Anti-inflammatory sorbitol compound as well as preparation method and application thereof

Abstract

The invention relates to a production and preparation method of an anti-inflammatory polyketone compound, and also relates to application of the compound in treatment of inflammasome-related inflammation, and the structural formula of the compound is # imgabs0 #. A fermentation product containing the compound can be obtained through fermentation culture of a mutant strain Penicillium citrinum HDN11-186-KOCitS, and then the compound is obtained through separation and purification by adopting the methods of ODS reversed-phase column chromatography, Sephadex LH20 gel column chromatography, semi-preparative HPLC (High Performance Liquid Chromatography) and the like. The mutant strain Penicillium citrinum HDN11-186-KOCitS is obtained by carrying out mother nucleus gene knockout on a main product citrinin of the fungus Penicillium citrinum HDN11-186 (the preservation number is CCTCC No: M 20232373), and the mother nucleus gene knockout is obtained by carrying out mother nucleus gene knockout on the fungus Penicillium citrinum HDN11-186 (the preservation number is CCTCC No: M 20232373). The invention aims to provide a method for providing a new compound which has anti-inflammatory activity and has no side effect on normal cells from secondary metabolites derived from fungi, and the new compound can be used for discovering and preparing anti-inflammatory activity medicines and has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the field of industrial microorganisms, and particularly to a method for producing sorbitol compounds with novel carbon skeletons using the fungus Penicillium citrinum HDN11-186 (Deposit number: CCTCC No: M 20232373; Deposit date: December 6, 2023; Depositary institution: China Center for Type Culture Collection; Deposit address: School of Life Sciences, Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan, Hubei 430072); the present invention also relates to the use of such compounds in inhibiting the NLRP3 inflammasome and treating inflammation-related diseases. Background Art

[0002] Chronic inflammation is an inducing factor for many diseases and has evolved into a huge challenge to public health. The Nod-like receptor protein 3 (NLRP3) inflammasome has become a key mediator of pathological inflammation in various diseases, making it an interesting target for pharmacological intervention. It triggers inflammatory responses and subsequently promotes fibrosis in neurodegenerative diseases, cancer, diabetes, cardiovascular diseases, etc. through pathogen-associated molecular patterns (PAMPs) or danger-associated molecular patterns (DAMPs). Inhibiting the NLRP3 inflammasome is expected to have broad therapeutic potential in diseases such as Parkinson's disease, Alzheimer's disease, non-alcoholic steatohepatitis, gout, atherosclerosis, and many other inflammatory diseases. So far, several small molecules have been developed for inhibiting the activation of the NLRP3 inflammasome, among which MCC950, as the most effective inhibitor, shows nanomolar IC 50 values in reducing IL-1β release. However, the clinical progress of MCC950 is hindered by its hepatotoxicity, so there is an urgent need to discover novel molecular inhibitors with higher activity and lower toxicity to address this imminent challenge.

[0003] After the present inventors knocked out the gene of the main product citrinin biosynthesis nucleus in a strain of fungus Penicillium citrinum HDN11-186 derived from Suaeda salsa in coastal wetlands, a knockout mutant strain was obtained Penicillium citrinumHDN11-186-KOCitS, and a class of sorbitol-derived bridged bicyclic sorbitol family compounds were isolated from the solid fermentation products of this mutant strain. Studies have shown that the compounds have significant NLRP3 inflammasome inhibitory activity, can significantly reduce the levels of inflammatory factors IL-6 and NO, and promote the healing of diabetic refractory wounds by inhibiting excessive inflammatory responses, providing more options for the development of NLRP3 inflammasome inhibitors and the treatment of inflammation-related diseases. Summary of the Invention

[0004] The present invention aims to provide a class of novel compounds with NLRP3 inflammasome inhibitory activity and no side effects on normal cells. Its structural formula is Formula I: , The compounds of Formula I of the present invention can be obtained by microbial fermentation culture to obtain a fermented product containing such compounds, and then the crude fermentation extract is separated and purified by methods such as ODS reverse-phase column chromatography, Sephadex LH20 gel column chromatography, and semi-preparative HPLC.

[0005] The second object of the present invention is to provide a method for knocking out the gene encoding the biosynthetic mother nucleus of citrinin, the main product of the fungus Penicillium citrinum HDN11-186 to obtain a mutant strain Penicillium citrinum HDN11-186-KOCitS. The gene responsible for the biosynthesis of the citrinin mother nucleus in this patent is citS , its gene length is 7633 base pairs, encoding a non-reducing polyketide synthase CitS protein, and bioinformatics predicts that it contains 2584 amino acids; knocking out citS The upstream nucleotide sequence CitSup has a length of 2159 base pairs; knocking out citS The downstream nucleotide sequence CitSdown of has a length of 2015 base pairs; this method is applicable to the homologous recombination knockout of the citrinin mother nucleus gene in all fungi containing citS homologous sequences.

[0006] The third object of the present invention is to provide a production method for the sorbitol compounds.

[0007] The fourth object of the present invention is to provide the application of the sorbitol compounds in the preparation of NLRP3 inflammasome inhibitory drugs.

[0008] In the following examples of the present invention, examples of preparing the compounds of Formula I of the present invention using P. citrinum HDN11-186-KOCitS are listed. Brief Description of the Drawings

[0010] Figures 1 - 4This is a study on the repair-promoting effect of compound I on NIH3T3 cells:

[0011] Figure 1 Effect of Compound I on NIH3T3 cell proliferation after 24 h of treatment; Figure 2 Effects of Compound I on HG (200 mM or 300 mM)-induced oxidative damage in NIH3T3 cells. Figure 3 Effects of Compound I on H2O2-induced oxidative damage in NIH3T3 cells; Figure 4 Effect of compound I on LPS / RAW264.7-CM-induced inflammatory damage in NIH3T3 cells. Comparison between the model group and the normal control group # P<0.05, ## P<0.01, *P<0.05, **P<0.01 compared with the model group.

[0012] Figures 5 - 8 Compound I inhibits the release of inflammatory factors from macrophages and promotes the proliferation of fibroblasts:

[0013] Figure 5 Compound I inhibits LPS / ATP-induced IL-1β release in J774.A1 macrophages. Figure 6 Compound I inhibits LPS-induced NO release in RAW264.7 macrophages; Figure 7 Compound I inhibits LPS-induced IL-6 release in RAW264.7 macrophages; Figure 8 Compound I promotes NIH3T3 cell proliferation by inhibiting the production of inflammatory factors. Comparison between the model group and the normal control group # P<0.05, ## P<0.01, *P<0.05, **P<0.01 compared with the model group.

[0014] Figures 9 - 11 Study on the effect of compound I on promoting the healing of refractory wounds in diabetic mice

[0015] Figure 9 Images of wound healing in mice in each group at 0, 4, 6, 8, and 10 days after injury. Figure 10 Wound healing trends of mice in each group at 0, 4, 6, 8, and 10 days after injury. Figure 11 Comparison between the model group and the control group # P<0.05, ##P < 0.01, comparison between the compound I group and the model group; *P < 0.05, **P < 0.01, n = 4.

[0016] # And * respectively represent the activity level or potency of the control group compound and the experimental group (compound I). More # And * represent higher activity. Detailed implementation manner The chemical structure of compound I referred to in the following examples (the Arabic numerals in the structural formula are the carbon atom positions in the chemical structure) is: The following examples are further illustrations of the present invention, rather than limitations of the present invention.

[0018] Example 1 Citrinin mother nucleus gene knockout 1 Penicillium citrinum HDN11-186 spore collection and germination According to the conventional method for culturing microorganisms, take Penicillium citrinum an appropriate amount of HDN11-186, inoculate it onto a PDA flat medium, and culture it in an incubator at 28 °C for 4 days to collect its spores. Take 100 - 200 μ μL of the spore solution of the previously collected strain HDN11-186 and inoculate it into 45 mL of PDB + YE liquid medium [medium composition (g / L): potato 200.0, glucose 20.0, yeast extract 2.0], and culture it at 28 °C and 220 rpm with shaking for about 7.5 - 9 h. Microscopic examination is used to determine that most spores have germinated. The subsequent operations for the germination of the spores of strain HDN11-186 are carried out according to Table 1.

[0019] Step Operation 1 Add the culture solution after the strain germinates into a sterilized 50 mL centrifuge tube. Pre - cool the centrifuge to 4 °C and centrifuge at 4000 rpm for 6 min. Discard the supernatant. 2 Wash the thalli twice with 15 mL of OM buffer. Centrifuge at 4 °C and 4000 rpm for 6 min. Discard the supernatant. 3 Weigh 30 mg of Lysing Enzymes and 20 mg of Yatalase and add them to the OM buffer. After oscillating and dissolving, filter and sterilize with a 0.2 μm filter membrane, add to the thalli in the previous step and resuspend the spores. Pour the solution into a sterile conical flask and culture on a shaker at 28 °C and 80 rpm until the cell wall is dissolved. 4 Carefully add the enzymolyzed protoplasts into a sterile 50 mL centrifuge tube. Slowly and drop - by - drop add 10 mL of PTB buffer to the centrifuge tube. Centrifuge at 5000 rpm and 4 °C for 15 min. 5 Transfer the protoplasts at the interface of the upper and lower layer solutions into a new 10 mL sterile centrifuge tube. Add 2 volumes of pre - cooled STC buffer, gently pipette and mix well. Centrifuge at 5000 rpm and 4 °C for 8 min. 6 Discard the supernatant, add an appropriate amount of STC Buffer, gently mix well to resuspend the protoplasts, and aliquot them into 1.5 mL pre - cooled centrifuge tubes at 100 μL each. 2 Localization of the citrinin mother nucleus gene, construction of the gene knockout fragment and verification of protoplast transformation Method 1: Upload the fungal whole genome to the bioinformatics prediction website antiSMASH (https: / / fungismash.secondarymetabolites.org / #! / start) to predict the citrinin biosynthetic gene cluster and obtain its location in the genome; Method 2: Use the reported citrinin mother nucleus gene citS or the protein sequence CitS encoded by it to perform Local Blast in the local genome, and the interval with the highest score is the citrinin mother nucleus gene citSSequence. After determining the localization of the citrinin core gene, the upstream and downstream sequences were used as homologous regions for gene knockout, and the length of the homologous region was 1500 bp - 2500 bp (select the sequence interval within the length range that is easier to obtain according to sequence characteristics and PCR difficulty). It is necessary to include citS both sides or citS include the head and tail.

[0020] Construct the citrinin core gene knockout fragment of CitSup-G418-CitSdown by one-step fusion PCR (CitSup is the upstream homologous region of CitS, with a length of 2159 bp; CitSdown is the downstream homologous region of CitS, with a length of 2015 bp; G418 is the geneticin resistance gene). Add the purified knockout fragment to 100 μ μL of protoplasts, gently mix and let stand on ice for 65 min; then add 600 μ μL of PEG Buffer, gently pipette and mix well, and place at room temperature for 26 min; then aspirate the transformation solution and add it to a PSA plate containing resistance (218.6 g of sorbitol is added to the PDA medium), and place it in an incubator at 28 °C for 3 - 5 days. For the transformants grown after the transformation of HDN11-186 protoplasts, pick single colonies and inoculate them on a PDA resistance screening plate. After two passages, extract gDNA for PCR verification (the verification primers are YZ-F / R). The correctly verified transformants are stored at -20 °C.

[0021] The solution formulations used are as follows: OM buffer [MgSO4·7H2O 295.8 g (1.2 M), 0.2 M NaPhosphate buffer 50 ml (containing 9.09 g of Na2HPO4 and 16.34 g of NaH2PO4 in 1 L, pH 6.5), add 800 ml of ddH2O to dissolve, adjust the pH to 5.8 with 1 M NaH2PO4, make up the volume to 1 L, filter and sterilize with a 0.22 μm filter membrane, store at 4°C]; PTB buffer [d-sorbitol 109.3 g, pH = 7.0 Tris HCl 100 ml, add ddH2O to dissolve and make up the volume to 1 L, autoclave at 121°C for 20 min, store at 4°C]; STC buffer [d-sorbitol 218.6 g, CaCl2·2H2O 1.47 g, pH = 7.5 Tris HCl 10 ml, add ddH2O to dissolve and make up the volume to 1 L, autoclave at 121°C for 20 min, store at 4°C]; PEG Buffer [PEG 4000 60 g, CaCl2·2H2O 7.35 g, pH = 7.5 Tris-HCl 5 mL, add ddH2O to dissolve and make up the volume to 1 L, autoclave at 121°C for 20 min, store at room temperature].

[0022] Table 2 PCR primers used in this experiment Primer Name Sequence (5’ - 3’) CitSup - F AATCAACTATCAACTATTAACTATATCGTAATACCATATGCGTCGCCACCTTCA CitSup - R GCCTGAATGGCGAATGGAAATTGTAAGCGTTAATCTAGACGAGGCGCATTCAGTATGAC CitSdown - F GTGTCTACTGCTGGCCTAGTTTTCGGTACTATGCATATGGTCCTCGACTCTTTCCGTG CitSdown - R TTTGTCATTTAAATTAGTGATGGTGATGGTGATGCACGTGCATCAACAGGGCACCAGG G418 - F TCTAGATTAACGCTTACAATTTCCATTC G418 - R ATATGCATAGTACCGAAAACTAGGCC YZ-F GGAGTCATTGCGAGTACGAAGG YZ-R CCTGCAAGTTTGTGCTCAGC

[0023] Example 2 Fermentation production, separation and purification of Compound I

[0024] According to the conventional method of culturing microorganisms, an appropriate amount of the mutant strain Penicillium citrinum HDN11-186-KOCitS cells was inoculated onto a PDA plate medium and cultured in an incubator at 28 °C for 4 days for strain activation and spore collection. Prepare 22 L of PDA medium [medium composition (g / L): potato 200.0, glucose 20.0, agar 20.0], pour it into a petri dish to make a solid plate. Take an appropriate amount of Penicillium citrinum spores of the HDN11-186 mutant strain with CitS knocked out, inoculate them onto the PDA solid plate medium, and statically culture at 28 °C for 7 days to obtain the fermentation product.

[0025] The cells and the medium were broken and extracted 6 times with ethyl acetate. The extraction solutions were combined, filtered through a silk cloth to remove the cells and the medium, and the obtained supernatant was concentrated under reduced pressure to obtain a crude extract, totaling 28 g.

[0026] The extract (28 g) was dissolved in methanol and subjected to ODS reverse-phase column chromatography. Methanol-water was used as the mobile phase for gradient elution to obtain 15 fractions. Fraction 14 was first subjected to Sephadex LH20 gel column chromatography using methanol as the mobile phase, and then compound I (30 mg) was prepared by preparative reverse-phase high performance liquid chromatography (acetonitrile: water = 55:45).

[0027] Compound Ⅰ is a yellow powder, with the molecular formula C 29 H 28 O 10 , and HRESIMS m / z : 535.1597 [M − H] − (calcd. 535.1610); IR (KBr) ν max 3421, 1726, 1656, 1627, 1207, 1000 cm −1 . 1 The H and 13 C NMR data are shown in Table 3.

[0028] Table 3 1 H and 13 C NMR data of compound Ⅰ (400 and 100 MHz, in DMSO- d 6) a <![CDATA δ C , type]]> <![CDATA δ H ( J in Hz)]]> <![CDATA 1 H- 1 H COSY b > <![CDATA[HMBC (H→C) c > 1 62.0, C 2 195.1, C 3 109.0, C 4 42.4, CH 3.47, d (2.5) 8 2,3,5,6,7,8,9,27 5 73.4, C 6 209.2, C 7 49.5, CH 3.85, d (9.1) 8 1,2,4,6,8,15,16,25,26 8 42.1, CH 3.54, dd (9.1, 2.3) 4, 7 3,4,5,16,25,28 9 170.6, C 10 120.6, CH 6.63, d (15.0) 11 9,12 11 141.3, CH 7.12, dd (15.0, 10.7) 10, 12 9,12,13 12 131.2, CH 6.35, dd (14.8, 11.6) 11, 13 13,14 13 139.1, CH 6.22, dq (13.9, 6.6) 12,14 11,12,14 14 <![CDATA[18.6, CH3]]> 1.85, d (6.6) 13 12,13 15 79.6, C 16 121.9, C 17 179.1, C 18 108.0, C 19 159.8, C 20 112.6, CH 6.68, s 18,19,30 21 147.9, C 22 108.2, CH 6.97, s 17,18,20,23,30 23 156.4, C 25 168.6, C 26 <![CDATA[10.7, CH3]]> 1.50, s 1,2,6,7 27 <![CDATA[23.9, CH3]]> 1.07, s 4,5,6 28 173.9, C 29 <![CDATA[52.9, CH3]]> 3.66, s 28 30 <![CDATA[21.7, CH3]]> 2.37, s 20,21,22 19-OH 12.06, s 18,19,20

[0029] a) The signal assignments in this table are based on the results of HSQC, HMBC, and 1 H- 1 H COSY spectra analysis.

[0030] b) The numbers and codes in this column represent the 1 H- 1 H nuclei that give coupling-related signals with the 1 H in the corresponding row in the 1 H-

[0031] c) The numbers and codes in this column represent the 1 C nuclei that give coupling-related signals with the 13 H in the corresponding row in the HMBC spectrum.

[0032] Example 3 Activity test of the compound against inflammasome

[0033] Preparation of experimental solutions Stock solution of compound I: 12 mg of compound I was added to 500 μDMSO of L was used to prepare a stock solution of Compound I at 52 mM (24 mg / mL).

[0034] Penicillin-streptomycin mixture (100×): Weigh 1×106 U of penicillin and 1 g of streptomycin, dissolve them in 100 mL of ultrapure water, and filter-sterilize with a 0.22 μ μm pore size filter membrane. Dilute 100-fold before use.

[0035] Complete DMEM medium: 89% of the original DMEM medium + 1% of the penicillin-streptomycin mixture + 10% fetal bovine serum.

[0036] SRB dye: Weigh 0.4 g of SRB dye powder, add 1% glacial acetic acid, and make up the volume to 100 mL with double-distilled water.

[0037] Trichloroacetic acid solution: Weigh 50 g of trichloroacetic acid and dissolve it in 500 mL of double-distilled water.

[0038] Tris solution: Weigh 0.1215 g of Tris and dissolve it in 100 mL of double-distilled water.

[0039] Positive drug MCC950 was prepared at 1 mg / mL for activity testing.

[0040] Cell culture Resuscitate the required cells at 37 °C, resuspend the cells with complete DMEM medium and place them in a cell culture dish, and culture them in a 37 °C incubator containing 5% CO2. Passage and experiments were carried out according to the growth status and density. When the cell density reached 80 - 90%, discard the medium, add 2 mL of PBS for washing, then add 2 mL of trypsin for digestion. NIH3T3 cells can be digested for about 5 s under the microscope. After digestion, discard the trypsin and resuspend with fresh medium, passage at 1 / 4. RAW264.7 cells can be passaged directly without trypsin digestion.

[0041] Effect of Compound I on the proliferation of NIH3T3 cells Take NIH3T3 cells in the logarithmic growth phase, seed them in a 96-well plate at a density of 8×103 cells / well, and place them in the incubator overnight. Then, add Compound I with final concentrations of 0.625 - 160 μ μM to the Compound I administration groups, and add an equal amount of sterile water to the control group. Set 5 replicates for each group and continue to culture in the incubator for 24 h.

[0042] After the culture, discard the upper culture medium, add 10% pre-cooled TCA to fix the cells, 100 μL / well, let it stand for 5 min, fix it in a 4 °C refrigerator for more than 1 h. Then rinse it with tap water 5 - 6 times and dry it in a 37 °C oven. Add SRB dye, 100 μ L / well, stain it in the dark at room temperature for 15 min, then wash it 5 - 6 times with 1% glacial acetic acid to wash away the excess dye, and dry it in a 37 °C oven. Finally, add 150 μ L of 10 mM Tris-HCL solution to each well, incubate it at 37 °C for 10 min, and then measure the absorbance (OD) value at a wavelength of 515 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0043] Calculate the cell survival rate, and the survival rate is calculated according to the following formula: Survival rate % = OD of the drug-treated group / OD of the control group × 100% Effect of Compound I on Oxidative Damage of HG-Induced NIH3T3 Cells Take NIH3T3 cells in the logarithmic growth phase, seed them in a 96-well plate at a density of 8×10³ cells / well, and place them in an incubator overnight. Then, the NIH3T3 cells are divided into a control group, an HG group, and a Compound I group. The Compound I treatment groups are respectively added with Compound I at a final concentration of 1.25, 2.5, 5 μ M and glucose at a final concentration of 200 or 300 mM; the control group is added with an equal amount of sterile water. Each group has 5 replicates and is placed in an incubator for further culture for 24 h. After the culture is completed, the cell viability of NIH3T3 is detected by the SRB method.

[0044] Effect of Compound I on Oxidative Damage of H₂O₂-Induced NIH3T3 Cells Take NIH3T3 cells in the logarithmic growth phase, seed them in a 96-well plate at a density of 8×10³ cells / well, and place them in an incubator overnight. Then, the NIH3T3 cells are divided into a control group, an H₂O₂ group, and a Compound I group. The Compound I group is respectively added with Compound I at a final concentration of 1.25, 2.5, 5 μ M, and the control group and the H₂O₂ group are added with an equal amount of sterile water. Each group has 5 replicates and is placed in an incubator for further culture for 24 h. After the culture is completed, each of the H₂O₂ group and the Compound I group is added with H₂O₂ at a final concentration of 200 μ M and then continue to culture for 2 h. After the culture is completed, the cell viability of NIH3T3 is detected by the SRB method.

[0045] Effect of Compound I on Inflammatory Damage of Conditioned Medium-Induced NIH3T3 Cells Preparation of conditioned medium (LPS-RAW264.7 / CM): RAW264.7 cells in the logarithmic growth phase were seeded in 6-well plates at a density of 4×105 cells / well, incubated overnight in an incubator, and then divided into a control group and an LPS group. The LPS group was added with LPS at a final concentration of 100 ng / mL, and the control group was added with an equal volume of sterile water. The cells were further incubated in the incubator for 24 h. After the incubation, the cell supernatants of each group were collected, centrifuged, and transferred to new centrifuge tubes and stored in a -20 °C refrigerator.

[0046] NIH3T3 cells in the logarithmic growth phase were seeded in 96-well plates at a density of 8×103 cells / well, incubated overnight in an incubator, and then the NIH3T3 cells were divided into a control group, a conditioned medium group, and a compound I group. The compound I group was added with compound I at final concentrations of 1.25, 2.5, 5 μ μM. The control group and the conditioned medium group were added with an equal volume of sterile water. Five replicates were set for each group. After pretreatment for 2 h, conditioned medium was added to each group except the control group and incubated for another 24 h.

[0047] After the incubation, the cell viability of NIH3T3 was detected by the SRB method.

[0048] Detection and data analysis Cultured in a 37 °C constant temperature incubator, the luminescence values were measured at 24 h and 72 h using an envision, and the minimum inhibitory concentration (MIC) of the samples was determined according to the luminescence values. (Minimum inhibitory concentration: The concentration that inhibits 90% of bacterial growth is the minimum inhibitory concentration. In this study, the luminescence value RLU of the DMSO negative control group was used as a reference, and the concentration that could reduce the luminescence value RLU by 90% was the minimum inhibitory concentration.)

[0049] Study on the repair effect of compound I on cell damage induced by HG, H2O2 or LPS / RAW264.7-CM As attached Figure 1 shown, after different concentrations of compound I were applied to NIH3T3 cells for 24 h, as the concentration of compound I increased, the cell viability of NIH3T3 cells gradually decreased, showing concentration dependence. At concentrations of 80 μ μM and less than 80 μ μM, the cell viability was greater than 95%, and there was no significant effect on cell proliferation under this experimental condition.

[0050] As attached Figure 2As shown, high-concentration glucose caused oxidative damage to cells. The cell viability of NIH3T3 in the 200 mM HG group was about 80%, and the cell viability was still about 80% after co-treatment with 200 mM HG and Compound I for 24 h; the cell viability of NIH3T3 in the 300 mM HG group was about 80%, and the cell viability was still about 60% after co-treatment with 300 mM HG and Compound I for 24 h, indicating that Compound I had no effect on HG-induced oxidative damage of NIH3T3 cells.

[0051] Attachment Figure 3 Shown, H2O2 significantly inhibited the proliferation of NIH3T3 cells through oxidative damage, and the cell viability was about 78%. After adding H2O2 24 h after pretreatment with Compound I, the cell viability of NIH3T3 was still about 78%, indicating that Compound I had no effect on H2O2-induced oxidative damage of NIH3T3 cells.

[0052] Lipopolysaccharide (LPS) induced the polarization of macrophages RAW264.7 towards M1, characterized by the induction of inducible nitric oxide synthase (iNOS), the production of nitric oxide (NO), and the secretion of pro-inflammatory cytokines (TNF-α, IL-1β, IL-6). The combined action of multiple inflammatory factors can simulate the inflammatory microenvironment mediated by macrophages in vivo. According to Attachment Figure 4 , the supernatant after LPS stimulation of RAW264.7 macrophages, namely the LPS / RAW264.7-CM conditioned medium, significantly inhibited the proliferation of NIH3T3 cells after 24 h of action due to the presence of multiple inflammatory factors, and the cell viability was about 50%. After adding the LPS / RAW264.7-CM conditioned medium 2 h after pretreatment with Compound I and co-treating for 24 h, the cell viability of NIH3T3 was still about 50%, indicating that Compound I had no effect on the inflammatory damage of NIH3T3 cells induced by the LPS / RAW264.7-CM conditioned medium.

[0053] Compound I inhibits the release of inflammatory factors in macrophages and promotes the proliferation of fibroblasts As shown in the attachment Figure 5 Shown, ATP / LPS in the model group induced the activation of inflammasomes in J774.A1 cells. Compared with the normal control group, the level of IL-1β increased. After adding Compound I, the release of IL-1β could be reduced, and it was concentration-dependent. According to Attachment Figures 6-7, compared with the normal control group, LPS in the model group significantly increased the levels of inflammatory factors NO and IL-6 in RAW264.7 macrophages. After adding Compound I, the levels of inflammatory factors NO and IL-6 in RAW264.7 macrophages were significantly decreased (P<0.01), indicating that Compound I has good activity in inhibiting the release of macrophage inflammatory factors. At the same time, the culture supernatants of RAW264.7 macrophages stimulated by LPS and the culture supernatants of RAW264.7 macrophages co-stimulated by LPS and Compound I were collected and used to culture NIH3T3 fibroblasts to study the effects of two different conditioned media on the proliferation of NIH3T3 fibroblasts. According to Appendix Figure 8 , compared with the normal control group, the LPS / RAW264.7-CM model group significantly inhibited the proliferation of NIH3T3 fibroblasts due to the presence of various inflammatory factors (P<0.01). However, compared with the LPS / RAW264.7-CM model group, the cell viability of NIH3T3 fibroblasts in the (I+LPS) / RAW264.7-CM group was significantly increased (P<0.01), indicating that Compound I can reduce the damage of inflammatory factors to NIH3T3 fibroblasts by inhibiting the release of inflammatory factors in LPS-induced RAW264.7 macrophages, thereby promoting the proliferation of NIH3T3 fibroblasts.

[0054] Example 4 Effect of Compound I on the Healing of Refractory Wounds in Diabetic Mice 1 Experimental Samples and Experimental Methods

[0055] Experimental Animals SPF-grade 6-week-old C57BL / 6 mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., and the experimental animal production license number was: SCXK (Beijing) 2021-0006.

[0056] Preparation of Experimental Solutions STZ solution: Weigh streptozotocin and prepare a 1% STZ solution with sodium citrate buffer. Place it in the dark on ice and use it immediately. Use it up within 30 minutes.

[0057] Compound I medicinal solution: Compound I was prepared into a stock solution with a concentration of 24 mg / mL using DMSO. When administering the drug, dilute the stock solution with sterile physiological saline to a medicinal solution with a concentration of 0.25 mg / mL, and the DMSO content was 1.04%.

[0058] Establishment of Diabetic Mouse Model After the mice were fasted but not water-deprived for 4 h, they were intraperitoneally injected with STZ solution (50 mg / kg) for 5 consecutive days. After 72 h, a blood glucose meter and blood glucose test strips were used to detect blood glucose. A blood glucose level ≥16.67 mmol was considered successful modeling.

[0059] Establishment of a refractory wound model in diabetic mice After fasting the mice for 4 h without water deprivation, they were anesthetized by intraperitoneal injection of 10% chloral hydrate (400 mg / kg). Then the back hair was shaved, and the area was disinfected with 75% alcohol. Two circular modeling areas with a diameter of 8 mm were marked on the back using a skin biopsy punch and a marker pen. Under sterile conditions, the skin in the modeling area was cut off to form a full-thickness skin wound reaching the fascia layer.

[0060] Experimental grouping and drug administration A normal control group, a model group, and a compound I group were set up. The normal control group consisted of non-diabetic mice with wounds made, and the model group and the compound I group consisted of diabetic mice with wounds made.

[0061] The drug stock solution dissolved in DMSO was diluted with sterile normal saline to a drug solution with a DMSO content of 1.04%. Taking the day when the wound was made as day 0, after a 2-day adaptation interval, drug administration started. The drug was externally dropped on the wound 2 times a day at the same time, once in the morning and once in the afternoon, with a dosage of 4 mg / kg. The normal control group and the model group were externally dropped with an equal amount of sterile normal saline, and drug administration was continued until the wound healed.

[0062] Wound image acquisition and calculation of wound healing rate Wound images were collected every 2 days. The ImageJ image analysis software was used to analyze and calculate the wound areas on the 4th, 6th, 8th, and 10th days, and finally the wound healing rate was calculated.

[0063] Wound healing rate (%) = 1 - (wound area on day x / wound area on day 0) × 100%.

[0064] Statistical methods The software GraphPad Prism 8 was used for statistical analysis of the experimental data. The data were expressed in the form of mean ± standard deviation (x ± s). The independent samples t-test was applied to compare the means of two groups of samples, and One-way ANOVA was applied to compare the means of multiple groups of samples. P < 0.05 indicated that the difference was statistically significant.

[0065] 2 Experimental results Compound I promotes the healing of refractory wounds in diabetic mice As attached Figures 9-11As shown, during the entire wound healing process, the wound area of the model group was always larger than that of the normal control group, indicating that the hyperglycemic state significantly delayed the healing of diabetic wounds. On the 4th day, the wounds of each group had scabbed over. Among them, the scab area of the compound I treatment group was significantly smaller than that of the model group. The wound healing rates of the normal control group, the model group, and the compound I group were 77.57%, 35.73%, and 54.5% respectively. On the 6th day, the wound areas of each group further decreased. Among them, the scab of the normal control group had completely fallen off and the wound healed well, with a wound healing rate of 96.11%. However, the scabs of the wounds in the model group and the compound I treatment group had not fallen off yet. Among them, the scab area of the compound I treatment group was significantly smaller than that of the model group. The wound healing rate of the model group was 70.36%, and the wound healing rate of the compound I treatment group was 87.40%. On the 8th day, most of the scabs on the wounds in the compound I treatment group had fallen off, and the wound area was significantly smaller than that of the model group. The wound healing rate of the model group was 82.49%, and the wound healing rate of the compound I treatment group was 96.96%. On the 10th day, the scabs on the wounds in the compound I treatment group had completely fallen off and the wound healed well, with a wound healing rate of 100%. The scabs on the wounds in the model group had also fallen off, but there were obvious pigmented scars and the wound was not completely healed, with a wound healing rate of 96.59%. The time required for the wounds in the normal control group, the model group, and the compound I treatment group to completely heal was 7 days, 13 days, and 10 days respectively, indicating that compound I can significantly promote the healing of refractory wounds in diabetic mice (P<0.01).

[0066] 3 Conclusion Compound I has significant NLRP3 inflammasome inhibitory activity, can significantly reduce the levels of inflammatory factors IL-6 and NO, and promotes the healing of refractory diabetic wounds by inhibiting excessive inflammatory responses. It can be used as an anti-inflammasome drug for the treatment of inflammation-related diseases.

Claims

1. A compound represented by the following formula structure .

2. A mutant strain Penicillium citrinum Preparation method of HDN11-186-KOCitS, characterized in that Using a fungus sourced from Suaeda salsa in coastal wetlands Penicillium citrinum After whole-genome sequencing of HDN11-186 (Accession No.: CCTCC No: M 20232373) and bioinformatics analysis, the parental gene responsible for citrinin biosynthesis citS was subjected to homologous recombination knockout based on Geneticin (G418) resistance screening to obtain a knockout mutant strain Penicillium citrinum HDN11-186-KOCitS.

3. The method for extraction, preparation, refining and purification of the compound according to claim 1, characterized in that comprising the following steps: The knockout strain P. citrinum HDN11-186-KOCitS was first cultured on a PDA solid medium containing 350 μg / ml of the antibiotic G418 in an incubator at 28 °C for 4 days. After collecting the spores, they were inoculated on the PDA solid medium and statically fermented at 28 °C for 7 days. After fermentation, the medium together with the thalli was chopped and extracted with ethyl acetate 6 times. The extract was filtered through a Buchner funnel and concentrated under reduced pressure to obtain a crude extract. The crude extract was preliminarily separated by ODS reversed-phase column chromatography with methanol-water as the mobile phase, and further separated by Sephadex LH20 gel column chromatography with methanol as the mobile phase. Finally, the compound described in claim 1 was separated and purified by reversed-phase semi-preparative high-performance liquid chromatography, and the mobile phase was acetonitrile: water = 55:

45.

4. Use of the compound according to claim 1 in the preparation of an anti-inflammatory drug.

Images