptom, such as reducing its severity, slowing or delaying its development, arresting its development, or causing partial or complete reversal or elimination thereof.

[0595] As used herein, "cancer" refers to a large group of diverse diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth lead to the formation of malignant tumors that invade adjacent tissues and may also metastasize to distant parts of the body via the lymphatic system or bloodstream. "Cancer" or "cancer tissue" may include tumors. Examples of cancers that can be treated by the methods disclosed herein include (but are not limited to) cancers of the immune system, including lymphoma, leukemia, myeloma, and other white blood cell malignancies. In some embodiments, the methods disclosed herein can be used to reduce the tumor size of tumors derived from, for example: bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal area cancer, stomach cancer, testicular cancer, uterine cancer, multiple myeloma, Hodgkin's Disease, non-Hodgkin lymphoma (NHL), primary mediastinal large B-cell lymphoma (PMBC), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, chronic or acute leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), pediatric solid tumors, lymphocytic lymphoma, bladder cancer, kidney or ureteral cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal cord axis tumors, brainstem gliomas, pituitary adenomas, epidermoid carcinomas, squamous cell carcinomas, T-cell lymphomas; environmentally induced cancers, including asbestos-induced cancers; other B-cell malignancies; and combinations of the foregoing cancers.In some embodiments, the methods disclosed herein can be used to reduce the size of tumors derived from, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, soft tissue sarcomas and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (e.g., pancreatic adenocarcinoma, colon adenocarcinoma, ovarian adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, gastric adenocarcinoma, prostate adenocarcinoma, cervical adenocarcinoma or esophageal adenocarcinoma), sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, liver tumors, cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumors, bladder cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal pelvic cancer, CNS tumors (e.g., glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma and retinoblastoma). Specific cancers may respond to chemotherapy or radiation therapy, or the cancer may be refractory. A refractory cancer is a cancer that is not suitable for surgical intervention and the cancer either does not initially respond to chemotherapy or radiation therapy or the cancer becomes non-responsive over time.

[0596] As used herein, "autoimmune disease" refers to a disease or disorder directed against and / or caused by a subject's own tissues and / or organs. Clinical and laboratory markers of autoimmune diseases are known in the art. Exemplary markers include, but are not limited to, high levels of autoantibodies, antigen-antibody complex deposits (e.g., in subject tissues), lymphocyte aggregates in affected tissues, hypergammaglobulinemia. Exemplary autoimmune diseases include, but are not limited to, lupus, such as systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), lupus nephritis (LN), anti-synthetase syndrome, multifocal motor neuropathy, myasthenia gravis, neuromyelitis optica, pemphigus vulgaris, and systemic sclerosis. In some embodiments, the autoimmune disease is a B cell-mediated disease. Autoimmunity can be associated with autoantibody production, immune complex formation, dendritic cell activation, T cell activation, cytokine synthesis, and / or chemokine release. For example, SLE is "a life-threatening autoimmune disease characterized by activation of the adaptive immune system, formation of double-stranded DNA autoantibodies, and organ inflammation". Mackensen et al., Anti-CD19 CAR T cell therapy for refractory systemic lupus erythematosus, Nature Medicine (2022). SLE can be evaluated using the Systemic Lupus Erythematosus Disease Activity Index and / or the DORIS criteria. Ibid.

[0597] "Anti-tumor effect" as used herein refers to a biological effect that can be manifested as: a decrease in tumor volume, a decrease in the number of tumor cells, a decrease in tumor cell proliferation, a decrease in the number of metastatic foci, an increase in overall survival or progression-free survival, an increase in life expectancy, or an improvement in various physiological symptoms associated with the tumor. Anti-tumor effect can also refer to the prevention of tumor appearance, such as a vaccine.

[0598] As used herein, the term "administer" refers to physically introducing an agent into a subject using any of a variety of methods and delivery systems known to those of skill in the art. Exemplary routes of administration of the agents disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion. As used herein, the phrase "parenteral administration" means a mode of administration other than enteral and topical administration, generally by injection, and includes (but is not limited to) intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subepidermal, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection and infusion, as well as in vivo electroporation. In some embodiments, the agents disclosed herein may be administered via non-parenteral routes, such as orally. Other non-parenteral routes include topical, epidermal or transmucosal routes of administration, such as intranasal, vaginal, rectal, sublingual or topical. As used herein, the phrase "systemic injection" non-exclusively refers to intravenous, intraperitoneal, subcutaneous, via the submucosa of the nasal mucosa, via the tongue, via bronchoscopy, intravenous, intraarterial, intramuscular, intraocular, intrastriatal, subcutaneous, intradermal, via a dermal patch, via a skin patch, via a patch, into the cerebrospinal fluid, into the portal vein, into the brain, into the lymphatic system, intrapleural, retroorbital, intradermal, into the spleen, intralymphatic, and others.

[0599] The term "genetically engineered" or "engineered" refers to methods of modifying the genome of a cell, including but not limited to deleting a coding or non-coding region or a portion thereof or inserting a coding region or a portion thereof. In some embodiments, the modified cell is a lymphocyte, such as a T cell, which can be obtained from a patient or a donor. The cell can be modified to express an exogenous construct, such as a chimeric antigen receptor (CAR) or a T cell receptor (TCR), which is incorporated into the cell genome.

[0600] As used herein, "cytokine" refers to a non-antibody protein released by one cell in response to contact with a specific antigen, wherein the cytokine interacts with a second cell to mediate a response in the second cell. "Cytokine" as used herein is intended to mean a protein released by a population of cells that acts as an intercellular mediator on another cell. Cytokines can be expressed endogenously by cells or administered to a subject. Cytokines can be released by immune cells including macrophages, B cells, T cells, neutrophils, dendritic cells, eosinophils, and mast cells to propagate an immune response. Cytokines can induce various responses in recipient cells. Cytokines can include homeostatic cytokines, chemokines, pro-inflammatory cytokines, effectors, and acute-phase proteins. For example, homeostatic cytokines including interleukin (IL)-7 and IL-15 promote immune cell survival and proliferation, and pro-inflammatory cytokines can promote inflammatory responses. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN)-γ. Examples of pro-inflammatory cytokines include, but are not limited to, IL-1α, IL-1β, IL-6, IL-13, IL-17a, IL-23, IL-27, tumor necrosis factor (TNF)-α, TNF-β, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular cell adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), TGF-β, IL-35, and perforin. Examples of acute-phase proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).

[0601] As used herein, the term "lymphocyte" includes natural killer (NK) cells, T cells or B cells. NK cells are a type of cytotoxic lymphocyte that represents a major component of the innate immune system. NK cells inhibit tumor and virus-infected cells. They act via the process of apoptosis or programmed cell death. They are called "natural killers" because they do not require activation to kill cells. T cells play a major role in cell-mediated immunity (without antibody involvement). T cell receptors (TCRs) distinguish T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is the major site for T cell maturation. There are many types of T cells, including: helper T cells (e.g., CD4+ cells), cytotoxic T cells (also called TC, cytotoxic T lymphocytes, CTL, T killer cells, cytolytic T cells, CD8+ T cells or killer T cells), memory T cells ((i) stem memory cells (TSCM), like naïve cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+ and IL-7Ra+, but also express high amounts of CD95, IL-2R, CXCR3 and LFA-1, and display many functional attributes characteristic of memory cells); (ii) central memory cells (TCM) express L-selectin and CCR7, secrete IL-2, but do not secrete IFNγ or IL-4, and (iii) however, effector memory cells (TEM) do not express L-selectin or CCR7, but produce effector cytokines such as IFNγ and IL-4), regulatory T cells (Treg, suppressor T cells or CD4+CD25+ or CD4+FoxP3+ regulatory T cells), natural killer T cells (NKT) and γδ T cells. On the other hand, B cells play a major role in humoral immunity (with antibody involvement). B cells make antibodies, can act as antigen-presenting cells (APC) and, after activation by antigen interaction, become memory B cells and plasma cells, both short-lived and long-lived. In mammals, immature B cells are formed in the bone marrow.

[0602] "Immune response" refers to the action of the cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells and neutrophils) and soluble macromolecules produced by any of these cells or the liver (including Abs, cytokines and complement), which act to selectively target, bind to, damage, destroy and / or eliminate from the body of a vertebrate: invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells or, in the case of autoimmunity or pathological inflammation, normal human cells or tissues.

[0603] As used herein, "costimulatory signal" refers to a signal that, in combination with a primary signal such as TCR / CD3 engagement, elicits a T cell response, such as, but not limited to, proliferation and / or upregulation or downregulation of key molecules.

[0604] As used herein, "costimulatory ligand" includes a molecule on an antigen-presenting cell that specifically binds to a cognate costimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. The costimulatory ligand induces a signal in addition to the primary signal provided by stimulation through molecules such as binding of the T cell receptor (TCR) / CD3 complex to peptide-loaded major histocompatibility complex (MHC) molecules. Costimulatory ligands can include, but are not limited to, 3 / TR6, 4-IBB ligand, agonists or antibodies that bind Toll-like receptors, B7-1 (CD80), B7-2 (CD86), CD30 ligand, CD40, CD7, CD70, CD83, herpesvirus entry mediator (HVEM), human leukocyte antigen G (HLA-G), ILT4, immunoglobulin-like transcript (ILT) 3, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), ligands that specifically bind B7-H3, lymphotoxin β receptor, class I MHC chain-related protein A (MICA), class I MHC chain-related protein B (MICB), OX40 ligand, PD-L2 or programmed death (PD) LI. Costimulatory ligands include, but are not limited to, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, 4-1BB, B7-H3, CD2, CD27, CD28, CD30, CD40, CD7, ICOS, ligands that specifically bind CD83, lymphocyte function-associated antigen 1 (LFA-1), natural killer cell receptor C (NKG2C), OX40, PD-1 or tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT).

[0605] "Costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response through the T cell, such as but not limited to proliferation. Costimulatory molecules include but are not limited to 4-1BB / CD137, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD33, CD45, CD100 (SEMA4D), CD103, CD134, CD137, CD154, CD16, CD160 (BY55), CD18, CD19, CD19a, CD2, CD22, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 (α; β; δ; ε; γ; ζ), CD30, CD37, CD4, CD4, CD40, CD49a, CD49D, CD49f, CD5, CD64, CD69, CD7, CD80, CD83 ligand, CD84, CD86, CD8α, CD8β, CD9, CD96 (Tactile), CD1-la, CDl-lb, CDl-lc, CDl-ld, CDS, CEACAM1, CRTAM, DAP-10, DNAM1 (CD226), Fcγ receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, ICAM-1, ICOS, Igα (CD79a), IL2Rβ, IL2Rγ, IL7Rα, integrin, ITGA4, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1 (CD1 la / CD18), class I MHC molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX40, PAG / Cbp, PD-1, PSGL1, SELPLG (CD162), signaling lymphocytic activation molecule, SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF, TNFr, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6 or a fragment, truncation or combination thereof.

[0606] As used herein, a "subject" can be a mammal such as a primate, ungulate (e.g., cow, pig, horse), cat, dog, domestic pet, or domestic mammal. In some cases, the mammal can be a rabbit, pig, horse, sheep, cow, cat, or dog or a human. In some embodiments, the subject is a human. In some embodiments, the subject is an adult. In some embodiments, the subject is an adolescent human.

[0607] II. Circular RNAs and Compositions Thereof

[0608] Provided herein are circular RNA constructs and related pharmaceutical compositions comprising a delivery vehicle, wherein the circular RNA construct is capable of in vivo delivery to immune cells for treatment or production of a protein. According to the present disclosure, the circular RNAs provided herein can be injected into an animal (e.g., a human) such that a polypeptide encoded by the circular RNA molecule is expressed in the animal, for example, by immune cells and T cells.

[0609] In certain embodiments, the circular RNA construct comprises an IRES. In certain embodiments, the circular RNA construct comprises at least one expression sequence encoding a binding molecule that binds or associates with a tumor cell antigen. In certain embodiments, the circular RNA construct comprises an IRES and at least one expression sequence encoding a binding molecule.

[0610] In some embodiments, provided herein are circular RNA polynucleotides comprising a spliced 3' I group intron fragment (e.g., an extension of an exon sequence), optionally a first spacer, an internal ribosome entry site (IRES), an expression sequence, optionally a second spacer, and a spliced 5' I group intron fragment (e.g., an extension of an exon sequence). In some embodiments, these regions are in the stated order.

[0611] In certain embodiments, the constructed circular RNA is formulated into a pharmaceutical composition. In certain embodiments, the pharmaceutical composition comprises a delivery vehicle. In certain embodiments, a circular RNA construct comprising an IRES and at least one expression sequence encoding a binding molecule is formulated in a pharmaceutical composition comprising a delivery vehicle.

[0612] In certain embodiments, a pharmaceutical composition is disclosed that comprises a circular RNA construct comprising an IRES and at least one expression sequence encoding a binding molecule and a delivery vehicle. In certain embodiments, the delivery vehicle facilitates and / or enhances the delivery and release of the circular RNA to one or more target cells.

[0613] In certain embodiments, the circular RNA construct and related pharmaceutical compositions comprise an IRES and at least one expression sequence encoding a therapeutic protein, wherein the IRES is capable of promoting the expression of the delivered protein in vivo.

[0614] In certain embodiments, the circular RNA construct comprises an IRES and at least one expression sequence encoding a cytokine, immune checkpoint inhibitor, agonist, chimeric antigen receptor (CAR), inhibitory receptor agonist, one or more T cell receptors, and / or B cell receptors.

[0615] In some embodiments, the polynucleotide encodes a protein composed of subunits encoded by more than one gene. For example, the protein can be a heterodimer, where each chain or subunit of the protein is encoded by a separate gene. It is possible to deliver more than one circular RNA molecule in a delivery vehicle and each circular RNA encodes a separate subunit of the protein. Alternatively, a single circular RNA can be engineered to encode more than one subunit. In certain embodiments, the separate circular RNA molecules encoding individual subunits can be administered in separate delivery vehicles.

[0616] In certain embodiments, the circular RNA comprises an IRES and at least one expression sequence encoding a CAR construct. In some embodiments, the CAR targets a cancer antigen. In some embodiments, the CAR can be programmed to recognize a specific antigen and activate immune cells to attack and destroy cells when bound to the antigen. In certain embodiments, the payload encoded by the circular RNA polynucleotide can be optimized via the use of a specific internal ribosome entry site (IRES) within a translation initiation element (TIE). The TIE can comprise an untranslated region (UTR), an aptamer complex, or a combination thereof. The UTR can be fully or partially from a virus or eukaryotic mRNA. In some embodiments, the IRES specificity within the circular RNA can significantly enhance the expression of the specific protein encoded within the coding element.

[0617] Circular RNAs are produced by transcription from a DNA template, which causes the formation of precursor linear RNA polynucleotides capable of circularizing. Linear precursor RNA polynucleotides are provided for the preparation of circular RNA constructs and related pharmaceutical compositions. Before splicing of the precursor linear RNA polynucleotide, the DNA template has the same sequence as the precursor linear RNA polynucleotide. The DNA template has the same sequence as the precursor linear RNA polynucleotide before splicing of the precursor linear RNA polynucleotide (e.g., 3'-enhanced intron element, 3'-enhanced exon element, core functional element, and 5'-enhanced exon element, 5'-enhanced intron element). In some embodiments, the linear precursor RNA polynucleotide undergoes splicing, resulting in the removal of the 3'-enhanced intron element and the 5'-enhanced intron element during the circularization process. In some embodiments, the resulting circular RNA polynucleotide lacks the 3'-enhanced intron fragment and the 5'-enhanced intron fragment, but maintains the 3'-enhanced exon fragment, the core functional element, and the 5'-enhanced exon element. Circularization strategies are known in the art and are described elsewhere herein. In certain embodiments, the resulting circular RNA may include a PIE (Permuted Intron-Exon) region, a translation region (IRES and coding / non-coding elements), and a PIE region. The resulting Permuted Intron-Exon (PIE) region allows covalent linkage of the 5'-end and 3'-end of the RNA and formation of a circular RNA.

[0618] In some embodiments, the precursor RNA polynucleotide comprises (a) a terminal element; (b) an insertion region; and (c) a single intron element in the following order. In some embodiments, the terminal sequence is upstream of the single intron sequence in the precursor RNA polynucleotide. In such embodiments: (i) the terminal element comprises a splice site nucleotide, (ii) the single intron element comprises a splice site dinucleotide at or near the 5'-end of the single intron, and (iii) the single intron element is capable of interacting with a nucleophile capable of cleaving at the splice site dinucleotide at or near the 5'-end of the single intron element, wherein the cleavage product of (iii) comprises a 5'-splice site nucleotide capable of cleaving at the splice site nucleotide of the terminal element. In some embodiments, the nucleophile is a free nucleophile introduced into the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine capable of cleaving at the splice site dinucleotide at or near the 5'-end of the single intron. In some embodiments, the guanosine is a free guanosine introduced into the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5'-splice site nucleotide having a 3'-hydroxyl group capable of cleaving at the splice site nucleotide of the terminal element.

[0619] In some embodiments, the precursor RNA polynucleotide comprises (a) a single intron element; (b) an insertion region; and (c) a terminal element, in that order. In some embodiments, the single intron sequence is upstream of the terminal sequence in the precursor RNA polynucleotide. In such embodiments: (i) the single intron element comprises a splice site dinucleotide at or near the 3' end of the single intron; (ii) the terminal element comprises a splice site nucleotide; and (iii) the single intron element is capable of interacting with a nucleophile that is capable of cleaving at the splice site nucleotide of the terminal element, wherein the cleavage product of (iii) comprises a 5' splice site nucleotide that is capable of cleaving at the splice site dinucleotide at or near the 3' end of the single intron. In some embodiments, the nucleophile is a free nucleophile introduced into the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the nucleophile is a guanosine that is capable of cleaving at the splice site nucleotide of the terminal element. In some embodiments, the guanosine is a free guanosine introduced into the precursor RNA polynucleotide, e.g., not in cis and / or covalently linked to the precursor RNA polynucleotide. In some embodiments, the cleavage product of (iii) comprises a 5' splice site nucleotide having a 3' hydroxyl group that is capable of cleaving at the splice site nucleotide of the terminal element.

[0620] In some embodiments, the precursor linear RNA polynucleotide circularizes when incubated in the presence of one or more guanosine nucleotides or nucleosides (e.g., GTP) and divalent cations (e.g., Mg 2+ ). In some embodiments, the 3' enhancer exon element, the 5' enhancer exon element, and / or the core functional element fully or partially facilitates circularization of the precursor linear RNA polynucleotide to form the circular RNA polynucleotide provided herein.

[0621] In certain embodiments, the circular RNAs provided herein are produced inside a cell. In some embodiments, the precursor RNA is transcribed using a DNA template (e.g., using the vectors provided herein in some embodiments) by a phage RNA polymerase in the cytoplasm or by a host RNA polymerase II in the nucleus and then circularized.

[0622] In certain embodiments, the circular RNAs provided herein are injected into an animal (e.g., a human) such that a polypeptide encoded by the circular RNA molecule is expressed in the animal.

[0623] In some embodiments, the length of the DNA (e.g., vector), linear RNA (e.g., precursor RNA), and / or circular RNA polynucleotides provided herein is between: 300 to 10,000, 400 to 9,000, 500 to 8,000, 600 to 7,000, 700 to 6,000, 800 to 5,000, 900 to 5,000, 1,000 to 5,000, 1,100 to 5,000, 1,200 to 5,000, 1,300 to 5,000, 1,400 to 5,000, and / or 1,500 to 5,000 nucleotides. In some embodiments, the length of the polynucleotide is at least 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1,000 nt, 1,100 nt, 1,200 nt, 1,300 nt, 1,400 nt, 1,500 nt, 2,000 nt, 2,500 nt, 3,000 nt, 3,500 nt, 4,000 nt, 4,500 nt, or 5,000 nt. In some embodiments, the length of the polynucleotide does not exceed 3,000 nt, 3,500 nt, 4,000 nt, 4,500 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, or 10,000 nt. In some embodiments, the length of the DNA, linear RNA, and / or circular RNA polynucleotides provided herein is about 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1,000 nt, 1,100 nt, 1,200 nt, 1,300 nt, 1,400 nt, 1,500 nt, 2,000 nt, 2,500 nt, 3,000 nt, 3,500 nt, 4,000 nt, 4,500 nt, 5,000 nt, 6,000 nt, 7,000 nt, 8,000 nt, 9,000 nt, or 10,000 nt.

[0624] In some embodiments, the circular RNAs provided herein have higher functional stability than mRNAs containing the same expression sequences. In some embodiments, the circular RNAs provided herein have higher functional stability compared to mRNAs containing the same expression sequences, modified nucleotides (e.g., 5moU modification), optimized UTRs, caps, and / or polyA tails.

[0625] In some embodiments, the functional half-life of the circular RNA polynucleotides provided herein is at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the functional half-life of the circular RNA polynucleotides provided herein is 5 - 80 hours, 10 - 70 hours, 15 - 60 hours, and / or 20 - 50 hours. In some embodiments, the functional half-life of the circular RNA polynucleotides provided herein is longer (e.g., at least 1.5-fold longer, at least 2-fold longer) than the functional half-life of an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the functional half-life can be evaluated via functional protein synthesis assays.

[0626] In some embodiments, the half-life of the circular RNA polynucleotides provided herein is at least 5 hours, 10 hours, 15 hours, 20 hours, 30 hours, 40 hours, 50 hours, 60 hours, 70 hours, or 80 hours. In some embodiments, the half-life of the circular RNA polynucleotides provided herein is 5 - 80, 10 - 70, 15 - 60, and / or 20 - 50 hours. In some embodiments, the half-life of the circular RNA polynucleotides provided herein is longer (e.g., at least 1.5-fold longer, at least 2-fold longer) than the half-life of an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the circular RNA polynucleotide or its pharmaceutical composition has a functional half-life that is longer than or equal to a predetermined threshold in human cells. In some embodiments, the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, wherein the activity of Gaussia luciferase (GLuc) is measured every 1, 2, 6, 12, or 24 hours for 1, 2, 3, 4, 5, 6, 7, or 14 days in the medium of human cells (e.g., HepG2) expressing the circular RNA polynucleotide. In other embodiments, the functional half-life is determined by an in vivo assay, wherein the level of the protein encoded by the expression sequence of the circular RNA polynucleotide is measured every 1, 2, 6, 12, or 24 hours for 1, 2, 3, 4, 5, 6, 7, or 14 days in a patient's serum or tissue sample. In some embodiments, the predetermined threshold is the functional half-life of a reference linear RNA polynucleotide comprising the same expression sequence as the circular RNA polynucleotide.

[0627] In some embodiments, the circular RNAs provided herein can have a higher expression amplitude compared to equivalent linear mRNAs, e.g., having a higher expression amplitude 24 hours after administering the RNA to the cells. In some embodiments, the circular RNAs provided herein have a higher expression amplitude compared to mRNAs comprising the same expression sequence, 5moU modification, optimized UTRs, cap, and / or polyA tail.

[0628] In some embodiments, when exposed to the immune system of an organism or a certain type of immune cell, the circular RNAs provided herein may have lower immunogenicity than equivalent mRNAs. In some embodiments, when exposed to the immune system of an organism or a certain type of immune cell, the circular RNAs provided herein are associated with the regulated production of cytokines. For example, in some embodiments, compared to mRNAs containing the same expression sequence, the circular RNAs provided herein are associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to the immune system of an organism or a certain type of immune cell. In some embodiments, compared to mRNAs containing the same expression sequence, the circular RNAs provided herein are associated with less induction of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα transcripts when exposed to the immune system of an organism or a certain type of immune cell. In some embodiments, the circular RNAs provided herein have lower immunogenicity than mRNAs containing the same expression sequence. In some embodiments, compared to mRNAs containing the same expression sequence, modified nucleotides (e.g., 5moU modification), optimized UTRs, caps, and / or polyA tails, the circular RNAs provided herein have lower immunogenicity.

[0629] In some embodiments, the circular RNAs provided herein may be encapsulated by a delivery vehicle (e.g., LNP), and the delivery vehicle may deliver the circular RNA construct. Encapsulating the circular RNA in a delivery vehicle may, for example, effectively introduce the CAR gene into T cells. The delivery vehicle may comprise, for example, ionizable lipids, PEG-modified lipids, helper lipids, and / or structural lipids capable of encapsulating the circular RNA. A pharmaceutical composition of a circular RNA construct comprising an IRES, an expression sequence, and a delivery vehicle is provided.

[0630] In certain embodiments, the circular RNA constructs provided herein may be transfected into cells as such, or may be transfected and transcribed in cells in the form of a DNA vector. The circular RNA may be transcribed from the transfected DNA vector via an added polymerase or a polymerase encoded by the nucleic acid transfected into the cell or preferably via an endogenous polymerase. Accordingly, eukaryotic cells comprising the circular RNA polynucleotides provided herein are also provided. In some embodiments, the eukaryotic cell is a human cell. In some embodiments, the eukaryotic cell is an immune cell. In some embodiments, the eukaryotic cell is a T cell, a dendritic cell, a macrophage, a B cell, a neutrophil, or a basophil. Prokaryotic cells comprising the circular RNA polynucleotides provided herein are also provided.

[0631] In some embodiments, provided herein is a T cell, such as a human T cell, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a helper T cell, such as a human helper T cell, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a cytotoxic T cell, such as a human cytotoxic T cell, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a NK cell, such as a human NK cell, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a macrophage, such as a human macrophage, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a monocyte, such as a human monocyte, comprising the circular RNA construct provided herein. In some embodiments, provided herein is a myeloid cell, a human monocyte, comprising the circular RNA construct provided herein. In some embodiments, these cells are present in the bone marrow. In some embodiments, these cells are present in the spleen. In some embodiments, these cells are present in the blood, such as peripheral blood.

[0632] In some embodiments, provided herein is a CD3+ cell, such as a human CD3+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD4+ cell, such as a human CD4+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD8+ cell, such as a human CD8+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD14+ cell, such as a human CD14+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD16+ cell, such as a human CD16+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD56+ cell, such as a human CD56+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD11B+ cell, such as a human CD11B+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD33+ cell, such as a human CD33+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD33+CD14+ cell, such as a human CD33+CD14+ cell, comprising a circular RNA construct provided herein. In some embodiments, provided herein is a CD33+CD14+ cell, such as a human CD33+CD64+ cell, comprising a circular RNA construct provided herein. In some embodiments, these cells are present in the bone marrow. In some embodiments, these cells are present in the spleen. In some embodiments, these cells are present in blood, such as peripheral blood.

[0633] The circular RNA can be unmodified, partially modified, or fully modified. In one embodiment, the circular RNA contains at least one nucleoside modification. In one embodiment, up to 100% of the nucleosides of the circular RNA are modified. In one embodiment, at least one nucleoside modification is a uridine modification or an adenosine modification. In one embodiment, at least one nucleoside modification is selected from N6-methyladenosine (m6A), pseudouridine (ψ), N1-methylpseudouridine (m1ψ), and 5-methoxyuridine (5moU). In one embodiment, the precursor RNA is modified with methylpseudouridine (m1ψ).

[0634] In certain embodiments, the polynucleotide provided (such as a DNA template, precursor RNA polynucleotide, or circular RNA polynucleotide) comprises modified nucleotides and / or modified nucleosides. In some embodiments, the modified nucleoside is m 5 C (5-methylcytidine). In another embodiment, the modified nucleoside is m 5U (5-methyluridine). In another embodiment, the modified nucleoside is m 6 A (N 6 -methyladenosine). In another embodiment, the modified nucleoside is s 2 U (2-thiouridine). In another embodiment, the modified nucleoside is ψ (pseudouridine). In another embodiment, the modified nucleoside is Um (2'-O-methyluridine). In other embodiments, the modified nucleoside is m 1 A (1-methyladenosine); m 2 A (2-methyladenosine); Am (2'-O-methyladenosine); ms 2 m 6 A (2-methylthio-N 6 -methyladenosine); i 6 A (N 6 -isopentenyladenosine); ms 2 i 6 A (2-methylthio-N 6 -isopentenyladenosine); io 6 A (N 6 -(cis-hydroxyisopentenyl)adenosine); ms 2 io 6 A (2-methylthio-N 6 -(cis-hydroxyisopentenyl)adenosine); g 6 A (N 6 -glycylcarbamoyladenosine); t 6 A (N 6 -threonylcarbamoyladenosine); ms 2 t 6 A (2-methylthio-N 6 -threonylcarbamoyladenosine); m 6 t 6 A (N 6 -methyl-N 6 -threonylcarbamoyladenosine); hn 6 A (N 6 -hydroxy-n-valylcarbamoyladenosine); ms 2 hn 6 A (2-methylthio-N 6 -hydroxy-n-valylcarbamoyladenosine); Ar(p) (2'-O-ribosyladenosine (phosphate)); I (inosine); m 1 I (1-methylinosine); m 1 Im (1,2'-O-dimethylinosine); m 3 C (3-methylcytidine); Cm (2'-O-methylcytidine); s 2 C (2-thiocytidine); ac4 C(N 4 -acetylcytidine); f 5 C(5-formylcytidine); m 5 Cm(5,2'-O-dimethylcytidine); ac 4 Cm(N 4 -acetyl-2'-O-methylcytidine); k 2 C(lysidine); m 1 G(1-methylguanosine); m 2 G(N 2 -methylguanosine); m 7 G(7-methylguanosine); Gm(2'-O-methylguanosine); m 2 2G(N 2 ,N 2 -dimethylguanosine); m 2 Gm(N 2 ,2'-O-dimethylguanosine); m 2 2Gm(N 2 ,N 2 ,2'-O-trimethylguanosine); Gr(p)(2'-O-ribosylguanosine (phosphate)); yW(wybutosine); o2yW(peroxywybutosine); OHyW(hydroxywybutosine); OHyW*(under-modified hydroxywybutosine); imG(wyosine); mimG(methylwyosine); Q(queuosine); oQ(epoxyqueuosine); galQ(galactosyl-queuosine); manQ(mannosyl-queuosine); preQ0(7-cyano-7-deazaguanosine); preQ1(7-aminomethyl-7-deazaguanosine); G + (archaeosine); D(dihydrouridine); m 5 Um(5,2'-O-dimethyluridine); s 4 U(4-thiouridine); m 5 s 2 U(5-methyl-2-thiouridine); s 2 Um(2-thio-2'-O-methyluridine); acp 3 U(3-(3-amino-3-carboxypropyl)uridine); ho 5 U(5-hydroxyuridine); mo 5 U(5-methoxyuridine); cmo 5 U(uridine 5-oxyacetic acid); mcmo 5 U(uridine 5-oxyacetic acid methyl ester); chm 5 U(5-(carboxyhydroxymethyl)uridine)); mchm 5U(5-(carboxymethyl)uridine methyl ester); mcm 5 U(5-methoxycarbonylmethyluridine); mcm 5 Um(5-methoxycarbonylmethyl-2'-O-methyluridine); mcm 5 s 2 U(5-methoxycarbonylmethyl-2-thiouridine); nm 5 S 2 U(5-aminomethyl-2-thiouridine); mnm 5 U(5-methylaminomethyluridine); mnm 5 s 2 U(5-methylaminomethyl-2-thiouridine); mnm 5 se 2 U(5-methylaminomethyl-2-selenouridine); ncm 5 U(5-carbamoylmethyluridine); ncm 5 Um(5-carbamoylmethyl-2'-O-methyluridine); cmnm 5 U(5-carboxymethylaminomethyluridine); cmnm 5 Um(5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm 5 s 2 U(5-carboxymethylaminomethyl-2-thiouridine); m 6 2A(N 6 ,N 6 -dimethylcytidine); Im(2'-O-methylinosine); m 4 C(N 4 -methylcytidine); m 4 Cm(N 4 ,2'-O-dimethylcytidine); hm 5 C(5-hydroxymethylcytidine); m 3 U(3-methyluridine); cm 5 U(5-carboxymethyluridine); m 6 Am(N 6 ,2'-O-dimethyladenosine); m 6 2Am(N 6 ,N 6 ,O-2'-trimethyladenosine); m 2,7 G(N 2 ,7-dimethylguanosine); m 2,2,7 G(N 2 ,N 2 ,7-trimethylguanosine); m 3 Um(3,2'-O-dimethyluridine); m 5 D(5-methyldihydrouridine); f 5Cm (5-formyl-2'-O-methylcytidine); m 1 Gm (1,2'-O-dimethylguanosine); m 1 Am (1,2'-O-dimethyladenosine); τm 5 U (5-tauromethyluridine); τm 5 s 2 U (5-tauromethyl-2-thiouridine)); imG-14 (4-demethylwyeoside); imG2 (isowyeoside); or ac 6 A(N 6 -acetyladenosine).

[0635] In some embodiments, the modified nucleoside can include compounds selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-tauromethyluridine, 1-tauromethyl-pseudouridine, 5-tauromethyl-2-thio-uridine, 1-tauromethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. In another embodiment, the modification is independently selected from the group consisting of 5-methylcytosine, pseudouridine, and 1-methylpseudouridine.,

[0636] In some embodiments, the modified ribonucleosides include 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine. In some embodiments, such modified nucleosides provide additional stability and resistance to immune activation.

[0637] Various circular RNAs, circular RNA constructs, compositions comprising circular RNAs, precursor RNAs, and related methods are described, for example, in WO2019236673, WO2020237227, WO2021113777, WO2021226597, WO2021189059, WO2021236855, WO2022261490, WO2023056033, and WO2023081526, each of which is incorporated herein by reference in its entirety.

[0638] A. Enhanced intron elements and enhanced exon elements

[0639] The circular RNAs provided herein can include enhanced intron elements or fragments and enhanced exon elements or fragments. In certain embodiments, as provided herein, the enhanced intron elements and enhanced exon elements can include spacers, duplex regions, affinity sequences, intron fragments, exon fragments, and various untranslated elements. These sequences within the enhanced intron element or enhanced exon element are arranged to optimize circularization or protein expression.

[0640] In certain embodiments, the DNA templates, precursor linear RNA polynucleotides, and circular RNAs provided herein comprise a first (5') and / or second (3') spacer. In some embodiments, the DNA template or precursor linear RNA polynucleotide comprises one or more spacers in an enhanced intron element. In some embodiments, the DNA template, precursor linear RNA polynucleotide comprises one or more spacers in an enhanced exon element. In certain embodiments, the DNA template or linear RNA polynucleotide comprises a spacer in a 3' enhanced intron segment and a spacer in a 5' enhanced intron segment. In certain embodiments, the DNA template, precursor linear RNA polynucleotide, or circular RNA comprises a spacer in a 3' enhanced exon segment and another spacer in a 5' enhanced exon segment to assist with circularization or protein expression due to the symmetry generated throughout the sequence.

[0641] In some embodiments, the spacer between the 3'I group intron fragment and the core functional element can preserve secondary structure in those regions by preventing their interaction, thus enhancing splicing efficiency. In some embodiments, the first spacer (between the 3'I group intron fragment and the core functional element) and the second spacer (between the two expression sequences and the core functional element) comprise additional base-pairing regions that are predicted to base-pair with each other and not with the first duplex region and the second duplex region. In other embodiments, the first spacer (between the 3'I group intron fragment and the core functional element) and the second spacer (between one of the core functional elements and the 5'I group intron fragment) comprise additional base-pairing regions that are predicted to base-pair with each other and not with the first duplex region and the second duplex region. In some embodiments, this spacer base-pairing brings the I group intron fragments very close to each other, thereby further enhancing splicing efficiency. Additionally, in some embodiments, the combination of base-pairing between the first duplex region and the second duplex region and, respectively, between the first spacer and the second spacer promotes the formation of a splicing bubble of the I group intron fragment containing adjacent regions with flanking base-pairing. A typical spacer is an adjacent sequence having one or more of the following properties: 1) predicted to avoid interfering with proximal structures such as an IRES, an expression sequence, an aptamer, or an intron; 2) at least 7 nt in length and no longer than 100 nt; 3) located after and adjacent to the 3' intron fragment and / or located before and adjacent to the 5' intron fragment; and 4) containing one or more of the following: a) an unstructured region at least 5 nt in length, b) a base-pairing region at least 5 nt in length with a distal sequence including another spacer, and c) a structured region at least 7 nt in length limited to the sequence of the spacer. The spacer can have several regions, including unstructured regions, base-pairing regions, hairpin / structured regions, and combinations thereof. In one embodiment, the spacer has a structured region with a high GC content. In one embodiment, one region within the spacer base-pairs with another region within the same spacer. In one embodiment, one region within the spacer base-pairs with one region within another spacer. In one embodiment, the spacer comprises one or more hairpin structures. In one embodiment, the spacer comprises one or more hairpin structures having a stem of 4 to 12 nucleotides and a loop of 2 to 10 nucleotides. In one embodiment, there is an additional spacer between the 3'I group intron fragment and the core functional element. In one embodiment, this additional spacer prevents or reduces to some extent the interference of the structured region of the IRES or the aptamer of the TIE with the folding of the 3'I group intron fragment.In some embodiments, the length of the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides. In some embodiments, the length of the 5' spacer sequence does not exceed 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides. In some embodiments, the length of the 5' spacer sequence is between 5 and 50, 10 and 50, 20 and 50, 20 and 40, and / or 25 and 35 nucleotides. In certain embodiments, the length of the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. In one embodiment, the 5' spacer sequence is a polyA sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In one embodiment, the spacer comprises approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC content. In one embodiment, the spacer comprises approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content.

[0642] In some embodiments, the DNA templates and precursor linear RNA polynucleotides and circular RNA polynucleotides provided herein comprise a first (5') duplex region and a second (3') duplex region. In certain embodiments, the DNA template and precursor linear RNA polynucleotide comprise a 5' outer duplex region within the 3' enhanced intron fragment and a 3' outer duplex region within the 5' enhanced intron fragment. In some embodiments, the DNA template, precursor linear RNA polynucleotide, and circular RNA polynucleotide comprise a 5' inner duplex region within the 3' enhanced exon fragment and a 3' inner duplex region within the 5' enhanced exon fragment. In some embodiments, the DNA polynucleotide and precursor linear RNA polynucleotide comprise a 5' outer duplex region, a 5' inner duplex region, a 3' inner duplex region, and a 3' outer duplex region.

[0643] In certain embodiments, the first duplex region and the second duplex region can form perfect or imperfect duplexes. Thus, in certain embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% of the first duplex region and the second duplex region can base pair with each other. In some embodiments, the predicted duplex region has less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with an unintended sequence in the RNA (e.g., a non-duplex region sequence). In some embodiments, such duplex regions that are located at the ends of the precursor RNA strand and are adjacent to or very close to the Group I intron segments bring the Group I intron segments very close to each other, thereby enhancing splicing efficiency. In some embodiments, the length of the duplex region is from 3 to 100 nucleotides (e.g., a length of 3 - 75 nucleotides, a length of 3 - 50 nucleotides, a length of 20 - 50 nucleotides, a length of 35 - 50 nucleotides, a length of 5 - 25 nucleotides, a length of 9 - 19 nucleotides). In some embodiments, the length of the duplex region is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides. In some embodiments, the length of the duplex region is from about 9 to about 50 nucleotides. In one embodiment, the length of the duplex region is from about 9 to about 19 nucleotides. In some embodiments, the length of the duplex region is from about 20 to about 40 nucleotides. In certain embodiments, the length of the duplex region is about 30 nucleotides.

[0644] In other embodiments, the DNA template, the precursor linear RNA polynucleotide or the circular RNA polynucleotide do not contain any duplex regions to optimize translation or cyclization.

[0645] In certain embodiments, as provided herein, a DNA template or a precursor linear RNA polynucleotide can comprise an affinity tag. In some embodiments, the affinity tag is located in the 3' enhanced intron element. In some embodiments, the affinity tag is located in the 5' enhanced intron element. In some embodiments, both the 3' and 5' enhanced intron elements each comprise an affinity tag. In one embodiment, the affinity tag in the 3' enhanced intron element is the same length as the affinity tag in the 5' enhanced intron element. In some embodiments, the affinity tag in the 3' enhanced intron element is the same sequence as the affinity tag in the 5' enhanced intron element. In some embodiments, the affinity sequence is placed to optimize oligo(dT) purification.

[0646] In some embodiments, one or more affinity tags present in the precursor linear RNA polynucleotide are removed after cyclization. In some embodiments, an affinity tag is added to the residual linear RNA after performing RNA cyclization. In some such embodiments, the affinity tag is added enzymatically to the linear RNA. One or more affinity tags present in the linear RNA and not present in the circular RNA can facilitate circular RNA purification. In some embodiments, this purification is performed using a negative selection or affinity purification method. In some embodiments, this purification is performed using a binder that preferentially or specifically binds to the affinity tag.

[0647] In some embodiments, the affinity tag comprises a polyA region. In some embodiments, the polyA region is at least 15, 30, or 60 nucleotides in length. In some embodiments, the affinity tag comprising the polyA region is present at two positions in the precursor linear RNA. In some embodiments, the length of one or both polyA regions is 15 - 50 nucleotides. In some embodiments, the length of one or both polyA regions is 20 - 25 nucleotides. The polyA sequence is removed after cyclization. Thus, an oligonucleotide that hybridizes to the polyA sequence, such as a deoxythymidine oligonucleotide (oligo(dT)) conjugated to a solid surface (e.g., resin), can be used to isolate circular RNA from its precursor RNA.

[0648] In some embodiments, the affinity tag comprises a sequence that is not present in the circular RNA product. In some such embodiments, the sequence that is not present in the circular RNA product is a dedicated binding site (DBS). In some embodiments, the DBS is an unstructured sequence, i.e., a sequence that does not form defined structural elements such as hairpin loops, adjacent dsRNA regions, or triple helices. In some embodiments, the DBS sequence forms a random coil. In some embodiments, the DBS comprises at least 25% GC content, at least 50% GC content, at least 75% GC content, or at least 100% GC content. In some embodiments, the DBS comprises at least 25% AC content, at least 50% AC content, at least 75% AC content, or 100% AC content. In some embodiments, the length of the DBS is at least 15, 30, or 60 nucleotides. In some embodiments, the affinity tag comprising the DBS is present at two positions in the precursor linear RNA. In some embodiments, the length of the DBS sequences is independently 15 - 50 nucleotides. In some embodiments, the length of the DBS sequences is independently 20 - 25 nucleotides.

[0649] In some embodiments, the (multiple) DBS sequences are removed after cyclization. Thus, a binder comprising an oligonucleotide can be used to facilitate circular RNA purification, the oligonucleotide comprising a sequence complementary to the DBS. For example, the binder can comprise an oligonucleotide complementary to the DBS conjugated to a solid surface (e.g., resin).

[0650] In some embodiments, an affinity sequence or another type of affinity handle such as biotin is added to the linear RNA by ligation. In some embodiments, an affinity sequence comprising an oligonucleotide is ligated to the linear RNA. In some embodiments, an oligonucleotide conjugated to an affinity handle is ligated to the linear RNA. In some embodiments, a solution comprising a linear RNA conjugated to an affinity sequence or affinity handle and a circular RNA not comprising an affinity sequence or affinity handle is contacted with a binder comprising a solid support conjugated to a binding partner conjugated to an oligonucleotide complementary to the affinity sequence or conjugated to the affinity handle such that the linear RNA binds to the binder and the circular RNA is eluted or separated from the solid support.

[0651] Any purification method for the circular RNAs described herein may include one or more buffer exchange steps. In some embodiments, buffer exchange is performed after in vitro transcription (IVT) and before additional purification steps. In some such embodiments, the IVT reaction solution is buffer exchanged into a buffer containing Tris. In some embodiments, the IVT reaction solution is buffer exchanged into a buffer containing greater than 1 mM or greater than 10 mM, one or more monovalent salts such as NaCl or KCl, and optionally containing EDTA. In some embodiments, buffer exchange is performed after circular RNA purification is complete. In some embodiments, buffer exchange is performed after IVT and after circular RNA purification. In some embodiments, the buffer exchange performed after circular RNA purification includes exchanging the circular RNA into water or a storage buffer. In some embodiments, the storage buffer contains 1 mM sodium citrate at pH 6.5.

[0652] In certain embodiments, the 3' enhanced intron element includes a leader untranslated sequence. In some embodiments, the leader untranslated sequence is at the 5' end of the 3' enhanced intron fragment. In some embodiments, the leader untranslated sequence includes the last nucleotide of the transcription start site (TSS). In some embodiments, the TSS is selected from viral, bacterial, or eukaryotic DNA templates. In one embodiment, the leader untranslated sequence includes the last nucleotide of the TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a terminal spacer. In one embodiment, after translation by RNA T7 polymerase, the leader untranslated sequence contains guanosine at the 5' end.

[0653] In certain embodiments, the 5' enhanced intron element includes a trailing untranslated sequence. In some embodiments, the 5' trailing untranslated sequence is at the 3' end of the 5' enhanced intron element. In some embodiments, the trailing untranslated sequence is a partial restriction digestion sequence. In one embodiment, the trailing untranslated sequence is fully or partially a restriction digestion site for linearizing the DNA template. In some embodiments, the restriction digestion site is fully or partially from a native viral, bacterial, or eukaryotic DNA template. In some embodiments, the trailing untranslated sequence is a terminal restriction site fragment.

[0654] 1. Enhanced intron fragment

[0655] In certain embodiments, as provided herein, the 3' enhancer intron element and the 5' enhancer intron element each comprise an intron fragment. In certain embodiments, the 3' intron fragment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 3' proximal fragment of a native group I intron that includes the 3' splice site dinucleotide. Typically, the 5' intron fragment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 5' proximal fragment of a native group I intron that includes the 5' splice site dinucleotide. In some embodiments, the 3' intron fragment includes the first nucleotide of the 3' group I splice site dinucleotide. In some embodiments, the 5' intron fragment includes the first nucleotide of the 5' group I splice site dinucleotide. In other embodiments, the 3' intron fragment includes the first and second nucleotides of the 3' group I intron fragment splice site dinucleotide; and the 5' intron fragment includes the first and second nucleotides of the 3' group I intron fragment dinucleotide.

[0656] 2. Enhanced exon fragment

[0657] In certain embodiments, as provided herein, the DNA template, the linear precursor RNA polynucleotide, and the circular RNA polynucleotide each comprise an enhanced exon fragment. In some embodiments, the 3' enhanced exon element is upstream of the core functional element in the 5' to 3' order. In some embodiments, the 5' enhancer intron element is downstream of the core functional element in the 5' to 3' order.

[0658] According to the present disclosure, the 3'-enhanced exon element and the 5'-enhanced exon element each comprise an exon fragment. In some embodiments, the 3'-enhanced exon element comprises a 3'-exon fragment. In some embodiments, the 5'-enhanced exon element comprises a 5'-exon fragment. In certain embodiments, as provided herein, the 3'-exon fragment and the 5'-exon fragment each comprise a Group I intron fragment and 1 to 100 nucleotides of an exon sequence. In certain embodiments, the 3'-intron fragment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 3'-proximal fragment of a native Group I intron that includes the 3'-splice site dinucleotide. Generally, the 5'-Group I intron fragment is a continuous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous) to the 5'-proximal fragment of a native Group I intron that includes the 5'-splice site dinucleotide. In some embodiments, the 3'-exon fragment comprises the second nucleotide of the 3'-Group I intron splice site dinucleotide and 1 to 100 nucleotides of an exon sequence. In some embodiments, the 5'-exon fragment comprises the first nucleotide of the 5'-Group I intron splice site dinucleotide and 1 to 100 nucleotides of an exon sequence. In some embodiments, the exon sequence comprises in part or in whole a naturally occurring exon sequence that is from a viral, bacterial or eukaryotic DNA vector. In other embodiments, the exon sequence further comprises a synthetic, genetically modified (e.g., containing modified nucleotides) or otherwise engineered exon sequence.

[0659] In one embodiment, when the 3'-intron fragment comprises the two nucleotides of the 3'-Group I splice site dinucleotide and the 5'-intron fragment comprises the two nucleotides of the 5'-Group I splice site dinucleotide, the exon fragments located within the 5'-enhanced exon element and the 3'-enhanced exon element do not comprise the Group I splice site dinucleotide.

[0660] 3. Exemplary arrangements of enhanced intron elements and enhanced exon elements

[0661] By way of example and not limitation, in some embodiments, the 3'-enhanced intron element comprises, in 5' to 3' order: a leader untranslated sequence, a 5'-affinity tag, an optional 5'-external duplex region, a 5'-external spacer, and a 3'-intron fragment. In the same embodiment, the 3'-enhanced exon element comprises, in 5' to 3' order: a 3'-exon fragment, an optional 5'-internal duplex region, an optional 5'-internal duplex region, and a 5'-internal spacer. In the same embodiment, the 5'-enhanced exon element comprises, in 5' to 3' order: a 3'-internal spacer, an optional 3'-internal duplex region, and a 5'-exon fragment. In the same embodiment again, the 3'-enhanced intron element comprises, in 5' to 3' order: a 5'-intron fragment, a 3'-external spacer, an optional 3'-external duplex region, a 3'-affinity tag, and a trailing untranslated sequence.

[0662] B. Core Functional Element - IRES

[0663] In some embodiments, the DNA template, linear precursor RNA polynucleotide, and circular RNA polynucleotide comprise a core functional element. In some embodiments, the core functional element comprises a coding element and / or a non-coding element. In some embodiments, the core functional element further comprises a translation initiation element (TIE) upstream of the coding or non-coding element, and / or a termination element.

[0664] In some embodiments, the core functional element comprises a termination element. In some embodiments, the termination sequence comprises a stop codon. In one embodiment, the termination sequence comprises a termination cassette. In some embodiments, the termination cassette comprises at least 2 stop codons. In some embodiments, the termination cassette comprises a frame of at least 2 stop codons. In the same embodiment, the frames of the stop codons in the termination cassette each comprise 1, 2, or more stop codons. In some embodiments, the termination cassette comprises a LoxP or RoxStopRox, or a frt-flanked termination cassette. In the same embodiment, the termination cassette comprises a lox-termination-lox termination cassette.

[0665] In some embodiments, the polynucleotides herein comprise a coding element or a non-coding element or a combination of both. In some embodiments, the coding element comprises an expression sequence. In some embodiments, the coding element encodes at least one therapeutic protein. In some embodiments, the circular RNA encodes two or more polypeptides.

[0666] In some embodiments, the core functional element comprises at least one translation initiation element (TIE). The TIE is designed to permit the translation efficiency of the encoded protein. In some embodiments, the core functional element comprising one or more coding elements will further comprise one or more TIEs. In some embodiments, the translation initiation element (TIE) comprises a synthetic TIE. In some embodiments, the synthetic TIE comprises an aptamer complex capable of initiating the translation of linear or circular RNA polynucleotides, a synthetic IRES, or other engineered TIEs.

[0667] In some embodiments, the TIE comprises an untranslated region (UTR) or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof. In certain embodiments, the TIE contains modified nucleotides. In certain embodiments, the TIEs provided herein comprise an internal ribosome entry site (IRES). In certain embodiments, the IRES comprises one or more modified nucleotides as compared to a wild-type viral IRES or a eukaryotic IRES. See, e.g., WO2022 / 261490, which is incorporated herein by reference in its entirety.

[0668] Due to the discovery of viral IRESs, their classification has been difficult due to their dissimilarities. It has been observed that there is no common mechanism for the operation of all IRESs. Additionally, no specific structural elements common to all IRESs have been found; their sequences lack significant homology. See Nikonov, Biochemistry (Moscow), 2017, Vol. 82, No. 13, pp. 1615-1631. According to one author, four IRES classes have been defined. Type I and II IRESs are found in picornaviruses and can be about 400-500 nt in length. Type III IRESs are involved in flaviviruses (including HCV) and HCV-like picornaviruses and are characterized by the presence of a pseudoknot upstream of the AUG codon and the requirement for the first 30 nt of the coding sequence. Type IV IRESs are intergenic region (IGR) IRESs, which were initially identified in cricket paralysis virus (CrPV), which can function in the absence of any initiation codon and where translation starts with the GCU triplet. See Godet, Int. J. Mol. Sci. 2019, 20, 924; doi:10.3390 / ijms20040924.

[0669] An IRES permits translation of one or more open reading frames (e.g., open reading frames forming an expression sequence) from a circular RNA. The IRES element attracts the eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, e.g., Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20:102-110; Kobayashi et al., BioTechniques (1996) 21:399-402; and Mosser et al., BioTechniques 1997 22 150-161. In some embodiments, the IRES is capable of facilitating the expression of a protein encoded by a precursor RNA in a cell. In some embodiments, the IRES is capable of facilitating protein expression such that the level of protein expression is comparable to or higher than when using a control IRES.

[0670] Multiple IRES sequences are available and include sequences derived from a wide variety of viruses, such as: the leader sequence of the untranslated region (UTR) of picornaviruses such as encephalomyocarditis virus (EMCV) (Jang et al., J. Virol. (1989) 63:1651-1660), the poliovirus leader sequence, the hepatitis A virus leader sequence, the hepatitis C virus IRES, the human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25):15125-15130), the IRES element from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700), the Giardia virus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397), etc. Different IRES sequences have different abilities to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression from a linear mRNA or circular RNA construct is unknown and unpredictable. In certain embodiments, potential IRES sequences can be identified bioinformatically based on sequence position in a viral sequence. However, the activity of such sequences has not been previously characterized. As demonstrated herein, such IRES sequences can depend on the cell type, e.g., having different protein expression capabilities in T cells, hepatocytes, or muscle cells. In some embodiments, the novel IRES sequences described herein can have at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or 100-fold increased expression in a particular cell type compared to the previously described EMCV IRES sequence.

[0671] In some embodiments, the IRES is Aalivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Aquamavirus, Avihepatovirus, Avisivirus, Boosepivirus, Bopivirus, Caecilivirus, Cardiovirus, Cosavirus, Crahelivirus, Crohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Equine rhinitis virus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, Grusopivirus, Harkavirus, Hemipivirus, Hepatovirus, Hunnivirus, Cridivirus, Kunsagivirus, Limnipivirus, Livupivirus, Ludopivirus, Malagasivirus, Marsupivirus, Megrivirus, Mistivirus, Mosavirus, Mupivirus, Myrropivirus, Orivirus, Oscivirus, Parabovirus, Parechovirus, Pasivirus, Passerivirus, Pemapivirus, Poecivirus, Potamipivirus), Pygoscepivirus, Rabovirus, Rafivirus, Rajidapivirus, Rohelivirus, Rosavirus, Sakobuvirus, Salivirus, Sapelovirus, Senecavirus, Shanb avirus, Sicinivirus, Symapivirus, Teschovirus, Torchivirus, Tottorivirus, Tremovirus, Tropivirus, hepatitis C virus, Pegivirus, Pestivirus, Flavivirus IRES. In some embodiments herein, the IRES is selected from enterovirus, cretovirus, parechovirus, henipavirus, passerivirus, mistivirus, and cardiovirus.

[0672] In some embodiments, the IRES is an IRES sequence of any of the following: Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian Virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, human poliovirus 1, Plautia stali intestine virus, Kashmir bee virus, human rhinovirus 2, Homalodisca coagulata virus-1, human immunodeficiency virus type 1, louse P virus, hepatitis C virus, hepatitis A virus, GB hepatitis virus, foot-and-mouth disease virus, human enterovirus 71, equine rhinitis virus, Ectropis obliqua picornavirus-like virus, encephalomyocarditis virus, Drosophila C virus, human coxsackievirus B3, tobacco mosaic virus of cruciferous plants, cricket paralysis virus, bovine viral diarrhea virus 1, Black Queen Cell Virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, Hibiscus yellow vein mosaic virus, classical swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennapedia, human AQP4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kip1, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, Canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, naked Drosophila, Saccharomyces cerevisiae (S.TFIID of Saccharomyces cerevisiae, Saccharomyces cerevisiae YAP1, Tobacco Etch Virus, Turnip Crinkle Virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Dicistrovirus, HCVQC64, Human Cosavirus E / D, Human Cosavirus F, Human Cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SH1, Salivirus FHB, Salivirus NG-J1, Human Parechovirus 1, Crohivirus B, Yc-3, Rosavirus M-7, Chamba Virus A, Paxi Virus A, Paxi Virus A 2, Echovirus E14, Human Parechovirus 5, Aichi Virus, Hepatitis A Virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A 1220, Paxi Virus A3, Sapelovirus, Rosavirus B, Bakunsa Virus, Tremovirus A, Porcine Paxi Virus 1, PLV-CHN, Paxi Virus A, Sisinivirus, Hepatitis C Virus K, Hepatitis C Virus A, BVDV1, Border Disease Virus, BVDV2, CSFV-PK15C, SF573 Dicistrovirus, Hubei Picorna-like Virus, CRPV, Salivirus A BN5, Salivirus A BN2, Salivirus A02394, Salivirus AGUT, Salivirus A CH, Salivirus ASZ1, Salivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24 or aptamers of eIF4G.

[0673] In some embodiments, the IRES wholly or partially comprises a eukaryotic or cellular IRES. In certain embodiments, the IRES is from a human gene, where the human gene is ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13B, ARMC8, ARMCX6, ARPC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, AURKA, B3GALNT1, B3GNTL1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG, BTN3A2, C12orf43, C14orf93, C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDKN1B, CEACAM7, CEP295NL, CFLAR, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, COG4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1, CTSL, CUTA, CXCR5, CYB5R3,CYP24A1, CYP3A5, DAG1, DAP3, DAP5, DAXX, DCAF4, DCAF7, DCLRE1A, DCP1A, DCTN1, DCTN2, DDX19B, DDX46, DEFB123, DGKA, DGKD, DHRS4, DHX15, DIO3, DLG1, DLL4, DMDUTR, DMD ex5, DMKN, DNAH6, DNAL4, DUSP13, DUSP19, DYNC1I2, DYNLRB2, DYRK1A, ECI2, ECT2, EIF1AD, EIF2B4, EIF4G1, EIF4G2, EIF4G3, ELANE, ELOVL6, ELP5, EMCN, ENO1, EPB41, ERMN, ERVV-1, ESRRG, ETFB, ETFBKMT, ETV1, ETV4, EXD1, EXT1, EZH2, FAM111B, FAM157A, FAM213A, FBXO25, FBXO9, FBXW7, FCMR, FGF1, FGF1, FGF1A, FGF2, FGF2, FGF-9, FHL5, FMR1, FN1, FOXP1, FTH1, FUBP1, G3BP1, GABBR1, GALC, GART, GAS7, gastrin, GATA1, GATA4, GFM2, GHR, GJB2, GLI1, GLRA2, GMNN, GPAT3, GPATCH3, GPR137, GPR34, GPR55, GPR89A, GPRASP1, GRAP2, GSDMB, GSTO2, GTF2B, GTF2H4, GUCY1B2, HAX1, HCST, HIGD1A, HIGD1B, HIPK1, HIST1H1C, HIST1H3H, HK1, HLA-DRB4, HMBS, HMGA1, HNRNPC, HOPX, HOXA2, HOXA3, HPCAL1, HR, HSP90AB1, HSPA1A, HSPA4L, HSPA5, HYPK, IFFO1, IFT74, IFT81, IGF1, IGF1R, IGF1R, IGF2, IL11, IL17RE, IL1RL1, IL1RN, IL32, IL6, ILF2, ILVBL, INSR, INTS13, IP6K1, ITGA4, ITGAE, KCNE4, KERA, KIAA0355, KIAA0895L, KIAA1324, KIAA1522, KIAA1683, KIF2C, KIZ, KLHL31, KLK7, KRR1, KRT14, KRT17, KRT33A, KRT6A, KRTAP10-2, KRTAP13-3KRTAP13-4, KRTAP5-11, KRTCAP2, LACRT, LAMB1, LAMB3, LANCL1, LBX2, LCAT, LDHA, LDHAL6A, LEF1, LINC-PINT, LMO3, LRRC4C, LRRC7, LRTOMT, LSM5, LTB4R, LYRM1, LYRM2, MAGEA11, MAGEA8, MAGEB1, MAGEB16, MAGEB3, MAPT, MARS, MC1R, MCCC1, METTL12, METTL7A, MGC16025, MGC16025, MIA2, MIA2, MITF, MKLN1, MNT, MORF4L2, MPD6, MRFAP1, MRPL21, MRPS12, MSI2, MSLN, MSN, MT2A, MTFR1L, MTMR2, MTRR, MTUS1, MYB, MYC, MYCL, MYCN, MYL10, MYL3, MYLK, MYO1A, MYT2, MZB1, NAP1L1, NAV1, NBAS, NCF2, NDRG1, NDST2, NDUFA7, NDUFB11, NDUFC1, NDUFS1, NEDD4L, NFAT5, NFE2L2, NFE2L2, NFIA, NHEJ1, NHP2, NIT1, NKRF, NME1-NME2, NPAT, NR3C1, NRBF2, NRF1, NTRK2, NUDCD1, NXF2, NXT2, ODC1, ODF2, OPTN, OR10R2, OR11L1, OR2M2, OR2M3, OR2M5, OR2T10, OR4C15, OR4F17, OR4F5, OR5H1, OR5K1, OR6C3, OR6C75, OR6N1, OR7G2, p53, P2RY4, PAN2, PAQR6, PARP4, PARP9, PC, PCBP4, PCDHGC3, PCLAF, PDGFB, PDZRN4, PELO, PEMT, PEX2, PFKM, PGBD4, PGLYRP3, PHLDA2, PHTF1, PI4KB, PIGC, PIM1, PKD2L1, PKM, PLCB4, PLD3, PLEKHA1, PLEKHB1, PLS3, PML, PNMA5, PNN, POC1A, POC1B, POLD2, POLD4, POU5F1, PPIG, PQBP1, PRAME, PRPF4, PRR11, PRRT1, PRSS8, PSMA2, PSMA3, PSMA4, PSMD11, PSMD4, PSMD6, PSME3, PSMG3, PTBP3, PTCH1, PTHLH, PTPRDPUS7L, PVRIG, QPRT, RAB27A, RAB7B, RABGGTB, RAET1E, RALGDS, RALYL, RARB, RCVRN, REG3G, RFC5, RGL4, RGS19, RGS3, RHD, RINL, RIPOR2, RITA1, RMDN2, RNASE1, RNASE4, RNF4, RPA2, RPL17, RPL21, RPL26L1, RPL28, RPL29, RPL41, RPL9, RPS11, RPS13, RPS14, RRBP1, RSU1, RTP2, RUNX1, RUNX1T1, RUNX1T1, RUNX2, RUSC1, RXRG, S100A13, S100A4, SAT1, SCHIP1, SCMH1, SEC14L1, SEMA4A, SERPINA1, SERPINB4, SERTAD3, SFTPD, SH3D19, SHC1, SHMT1, SHPRH, SIM1, SIRT5, SLC11A2, SLC12A4, SLC16A1, SLC25A3, SLC26A9, SLC5A11, SLC6A12, SLC6A19, SLC7A1, SLFN11, SLIRP, SMAD5, SMARCAD1, SMN1, SNCA, SNRNP200, SNRPB2, SNX12, SOD1, SOX13, SOX5, SP8, SPARCL1, SPATA12, SPATA31C2, SPN, SPOP, SQSTM1, SRBD1, SRC, SREBF1, SRPK2, SSB, SSB, SSBP1, ST3GAL6, STAB1, STAMBP, STAU1, STAU1, STAU1, STAU1, STAU1, STK16, STK24, STK38, STMN1, STX7, SULT2B1, SYK, SYNPR, TAF1C, TAGLN, TANK, TAS2R40, TBC1D15, TBXAS1, TCF4, TDGF1, TDP2, TDRD3, TDRD5, TESK2, THAP6, THBD, THTPA, TIAM2, TKFC, TKTL1, TLR10, TM9SF2, TMC6, TMCO2, TMED10, TMEM116, TMEM126A, TMEM159, TMEM208, TMEM230, TMEM67, TMPRSS13, TMUB2, TNFSF4, TNIP3, TP53, TP53, TP73, TRAF1, TRAK1, TRIM31, TRIM6, TRMT1, TRMT2B, TRPM7, TRPM8, TSPEAR, TTC39B,TTLL11, TUBB6, TXLNB, TXNIP, TXNL1, TXNRD1, TYROBP, U2AF1, UBA1, UBE2D3, UBE2I, UBE2L3, UBE2V1, UBE2V2, UMPS, UNG, UPP2, USMG5, USP18, UTP14A, UTRN, UTS2, VDR, VEGFA, VEGFA, VEPH1, VIPAS39, VPS29, VSIG10L, WDHD1, WDR12, WDR4, WDR45, WDYHV1, WRAP53, XIAP, XPNPEP3, YAP1, YWHAZ, YY1AP1, ZBTB32, ZNF146, ZNF250, ZNF385A, ZNF408, ZNF410, ZNF423, ZNF43, ZNF502, ZNF512, ZNF513, ZNF580, ZNF609, ZNF707 or ZNRD1.,

[0674] In some embodiments, the cell is a myotube. In some embodiments, the IRES is derived from Bopivirus, Orsayvirus, Hennegavirus, Passerivirus, Mistivirus, Ridgevirus, Enterovirus, Cardiovirus, Salivirus, Rabovirus, Parechovirus, Caliivirus or Scinvirus. In some embodiments, the IRES is derived from Hennegavirus, Passerivirus, Ridgevirus, Bopivirus or Enterovirus. In some embodiments, the IRES is derived from Enterovirus I, Enterovirus F, Enterovirus E, Enterovirus J, Enterovirus C, Enterovirus A, Enterovirus B, Aichivirus B, Parechovirus A, Cardiovirus F, Cardiovirus B or Cardiovirus E.

[0675] In some embodiments, the cell is a hepatocyte. In some embodiments, the IRES is derived from Enterovirus, Bopivirus, Mistivirus, Caliivirus, Orsayvirus, Cardiovirus, Ridgevirus, Rabovirus, Salivirus, Parechovirus, Hennegavirus, Torovirus, Passerivirus, Kosavirus or Scinvirus. In some embodiments, the IRES is derived from Enterovirus, Mistivirus, Ridgevirus, Bopivirus or Caliivirus. In some embodiments, the IRES is derived from Enterovirus B, Enterovirus A, Enterovirus D, Enterovirus J, Enterovirus C, Rhinovirus B, Enterovirus H, Enterovirus I, Enterovirus E, Enterovirus F, Enterovirus B, Aichivirus A, Aichivirus A, Parechovirus F, Cardiovirus E or Cardiovirus B.

[0676] In some embodiments, the cell is a T cell. In some embodiments, the IRES is derived from a picornavirus, a bopivirus, a henipavirus, a miste virus, an enterovirus, a crestivirus, a labovirus, a torigavirus, a sallyvirus, a cardiovirus, a parechovirus, a megrivirus, an Allexivirus, or a sambavirus. In some embodiments, the IRES is derived from a picornavirus, a henipavirus, a miste virus, an enterovirus, or a crestivirus. In some embodiments, the IRES is derived from enterovirus I, enterovirus D, enterovirus C, enterovirus A, enterovirus J, enterovirus H, Aichi virus B, parechovirus A, or cardiovirus B.

[0677] To drive protein expression, the circular RNA comprises an IRES operably linked to a protein coding sequence. Exemplary IRES sequences are provided in Table 1A. In some embodiments, the circular RNA constructs and related pharmaceutical compositions disclosed herein comprise an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the IRES sequence in Table 1A or the construct from SEQ ID NOs: 50 - 61 or construct A - P in Table 1B. In some embodiments, the circular RNA constructs and related pharmaceutical compositions disclosed herein comprise the IRES sequence in Table 1A or the construct from SEQ ID NOs: 50 - 61 or construct A - P in Table 1B. Modifications to the IRES and accessory sequences are disclosed herein for increasing or decreasing IRES activity, for example, by truncating the 5' and / or 3' ends of the IRES, adding a spacer at the 5' end of the IRES, modifying the 6 nucleotides (Kozak sequence) at the 5' end of the translation start site, modifying alternative translation start sites, and generating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequence in the circular RNA constructs and related pharmaceutical compositions disclosed herein comprises one or more of these modifications relative to the native IRES.

[0678] In certain embodiments, the circular RNA constructs disclosed herein comprise an IRES and at least one expression sequence encoding a binding molecule. In certain embodiments, the IRES sequence is an exemplary IRES sequence provided in Table 1A below, or an IRES from a construct of SEQ ID NOs: 50-61 or any of constructs A-P of Table 1B. In some embodiments, the circular RNA constructs and related pharmaceutical compositions disclosed herein comprise an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the IRES sequence in Table 1A or an IRES from a construct of SEQ ID NOs: 50-61 or any of constructs A-P of Table 1B. In some embodiments, the circular RNA constructs and related pharmaceutical compositions disclosed herein comprise an IRES sequence in Table 1A or an IRES from a construct of SEQ ID NOs: 50-61 or any of constructs A-P of Table 1B and at least one expression sequence encoding a binding molecule.

[0679] Table 1A: IRES Sequences

[0680]

[0681]

[0682]

[0683]

[0684]

[0685]

[0686]

[0687]

[0688] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequences in Table 1A, an IRES sequence from the constructs of SEQ ID NOs: 50 - 61, or an IRES sequence shown below with respect to any of the constructs A - P in Table 1B, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR shown below with respect to any of the constructs A - P in Table 1B. In some embodiments, the circular RNA further comprises a CD28z or 4 - 1BB co - stimulatory domain as described herein.

[0689] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct A, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct A. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct A, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct A. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co - stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co - stimulatory domain. In some embodiments, the circular RNA further comprises a 4 - 1BB co - stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co - stimulatory domain.

[0690] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct B, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct B. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct B, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct B. In some embodiments, the circular RNA optionally exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0691] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct C, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct C. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct C, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct C. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0692] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct D, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct D. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct D, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct D. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0693] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct E, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct E. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct E, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct E. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0694] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct F, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct F. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct F, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct F. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0695] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct G, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct G. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct G, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct G. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0696] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct H, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct H. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct H, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct H. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0697] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct I, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct I. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct I, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct I. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0698] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct J, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct J. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct J, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct J. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0699] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct K, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct K. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct K, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct K. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0700] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct L, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct L. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct L, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct L. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0701] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct M, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct M. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct M, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct M. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0702] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct N, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct N. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct N, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct N. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0703] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct O, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct O. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct O, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct O. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0704] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct P, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct P. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of construct P, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the CAR of construct P. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0705] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:8 and a sequence encoding a CAR polypeptide. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0706] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:8 and a sequence encoding a HER2 CAR polypeptide. In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:8 and a sequence encoding a CD19 CAR polypeptide. In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:8 and a sequence encoding a BCMA polypeptide. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0707] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:18 and a sequence encoding a CAR polypeptide. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0708] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:18 and a sequence encoding a HER2 CAR polypeptide. In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:18 and a sequence encoding a CD19 CAR polypeptide. In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the IRES sequence of SEQ ID NO:18 and a sequence encoding a BCMA polypeptide. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits an increase.

[0709] In some embodiments, the circular RNA comprises a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a CAR or a binding fragment thereof of any of constructs A-P in Table 1B. In some embodiments, the circular RNA further comprises a CD28z co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB co-stimulatory domain as described herein and optionally exhibits increased activity compared to a suitable control having an alternative co-stimulatory domain.

[0710] Table 1B: Exemplary constructs (DNA templates)

[0711]

[0712]

[0713]

[0714]

[0715]

[0716]

[0717]

[0718]

[0719]

[0720]

[0721]

[0722]

[0723]

[0724]

[0725]

[0726]

[0727]

[0728]

[0729]

[0730]

[0731]

[0732]

[0733]

[0734]

[0735] C. Auxiliary components

[0736] As described in the present disclosure, the circular RNA constructs and related pharmaceutical compositions, linear RNA polynucleotides, and / or DNA templates disclosed herein may also comprise certain auxiliary elements (also collectively referred to herein as “incorporated auxiliary elements”). In certain embodiments, these auxiliary elements may be included within the sequences of the circular RNA, linear RNA polynucleotide, and / or DNA template for enhancing circularization, translation, or both. In certain embodiments, the auxiliary element is a sequence that is specifically between or within enhanced intron elements, enhanced exon elements, or core functional elements of individual polynucleotides. As a non-limiting example, the incorporated auxiliary elements (e.g., 5' and 3') may include IRES trans-acting factor regions, miRNA binding sites, restriction sites, RNA editing regions, structural or sequence elements, granule sites, zip code elements, RNA trafficking elements, and / or another specific sequence that enhances and / or facilitates circularization and / or translation of the protein encoded within the circular RNA polynucleotide.

[0737] In some embodiments, the incorporated auxiliary element comprises an IRES trans-acting factor (ITAF) region. In some embodiments, the IRES trans-acting factor region regulates translation initiation by binding to PCBP1-PCBP4 (polyC binding proteins), PABP1 (polyA binding protein), PTB (polypyrimidine tract binding), Argonaute protein family, HNRNPK (heterogeneous nuclear ribonucleoprotein K protein), or La protein. In some embodiments, the IRES trans-acting factor region comprises polyA, polyC, polyAC, or a polypyrimidine tract. In some embodiments, the ITAF region is located within a core functional element. In some embodiments, the ITAF region is located within the TIE.

[0738] In certain embodiments, the combined accessory element comprises at least one miRNA binding site. In some embodiments, the miRNA binding site is located within a 5' enhanced intron element, a 5' enhanced exon element, a core functional element, a 3' enhanced exon element, and / or a 3' enhanced intron element. In some embodiments, the miRNA binding site is located within a spacer within an enhanced intron element or an enhanced exon element. In certain embodiments, the miRNA binding site comprises the entire spacer region. In some embodiments, the 5' enhanced intron element and the 3' enhanced intron element each comprise the same miRNA binding site. In another embodiment, the miRNA binding site of the 5' enhanced intron element comprises a miRNA binding site that is different in length or nucleotides from the 3' enhanced intron element. In one embodiment, the 5' enhanced exon element and the 3' enhanced exon element comprise the same miRNA binding site. In other embodiments, the 5' enhanced exon element and the 3' enhanced exon element comprise miRNA binding sites that are different in length or nucleotides. In some embodiments, the miRNA binding sites are located adjacent to each other within a circular RNA construct, a linear RNA polynucleotide precursor, and / or a DNA template. In certain embodiments, the first nucleotide of one of the miRNA binding sites is after the last nucleotide of the first nucleotide of the second miRNA binding site.

[0739] In some embodiments, the miRNA binding site is located within the translation initiation element (TIE) of the core functional element. In one embodiment, the miRNA binding site is before, after, or within an internal ribosome entry site (IRES). In another embodiment, the miRNA binding site is before, after, or within an aptamer complex.

[0740] Incorporation of miRNA sequences within circular RNA molecules can permit tissue-specific expression of coding sequences within the core functional element. For example, in a circular RNA designed to express a protein in immune cells, miRNA binding sequences that cause expression inhibition in tissues such as the liver or kidney may be desired. Such miRNA binding sequences can be selected based on the cellular or tissue expression of the miRNA. The unique sequences defined by miRNA nomenclature are widely known and are available to workers in the microRNA field. For example, it can be found in the miRDB public database. As a non-limiting example, one or more miR-122 target sites can be inserted into the circular RNA.

[0741] In some embodiments, the miR-122 site can comprise the following sequence:

[0742] CAAACACCATTGTCACACTCCAA (SEQ ID NO:200).

[0743] D. Expression sequences and payloads

[0744] In some embodiments, the circular RNA construct comprises at least one expression sequence encoding a binding molecule. In certain embodiments, the circular RNA construct comprises an IRES and at least one expression sequence encoding a therapeutic protein, wherein the IRES is capable of promoting protein expression upon in vivo delivery.

[0745] In some embodiments, the circular RNA can encode various therapeutic proteins, cytokines, immune checkpoint inhibitors, agonists, chimeric antigen receptors, inhibitory receptor agonists, one or more T cell receptors, and / or B cell receptors available in the art. Chimeric proteins can also include, for example, recombinant fusion proteins, chimeric mutant proteins, or other fusion proteins. In some embodiments, the circular RNA comprises more than 1 expression sequence, such as 2, 3, 4, or 5 expression sequences. In some embodiments, the circular RNA is a bicistronic RNA. In some embodiments, the bicistronic RNA is codon-optimized. Exemplary bicistronic circular RNAs are described in WO2021 / 189059A2, which is incorporated herein by reference in its entirety.

[0746] In some embodiments, the expression sequence encodes a therapeutic protein. In some embodiments, the therapeutic protein is selected from the proteins listed in the table below.

[0747]

[0748]

[0749]

[0750]

[0751]

[0752]

[0753]

[0754]

[0755]

[0756] In some embodiments, the expression sequence encodes a therapeutic protein. In some embodiments, the expression sequence encodes a cytokine, such as IL-12p70, IL-15, IL-2, IL-18, IL-21, IFN-α, IFN-β, IL-10, TGF-β, IL-4, or IL-35, or a functional fragment thereof. In some embodiments, the expression sequence encodes an immune checkpoint inhibitor. In some embodiments, the expression sequence encodes an agonist (e.g., a TNFR family member, such as CD137L, OX40L, ICOSL, LIGHT, or CD70). In some embodiments, the expression sequence encodes a chimeric antigen receptor. In some embodiments, the expression sequence encodes an inhibitory receptor agonist (e.g., PDL1, PDL2, galectin-9, VISTA, B7H4, or MHCII) or an inhibitory receptor (e.g., PD1, CTLA4, TIGIT, LAG3, or TIM3). In some embodiments, the expression sequence encodes an inhibitory receptor antagonist. In some embodiments, the expression sequence encodes one or more TCR chains (α chain and β chain or γ chain and δ chain). In some embodiments, the expression sequence encodes a secreted T cell or immune cell engager (e.g., a bispecific antibody such as BiTE, targeting, for example, CD3, CD137, or CD28 and a tumor-expressed protein, such as CD19, CD20, or BCMA, etc.). In some embodiments, the expression sequence encodes a transcription factor (e.g., FOXP3, HELIOS, TOX1, or TOX2). In some embodiments, the expression sequence encodes an immunosuppressive enzyme (e.g., IDO or CD39 / CD73). In some embodiments, the expression sequence encodes for GvHD (e.g., anti-HLA-A2 CAR-Treg).

[0757] In some embodiments, the circular RNA construct comprises an IRES and an expression sequence encoding a CAR. In certain embodiments, the circular RNA constructs and related pharmaceutical compositions herein comprise a CAR-encoding region encoding a chimeric antigen receptor (CAR) complex protein. In certain embodiments, the expression sequence encodes a CAR targeting a cancer antigen. In certain embodiments, the CAR construct comprises, for example, an anti-CD19, anti-HER2, or anti-BCMA binder.

[0758] A chimeric antigen receptor (CAR or CAR-T) is a genetically engineered receptor. These engineered receptors can be inserted into immune cells via circular RNA as described herein and expressed by the immune cells, including T cells. In the case of a CAR, a single receptor can be programmed to recognize a specific antigen and, when bound to the antigen, activate the immune cell to attack and destroy cells bearing the antigen. When these antigens are present on tumor cells, immune cells expressing the CAR can target and kill the tumor cells.

[0759] Thus, in some embodiments, the CAR encoded by the polynucleotide comprises (i) an antigen-binding molecule that specifically binds to a target antigen, (ii) a hinge domain, a transmembrane domain, and an intracellular domain, and (iii) an activation domain. In some embodiments, the orientation of the CAR according to the present disclosure comprises an antigen-binding domain (e.g., scFv) in tandem with a co-stimulatory domain and an activation domain. The co-stimulatory domain may comprise one or more of an extracellular portion, a transmembrane portion, and an intracellular portion. In other embodiments, multiple co-stimulatory domains may be utilized in tandem. In some embodiments, the CAR comprises a CAR protein spacer. The CAR protein spacer may be between any of the foregoing domains. In some embodiments, the CAR is directed against a tumor-expressed protein, including (but not limited to) CD19, BCMA, and HER2.

[0760] 1. Codon Optimization

[0761] In some embodiments in which the circular RNA construct comprises at least one expression sequence encoding a binding molecule, the expression sequence may be codon-optimized. In some embodiments, the circular RNA construct is optimized to lack at least one microRNA binding site present in an equivalent pre-optimized polynucleotide. In some embodiments, the circular RNA construct is optimized to lack at least one microRNA binding site capable of binding to a microRNA present in the cell in which the circular RNA construct is expressed. In some embodiments, the circular RNA construct is optimized to lack at least one endonuclease sensitivity site present in an equivalent pre-optimized polynucleotide. In some embodiments, the circular RNA construct is optimized to lack at least one endonuclease sensitivity site capable of being cleaved by an endonuclease present in the cell expressing the endonuclease. In some embodiments, the circular RNA construct is optimized to lack at least one RNA editing sensitivity site present in an equivalent pre-optimized polynucleotide.

[0762] A codon-optimized sequence can be a sequence in which the codons in the polynucleotide encoding a polypeptide have been replaced to increase the expression, stability, and / or activity of the polypeptide. Factors affecting codon optimization include, but are not limited to, one or more of the following: (i) variation in codon preference between two or more organisms or genes or a synthetically constructed preference table, (ii) variation in the degree of codon preference within an organism, gene, or set of genes, (iii) systematic variation of codons, including content, (iv) variation of codons according to their decoding tRNA, (v) codon variation according to GC% (overall or at one position of the triplet), (vi) variation in the degree of similarity to a reference sequence (e.g., a naturally occurring sequence), (vii) variation in the codon frequency cutoff, (viii) structural properties of the mRNA transcribed from the DNA sequence, (ix) existing knowledge about the function of the DNA sequence, based on which the codon replacement set is designed; and / or (x) systematic variation of the codon sets for each amino acid. In some embodiments, the codon-optimized polynucleotide can minimize ribonuclease collisions and / or limit structural interference between the expression sequence and the IRES.

[0763] Codon optimization can be performed using known algorithms by methods known in the art. Factors that can affect codon optimization include differences in ribosome dwell time between sequences. Optimization based on ribosome dwell time ranks codons with lower dwell times, i.e., codons for which the ribosome does not stall for a long time (related to translation speed). These codons tend to have a lower GC, with a target GC% of about, for example, 48 - 54%. RNA stability also affects codon optimization. Optimization based on modified stability ranks codons related to RNA stability, which also tend to have a higher GC, with a target GC% of about, for example, 57 - 62%. Higher GC codons tend to improve stability by forming small structures in the RNA that constrain the reactive 2'-hydroxyl and small segments of double-stranded RNA that can be resistant to endonuclease activity. These structures can also slow down the ribosome and prevent it from colliding with other ribosomes. Another codon optimization method utilizes an algorithm with a specific codon usage reverse-engineered from a known sequence, with a target GC% of about 57 - 62%.

[0764] In embodiments using these algorithms, each algorithm will generate a random sequence that follows the codon usage frequency associated with the algorithm. For most amino acids, multiple codons can be used (however, some algorithms may select a single predefined codon for each amino acid). For algorithms that use multiple codons, a single amino acid sequence input can have many different nucleotide sequence outputs because the codon selection at each position is random and weighted. Algorithms generally do not include rare codons, which are defined slightly differently for each algorithm but are generally defined by codon usage in the corresponding genome. Optimization based on ribosome dwell time and modified stability, for example, uses a preferred codon matrix to generate a first-pass sequence. The first-pass preference can be set to 10, for example. This means that, for an amino acid with two potential codons at 0.6 and 0.4 usage rates (60% / 40%), a preference of 10 makes 0.6 become: (0.6^10) / ((0.6^10)-(0.4^10)) = ~0.98, and (0.4^10) / ((0.6^10)-(0.4^10)) = ~0.02, resulting in a 98% chance of selecting the initial 0.6 codon and a 2% chance of selecting the initial 0.4 codon.

[0765] The primary sequence will then undergo a "polishing process" to identify "problem sequences", such as: (a) self-complementary sequence regions containing more than 11 consecutive nucleotides; (b) repetitive regions of more than 11 consecutive nucleotides; and (c) non-desired sequences, which include (but are not limited to) XbaI sites (TCTAGA), which are used to linearize plasmids and must not be present in the circular RNA region; 5+ homopolymers (e.g., AAAAA), which can cause frameshift mutations in RNA; and >75% or <33% GC% content over an 18nt window.

[0766] Once these problem sequences are identified, the algorithm will attempt to remove the problem sequence by reselecting codons at random positions within the problem sequence in question. The algorithm will loop up to 25 times, for example, to remove each problem sequence, and then repeat this process, for example, 25 times to remove each problem sequence. If the algorithm cannot remove the problem sequence, it will report the presence of the problem sequence next to the final sequence, and then repeat this process any number of times to generate unique sequences based on the same amino acid sequence.

[0767] 2. Exemplary Antigen-Binding Domain

[0768] In some embodiments, the circular RNA construct contains an IRES and at least one expression sequence encoding a binding molecule. In certain embodiments, the expression sequence encodes a therapeutic protein, such as a chimeric antigen receptor (CAR).

[0769] CARs can be engineered to bind to an antigen (e.g., a cell surface antigen) by incorporating an antigen-binding molecule that interacts with the target antigen, such as a cancer antigen. In some embodiments, the antigen-binding molecule is an antibody fragment thereof, such as one or more single-chain antibody fragments (scFvs). An scFv is a single-chain antibody fragment having the variable regions of the heavy and light chains of an antibody joined together. See U.S. Patent Nos. 7,741,465 and 6,319,494 and Eshhar et al., Cancer Immunol Immunotherapy (1997) 45:131-136. The scFv retains the ability of the parental antibody to specifically interact with the target antigen. The scFv is suitable for chimeric antigen receptors because it can be engineered to be expressed as part of a single chain together with other CAR components. Id., see also Krause et al., J. Exp. Med., Vol. 188, No. 4, 1998 (619-626); Finney et al., Journal of Immunology, 1998, 161:2791-2797. It should be understood that the antigen-binding molecule is typically contained within the extracellular portion of the CAR such that it can recognize and bind to the antigen of interest. Bispecific and multispecific CARs that are specific for more than one related target are encompassed.

[0770] In some embodiments, the antigen-binding molecule comprises a single chain in which the heavy chain variable region and the light chain variable region are joined by a linker. In some embodiments, VH is at the N-terminus of the linker and VL is at the C-terminus of the linker. In other embodiments, VL is at the N-terminus of the linker and VH is at the C-terminus of the linker. In some embodiments, the linker comprises at least about 5, at least about 8, at least about 10, at least about 13, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids.

[0771] In some embodiments, the antigen-binding molecule comprises a nanobody. In some embodiments, the antigen-binding molecule comprises a DARPin. In some embodiments, the antigen-binding molecule comprises an anticalin or other synthetic protein capable of specifically binding to a target protein.

[0772] In some embodiments, the CAR comprises an antigen-binding domain that is specific for an antigen selected from: CD19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule-1, CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B cell maturation (BCMA), Tn antigen ((Tn Ag) or (GaINAca-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit alpha-2, mesothelin, interleukin 11 receptor alpha (IL-11Ra), prostate stem cell antigen (PSCA), protease serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor beta (PDGFR-β), stage-specific embryonic antigen-4 (SSEA-4), CD20, folate receptor alpha, human epidermal growth factor receptor 2 (HER2), HER3, mucin 1, cell surface-associated (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), prostate enzyme, prostate acid phosphatase (PAP), elongation factor 2 mutant (ELF2M), Ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (precursor, macropain factor) subunit, beta type, 9 (LMP2), glycoprotein 100 (gp100), oncogenic fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl), tyrosinase, ephrinEphA2 (Eph receptor A2), globotriosylceramide, sialyl Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight melanoma associated antigen (HMWMAA), O-acetyl-GD2 ganglioside (OAcGD2), folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248), tumor endothelial marker 7 related (TEM7R), claudin 6 (CLDN6), thyroid stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5 member D (GPRC5D), X chromosome open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), hexasaccharide moiety of globo H glycosphingolipid (GloboH), breast differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), hepatitis A virus cellular receptor 1 (HAVCR1), adrenergic receptor beta-3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor 20 (GPR20), lymphocyte antigen 6 complex locus K 9 (LY6K), olfactory receptor 51E2 (OR51E2), TCR gamma alternate reading frame protein (TARP), Wilms tumor protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), MAGE family members (including MAGE-A1, MAGE-A3, and MAGE-A4), ETS translocation variant gene 6 on chromosome 12p (ETV6-AML), sperm protein 17 (SPA17), X antigen family member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie 2), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-related antigen 1, tumor protein p53 (p53), p53 mutant, prostate protein, surviving telomerase, prostate cancer tumor antigen-1, melanoma antigen recognized by T cells 1, rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), sarcoma translocation breakpoint, melanoma inhibitor of apoptosis (ML-IAP), ERG (ETS fusion gene with transmembrane protease, serine 2 (TMPRSS2)), N-acetylglucosaminyltransferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-related protein 2 (TRP-2), cytochrome P4501B1 (CYP1B1), CCCTC-binding factor (zinc finger protein) class, squamous cell carcinoma antigen recognized by T cells 3 (SART3), paired box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TES1), lymphocyte-specific protein tyrosine kinase (LCK), A-kinase anchor protein 4 (AKAP-4), synovial sarcoma, X breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal ubiquitous 1 (RU1), renal ubiquitous 2 (RU2), podoplanin, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, heat shock protein 70-2 mutant (mut hsp70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecule-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), mucin-like hormone receptor-like 2 containing EGF-like modules (EMR2), lymphocyte antigen 75 (LY75), phosphatidylinositol proteoglycan-3 (GPC3), Fc receptor-like 5 (FCRL5), MUC16, 5T4, 8H9, ανβθ integrin, ανβ6 integrin, alpha-fetoprotein (AFP), B7-H6, ca-125, CA9, CD44, CD44v7 / 8, CD52, E-cadherin, EMA (epithelial membrane antigen), epithelial glycoprotein-2 (EGP-2), epithelial glycoprotein-40 (EGP-40), ErbB4, epithelial tumor antigen (ETA), folate-binding protein (FBP), kinase insert domain receptor (KDR), k-light chain, L1 cell adhesion molecule, MUC18, NKG2D, carcinoembryonic antigen (h5T4), tumor / testis-antigen 1B, GAGE, GAGE-1, BAGE, SCP-1, CTZ9, SAGE, CAGE, CT10, MART-1, immunoglobulin gamma-like polypeptide 1 (IGLL1), hepatitis B surface antigen-binding protein (HBsAg), viral capsid antigen (VCA), early antigen (EA), EBV nuclear antigen (EBNA), HHV-6p41 early antigen, HHV-6B U94 latent antigen, HHV-6Bp98 late antigen, cytomegalovirus (CMV) antigen, large T antigen, small T antigen, adenovirus antigen, respiratory syncytial virus (RSV) antigen, hemagglutinin (HA), neuraminidase (NA), parainfluenza type 1 antigen, parainfluenza type 2 antigen, parainfluenza type 3 antigen, parainfluenza type 4 antigen, human metapneumovirus (HMPV) antigen, hepatitis C virus (HCV) core antigen, HIV p24 antigen, human T-lymphotropic virus type 1 (HTLV-1) antigen, Merkel cell polyomavirus small T antigen, Merkel cell polyomavirus large T antigen, Kaposi's sarcoma-associated herpesvirus (KSHV) lytic nuclear antigen, and KSHV latent nuclear antigen.

[0773] As a non-limiting example, in some embodiments, the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR targeting a cancer antigen. As a non-limiting example, in some embodiments, the circular RNA construct comprises an IRES and a CAR comprising an antigen-binding domain specific for CD19. In some embodiments, the circular RNA construct comprises an IRES and a CAR comprising an antigen-binding domain specific for BCMA. In some embodiments, the circular RNA construct comprises an IRES and a CAR, wherein the CAR comprises an antigen-binding domain specific for HER2. In some embodiments, the expression sequence is codon-optimized.

[0774] As a non-limiting example, in some embodiments, the circular RNA construct comprises a CAR comprising an antigen-binding domain specific for CD19 (B-lymphocyte antigen CD19). CD19 is a biomarker for normal and neoplastic B cells as well as follicular dendritic cells. Diffuse large B-cell lymphoma (DLBCL) is the most common lymphoma, accounting for approximately 25% to 30% of all non-Hodgkin lymphomas, followed by FL. Since CD19 is expressed in more than 95% of B-cell malignancies, it is an attractive target for immunotherapy approaches. A known example of a CAR T-cell therapy targeting CD19 is (Kite Pharma Inc., axicabtagene ciloleucel), anti-CD19 28-ζ (28-ζ) CAR. Another known example of a CAR T-cell therapy targeting CD19 is (Novartis Pharmaceutical Corp., tisagenlecleucel), anti-CD19 BB-ζ (BB-ζ) CAR. Thus, in some embodiments, the expression sequence of the circular RNA construct encodes a CAR, wherein the codons are for anti-CD19 domains known in the art. In some embodiments, the CAR construct comprises an anti-CD19 binder. In some embodiments, the expression sequence is codon-optimized.

[0775] As another non-limiting example, in some embodiments, the circular RNA construct comprises a CAR containing an antigen-binding domain specific for B cell maturation antigen (BCMA). BCMA (also known as TNFRSF17 or CD269) is a member of the tumor necrosis factor receptor (TNFR) superfamily and is expressed by normal and malignant plasma cells and subsets of small B cells. BCMA has been investigated as a known biomarker for c...

Claims

1. A circular RNA construct, the circular RNA construct comprising: (A) An IRES that comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and (B) At least one expression sequence encoding a binding molecule.

2. A circular RNA construct, the circular RNA construct comprising: (A) An IRES that comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and (B) At least one expression sequence encoding a chimeric antigen receptor (CAR) that targets a cancer antigen.

3. A circular RNA construct, the circular RNA construct comprising: (A) An IRES that comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and (B) At least one expression sequence encoding a CAR that targets a cancer antigen, wherein the CAR construct comprises a CD19 binder.

4. The circular RNA construct according to claim 3, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 19-34.

5. A circular RNA construct, the circular RNA construct comprising: (A) An IRES that comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and (B) At least one expression sequence encoding a CAR that targets a cancer antigen, wherein the CAR construct comprises a BCMA binder.

6. The circular RNA construct according to claim 5, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 103-115.

7. A circular RNA construct, the circular RNA construct comprising: (A) An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picovirus, mistivirus, and cardiovirus, and (B) At least one expression sequence encoding a binding molecule.

8. A circular RNA construct, the circular RNA construct comprising: (A) An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picovirus, mistivirus, and cardiovirus, and (B) At least one expression sequence encoding a chimeric antigen receptor (CAR) that targets a cancer antigen.

9. A circular RNA construct, the circular RNA construct comprising: (A) An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picovirus, mistivirus, and cardiovirus, and (B) At least one expression sequence encoding a CAR that targets a cancer antigen, wherein the CAR construct comprises a CD19 binder.

10. The circular RNA construct according to claim 9, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 19-34.

11. A circular RNA construct, the circular RNA construct comprising: (A) An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and (B) At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

12. The circular RNA construct according to claim 11, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

13. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a binding molecule, and (B) A delivery vehicle.

14. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and (B) A delivery vehicle.

15. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and ii. At least one expression sequence encoding a binding molecule, and (B) A delivery vehicle.

16. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and (B) A delivery vehicle.

17. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a binding molecule, and (B) A delivery vehicle comprising an ionizable lipid.

18. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and (B) A delivery vehicle comprising an ionizable lipid.

19. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and (B) A transfer mediator comprising ionizable lipids.

20. The pharmaceutical composition according to claim 19, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 19-34.

21. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 1-18, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BMCA binder, and (B) A transfer mediator comprising ionizable lipids.

22. The pharmaceutical composition according to claim 21, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 103-115.

23. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistyvirus, and cardiovirus, and ii. At least one expression sequence encoding a binding molecule, and (B) A transfer mediator comprising ionizable lipids.

24. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistyvirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and (B) A transfer mediator comprising ionizable lipids.

25. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistyvirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and (B) A transfer mediator comprising ionizable lipids.

26. The pharmaceutical composition according to claim 25, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 19-34.

27. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistyvirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, wherein the CAR construct comprises a BMCA binder, and (B) A transfer mediator comprising ionizable lipids.

28. The pharmaceutical composition according to claim 27, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 103-115.

29. A pharmaceutical composition comprising: (A) Circular RNA construct, comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and ii. At least one expression sequence encoding a binding molecule, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclicalkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocycliccarbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

30. A pharmaceutical composition, the pharmaceutical composition comprising: (A) Circular RNA construct, comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and ii. At least one expression sequence encoding a CAR targeting a cancer antigen, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclicalkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocycliccarbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

31. A pharmaceutical composition, the pharmaceutical composition comprising: (A) Circular RNA construct, comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of the following 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclicalkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocycliccarbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

32. A pharmaceutical composition, the pharmaceutical composition comprising: (A) Circular RNA construct, comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 1-18, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NO: 19-34, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfinyl group, alkylsulfinylalkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

33. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

34. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-BCMA binder, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

35. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and ii. At least one expression sequence encoding a binding molecule, and (B) A delivery vehicle comprising: (i) An ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

36. A pharmaceutical composition, the pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from the group consisting of enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, and (B) A delivery vehicle comprising: (i) Ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) Ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclicalkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocycliccarbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfinyl group, alkylsulfinylalkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

37. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, picobirnavirus, mystivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and (B) A delivery vehicle comprising: (i) Ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) Ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

38. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, picobirnavirus, mystivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-CD19 binder, and wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19 - 34, and (B) A delivery vehicle comprising: (i) Ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) Ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched-chain C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

39. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, picobirnavirus, mystivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder, and (B) A delivery vehicle comprising: (i) Ionizable lipid of formula (I) where n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclicalkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocycliccarbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) Ionizable lipid of formula (II) where each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halo group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

40. A pharmaceutical composition comprising: (A) A circular RNA construct comprising: i. An IRES selected from enterovirus, parechovirus, kobuvirus, henipavirus, passerivirus, mistivirus, and cardiovirus, and ii. At least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises an anti-BCMA binder, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103 - 115, and (B) A transfer vehicle comprising: (i) An ionizable lipid of formula (I) wherein n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched-chain C6-C optionally substituted with one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) wherein each n is independently an integer from 2 - 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted by one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

41. The pharmaceutical composition according to any one of claims 1 - 4, 7 - 10, 13 - 20, 23 - 26, 29 - 32, and 35 - 38, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 50 - 61.

42. The pharmaceutical composition according to any one of claims 1 - 4, 7 - 10, 13 - 20, 23 - 26, 29 - 32, and 35 - 38, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence selected from any one of SEQ ID NOs: 50 - 61.

43. The pharmaceutical composition according to claim 42, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NOs: 50, 51, 52, 54, 55, 56, 58, and 59.

44. A pharmaceutical composition comprising a circular RNA construct and a transfer vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 50 - 61.

45. A pharmaceutical composition comprising a circular RNA construct and a transfer vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, and wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NOs: 50 - 61.

46. The pharmaceutical composition according to claim 45, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NOs: 50, 51, 52, 54, 55, 56, 58, and 59.

47. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, wherein the circular RNA comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 50 - 61, and wherein the delivery vehicle comprises: (i) An ionizable lipid of formula (I) wherein n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) wherein each n is independently an integer from 2 - 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, wherein "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxide alkyl group, alkylsulfonyl group and alkylsulfone alkyl group; and R2 is selected from the group consisting of:

48. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder, wherein the circular RNA comprises a sequence selected from any one of SEQ ID NOs: 50 - 61, and wherein the delivery vehicle comprises: (i) An ionizable lipid of formula (I) wherein n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) An ionizable lipid of formula (II) wherein each n is independently an integer from 2 - 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, wherein "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxide alkyl group, alkylsulfonyl group and alkylsulfone alkyl group; and R2 is selected from the group consisting of:

49. The pharmaceutical composition according to claim 48, wherein the circular RNA construct comprises a sequence selected from any one of SEQ ID NOs: 50, 51, 52, 54, 55, 56, 58, and 59.

50. The circular RNA construct or pharmaceutical composition according to any one of claims 1 - 49, wherein the circular RNA construct comprises SEQ ID NO:

50.

51. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

51.

52. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

52.

53. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

54.

54. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

55.

55. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

56.

56. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

58.

57. The circular RNA construct or pharmaceutical composition according to any one of claims 1 to 49, wherein the circular RNA construct comprises SEQ ID NO:

59.

58. The pharmaceutical composition according to any one of claims 5-6, 21-22, 27, 28, 33-34 or 39-40, wherein the IRES comprises the sequence of SEQ ID NO:8, wherein the CAR construct comprises a BCMA binder, and wherein the BCMA binder comprises a sequence selected from any one of SEQ ID NOs:104-115.

59. The pharmaceutical composition according to any one of claims 13-58, wherein the delivery vehicle comprises an ionizable lipid of formula (I).

60. The pharmaceutical composition according to claim 59, wherein the delivery vehicle comprises a helper lipid, a structural lipid, and a PEG lipid.

61. The pharmaceutical composition according to any one of claims 59-60, wherein the delivery vehicle has a lipid molar ratio formulation as described in Table 4b.

62. The pharmaceutical composition according to any one of claims 13-58, wherein the delivery vehicle comprises an ionizable lipid of formula (II).

63. The pharmaceutical composition according to claim 62, wherein the ionizable lipid is selected from ionizable lipids selected from the following:

64. The pharmaceutical composition according to claim 63, wherein the ionizable lipid is:

65. The pharmaceutical composition according to any one of claims 13-64, wherein the delivery vehicle further comprises at least one lipid selected from a helper lipid, a structural lipid, and a PEG-modified lipid.

66. The pharmaceutical composition according to claim 65, wherein the delivery vehicle comprises PEG-DSPC.

67. The pharmaceutical composition according to any one of claims 13-66, wherein the delivery vehicle is a lipid nanoparticle.

68. The pharmaceutical composition according to any one of claims 13-67, wherein the delivery vehicle further comprises a targeting moiety.

69. The pharmaceutical composition according to claim 68, wherein the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bicyclic peptide or tricyclic peptide, minibody, polynucleotide aptamer, engineered scaffold protein, heavy chain variable region, light chain variable region or a fragment thereof.

70. The pharmaceutical composition according to any one of claims 13-69, the pharmaceutical composition further comprises a pharmaceutically acceptable salt, a buffer, a diluent or a combination thereof.

71. The circular RNA construct or pharmaceutical composition according to any one of the preceding claims, wherein the circular RNA further comprises a polyA region.

72. The circular RNA construct or pharmaceutical composition according to any one of the preceding claims, wherein the circular RNA further comprises at least one miRNA binding site.

73. The circular RNA construct or pharmaceutical composition according to claim 72, wherein the circular RNA comprises at least one miR-122 binding site.

74. The circular RNA construct or pharmaceutical composition according to any one of the preceding claims, wherein the at least one expression sequence encoding a CAR is codon-optimized.

75. The circular RNA construct or pharmaceutical composition according to any one of the preceding claims, wherein the RNA construct further comprises a 5' enhancer intron element, a 5' enhancer exon element, a 3' enhancer exon element, and a 3' enhancer intron fragment.

76. A method for preparing the circular RNA construct or pharmaceutical composition according to any one of the preceding claims.

77. A method for treating cancer or an autoimmune disorder in a subject, the method comprising administering an effective amount of a composition comprising the circular RNA construct or pharmaceutical composition according to any one of claims 1-75, thereby treating the cancer or autoimmune disorder.

78. Use of a composition comprising the circular RNA construct or pharmaceutical composition according to any one of claims 1-75 for treating cancer or an autoimmune disorder.

79. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and (B) at least one expression sequence encoding a binding molecule.

80. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen.

81. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

82. The linear precursor RNA polynucleotide according to claim 81, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 19-34.

83. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES comprising a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 1-18, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

84. The linear precursor RNA polynucleotide according to claim 83, wherein the expression sequence comprises a sequence that is at least 80% identical to a sequence selected from any one of SEQ ID NOs: 103-115.

85. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and (B) at least one expression sequence encoding a binding molecule.

86. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen.

87. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder.

88. The linear precursor RNA polynucleotide according to claim 87, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 19-34.

89. A linear precursor RNA polynucleotide, the linear precursor RNA polynucleotide comprising: (A) an IRES selected from enterovirus, parechovirus, pegivirus, henipavirus, picornavirus, mistivirus, and cardiovirus, and (B) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder.

90. The linear precursor RNA polynucleotide according to claim 89, wherein the expression sequence comprises a sequence that is at least 80% identical to any one of the sequences selected from SEQ ID NO: 103-115.

91. The linear precursor RNA polynucleotide according to any one of claims 79-90, wherein the expression sequence is codon-optimized.

92. The linear precursor RNA polynucleotide according to any one of claims 79-91, the linear precursor RNA polynucleotide further comprising a 5' enhanced intron element, a 5' enhanced exon element, a 3' enhanced exon element, and a 3' enhanced intron fragment.

93. The linear precursor RNA polynucleotide according to claim 92, the linear precursor RNA polynucleotide sequentially comprising the following: (A) the 5' enhanced intron element, (B) the 5' enhanced exon element, (C) a core functional element comprising an IRES and at least one expression sequence encoding a CAR construct targeting a cancer antigen and optionally a stop codon or a stop cassette, (D) the 3' enhanced exon element, and (E) the 3' enhanced intron element.

94. The linear precursor RNA polynucleotide according to any one of claims 79 to 93, the linear precursor RNA polynucleotide further comprising at least one miRNA binding site.

95. The linear precursor RNA polynucleotide according to claim 94, wherein the precursor RNA comprises at least one miR-122 binding site.

96. A DNA vector encoding the RNA polynucleotide according to any one of claims 79-95.

97. A method for preparing a circular RNA construct, the method comprising incubating the linear RNA polynucleotide according to any one of claims 79-95 under conditions suitable for cyclization.

98. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NOs: 1, 2, 4, and 8, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a CD19 binder comprising a sequence selected from any one of SEQ ID NOs: 19 and 20, and wherein the delivery vehicle is a lipid nanoparticle.

99. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NOs: 8, 16, 17, and 18, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a BCMA binder comprising SEQ ID NO: 115, and wherein the delivery vehicle is a lipid nanoparticle.

100. A pharmaceutical composition comprising a circular RNA construct and a delivery vehicle, wherein the circular RNA construct comprises (i) an IRES comprising a sequence selected from any one of SEQ ID NOs: 8, 16, 17, and 18, and (ii) at least one expression sequence encoding a CAR construct targeting a cancer antigen, wherein the CAR construct comprises a HER2 binder comprising a nucleotide sequence selected from any one of SEQ ID NOs: 132 or 133, and wherein the delivery vehicle is a lipid nanoparticle.

101. The pharmaceutical composition according to any one of claims 98 to 100, wherein the lipid nanoparticle comprises: (i) an ionizable lipid of formula (I) wherein n is an integer between 1 and 4; R a is hydrogen or a hydroxyl group; and R1 and R2 are each independently a straight-chain or branched C6-C optionally substituted by one or more substituents selected from the group consisting of 30 alkyl, C6-C 30 alkenyl or C6-C 30 heteroalkyl: oxo group, halogen group, hydroxy group, cyano group, alkyl group, alkenyl group, aldehyde group, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic group)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminocarbonylaminoalkyl group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; or (ii) an ionizable lipid of formula (II) wherein each n is independently an integer from 2 to 15; L1 and L3 are each independently -OC(O)-* or -C(O)O-*, where "*" indicates the point of attachment to R1 or R3; R1 and R3 are each independently a straight-chain or branched C9-C optionally substituted with one or more substituents selected from the group consisting of 20 alkyl or C9-C 20 alkenyl: oxo group, halogen group, hydroxyl group, cyano group, alkyl group, alkenyl group, aldehyde, heterocyclic alkyl group, hydroxyalkyl group, dihydroxyalkyl group, hydroxyalkylaminoalkyl group, aminoalkyl group, alkylaminoalkyl group, dialkylaminoalkyl group, (heterocyclic)(alkyl)aminoalkyl group, heterocyclic group, heteroaryl group, alkylheteroaryl group, alkynyl group, alkoxy group, amino group, dialkylamino group, aminoalkylcarbonylamino group, aminocarbonylalkylamino group, (aminocarbonylalkyl)(alkyl)amino group, alkenylcarbonylamino group, hydroxycarbonyl group, alkoxycarbonyl group, aminocarbonyl group, aminoalkylaminocarbonyl group, alkylaminoalkylaminocarbonyl group, dialkylaminoalkylaminocarbonyl group, heterocyclic alkylaminocarbonyl group, (alkylaminoalkyl)(alkyl)aminocarbonyl group, alkylaminoalkylcarbonyl group, dialkylaminoalkylcarbonyl group, heterocyclic carbonyl group, alkenylcarbonyl group, alkynylcarbonyl group, alkylsulfoxide group, alkylsulfoxidealkyl group, alkylsulfonyl group and alkylsulfonylalkyl group; and R2 is selected from the group consisting of:

102. The pharmaceutical composition according to claim 101, wherein the lipid nanoparticle delivery vehicle comprises an ionizable lipid, and wherein the ionizable lipid is 103. The pharmaceutical composition according to any one of claims 98-102, wherein the lipid nanoparticle transfer vehicle further comprises at least one lipid selected from co-lipids, structural lipids, and PEG-modified lipids.

104. A method for treating cancer, the method comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of claims 98-103.

105. A method for treating an autoimmune disease, the method comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of claims 98-103.

106. Use of a composition comprising a circular RNA construct for treating cancer, the use comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of embodiments 98-103.

107. Use of a composition comprising a circular RNA construct for treating an autoimmune disease, the use comprising administering to a human subject in need thereof the pharmaceutical composition according to any one of embodiments 98-103.

108. The method according to claim 77 or claim 104 or 105 or the use according to claim 106 or 107, wherein the administration is carried out daily, every other day, twice a week, weekly, every ten days, every two weeks, every three weeks, every four weeks, once a month, every six weeks, every eight weeks, every three months, every four months, every six months, every eight months, every nine months, or annually.

Images