Application of gene FAP in preparation of medicine for treating non-alcoholic steatohepatitis

Abstract

The invention discloses application of a gene FAP in preparation of a medicine for treating non-alcoholic steatohepatitis, and belongs to the technical field of biological medicines. The invention proposes that the expression of the silencing or interfering gene FAP can be used for treating or assisting in treating the non-alcoholic steatohepatitis. The invention provides a new strategy for preparing the medicine for treating the non-alcoholic and fat hepatitis by using the siRNA for the first time, multi-angle and multi-level verification research is carried out, a foundation is provided for design and clinical application of nucleic acid medicines, and the application has important clinical treatment significance.

Description

Technical Field

[0001] The present invention relates to the application of gene FAP in the preparation of drugs for non-alcoholic steatohepatitis, belonging to the field of biomedical technology. Background Art

[0002] Metabolic Dysfunction-Associated Fatty Liver Disease (MAFLD) is a liver disease associated with metabolic disorders, previously known as Non-alcoholic Fatty Liver Disease (NAFLD), including a series of liver diseases ranging from steatosis to Non-alcoholic Steatohepatitis (NASH). Now, Metabolic Dysfunction-Associated Steatohepatitis (MASH) has replaced NASH, and the new definition emphasizes the role of metabolic abnormalities in the development of the disease more strongly. Under the condition of hepatic steatosis, if one of type 2 diabetes, abnormal metabolism, and overweight / obesity is present, it will be diagnosed as MAFLD. MAFLD is the most common chronic liver disease worldwide, and MASH is an inflammatory subtype of MAFLD, accompanied by steatosis, hepatocyte injury, and inflammation. Although the progression of MASH is very slow, if left untreated, more than 20% of patients will eventually develop into irreversible cirrhosis, and the risk of liver cancer in MASH patients is relatively high. The core pathogenesis of MASH is the excessive accumulation of fatty acids in hepatocytes, which triggers endoplasmic reticulum stress, oxidative stress, and inflammasome activation, and these processes are closely related to MASH phenotypes such as hepatocyte injury, inflammation, and fibrosis. Currently, Resmetriom is the world's first drug approved by the FDA for the treatment of MASH, and other drugs are in the clinical trial stage. Therefore, finding effective other therapeutic targets is another research hotspot for the treatment of MASH.

[0003] Fibroblast Growth Factor 21 (FGF21) is an atypical member of the FGF superfamily. It can enter the systemic circulation and regulate lipid and carbohydrate metabolism in an endocrine manner. FGF21 is a stress hormone, mainly derived from the liver, and has anti-obesity, insulin-sensitizing, and hepatoprotective properties. The protective effect of this protein against MASH targets its pathological features, including reducing fatty acid accumulation, hepatic steatosis, and alleviating inflammation and fibrosis. FGF21 can increase the level of adiponectin while inhibiting the level of Tumor Necrosis Factor Alpha (TNF-α), thereby reducing the accumulation of free fatty acids, inhibiting endoplasmic reticulum stress, the accumulation of reactive oxygen species, and apoptosis, thus reducing the activation of hepatic stellate cells and the accumulation of inflammatory cells, thereby achieving anti-fibrotic and anti-inflammatory effects.

[0004] Fibroblast activation protein (FAP) is a type II transmembrane serine protease and a member of the proline peptidase family, possessing dipeptidyl peptidase and endopeptidase activities. FAP is a site-specific endopeptidase of human FGF21 but cannot cleave murine FGF21. FAP exists in a soluble form in the blood and can inhibit the beneficial activity of endogenous FGF21 protein. FAP can cleave 10 amino acids at the C-terminus of human FGF21, preventing FGF21 from binding to its corresponding receptor and reducing its potency in cell signaling analysis by 380-fold, thereby generating inactive FGF21.

[0005] Small nucleic acid drugs exert their pharmacological effects through RNA interference (RNAi), have a restricted selection of corresponding targets, high specificity, and can expand the drug targets to the upstream RNA of functional proteins to regulate the expression of target genes at the post-transcriptional level. In the early stage of developing siRNA therapies, many drugs were designed based on completely unmodified or slightly modified siRNAs to reach the appropriate tissues and then silence the target genes. These molecules can mediate gene silencing in vivo. However, limited efficacy and potential off-target effects may be observed with these approaches. The present invention aims to prepare the MASH-effective therapeutic target FAP as a modified siRNA drug with RNA interference effects in cells and mice to reduce the expression of FAP and delay the development of MASH. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to find an effective therapeutic target and provide a nucleic acid drug that is effective in treating MASH, namely the nucleic acid drug siFAP, to achieve a significant improvement in the efficacy of MASH. The results of the study showed that by administering different concentrations of siFAP by tail vein injection to genetically engineered mice with humanized FGF21 fragments and wild-type mice fed with MCD feed to construct a MASH model, the expression of FAP protein can be reduced while the expression of FGF21 protein is upregulated. The present invention applies siFAP to genetically engineered mice with humanized FGF21 fragments and wild-type mice fed with MCD feed to construct a MASH model, verifying that FAP can cut humanized FGF21 fragments but cannot cut mouse FGF21, and at the same time verifying the therapeutic effect of the drug on MASH. The results showed that siFAP can block the cleavage of the humanized FGF21 gene fragment, and at the same time, siFAP can effectively inhibit the disease progression of MASH model mice by protecting FGF21.

[0007] The first technical solution provided by the present invention is a double-stranded siRNA molecule, as shown below:

[0008] The siRNA molecule for inhibiting FAP gene expression comprises a double-stranded siRNA molecule formed by complementation of the RNA single strand shown in SEQ ID NO.1 and the RNA single strand shown in SEQ ID NO.2; each nucleotide in the siRNA is independently a modified or unmodified nucleotide.

[0009] In certain embodiments, at least one nucleotide in the double-stranded siRNA molecule is a modified nucleotide.

[0010] In certain embodiments, all nucleotides in the double-stranded siRNA molecule are modified nucleotides.

[0011] In certain embodiments, the modification is selected from phosphorothioate, 2'-F, 2'-OMe, 2'-Ara-F, 2'-O-MOE, m 6 A or m 5 At least one of C.

[0012] In certain embodiments, the modified molecule is as shown in any one of (1) to (7):

[0013]

[0014] In certain embodiments, the double-stranded siRNA molecule is as shown in any one of the groups siFAP-1 to siFAP-16: siFAP-1:

[0015] 5'(A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U)3';

[0016] 5'[A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3';siFAP-2:

[0017] 5'(A)- A -(C) A (U) C (U) A (CAG) A (A) U (U) A (G) C (A) U (U)3';

[0018] 5' A -(A)- U (G) C (U) A (A) U (U) CUG (U) A (G) A (U) G (U) U -(U)- C 3';siFAP-3:

[0019] 5'( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U )3';

[0020] 5'[A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U)[G]( U )[U]-( U )-[C]3'; siFAP-4:

[0021] 5'( A )- A -( C ) A ( U ) C ( U ) A ( CAG ) A ( A ) U ( U ) A ( G ) C ( A ) U ( U )3';

[0022] 5' A -( A )- U ( G ) C ( U ) A ( A ) U ( U ) CUG ( U ) A ( G ) A ( U ) G ( U ) U -( U )- C 3'; siFAP-5:

[0023] 5'(A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3';

[0024] 5'[A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C]3'; siFAP-6:

[0025] 5'(A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U)3';

[0026] 5'[A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C']3';

[0027] siFAP-7:

[0028] 5'(A*)- A* -(C) A* (U) C (U) A* (CA*G) A* (A*) U (U) A* (G) C (A*) U (U)3';

[0029] 5' A* -(A*)- U (G) C (U) A* (A*) U (U) CUG (U) A* (G) A* (U) G (U) U -(U)- C 3';siFAP-8:

[0030] 5'( A* )-[A*]-( C )[A*]( U )[C]( U )[A*]( CA*G )[A*]( A* )[U]( U )[A*]( G )[C]( A* )[U]( U )3';

[0031] 5'[A*]-( A* )-[U]( G )[C]( U )[A*]( A* )[U]( U )[CUG](U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C]3'; siFAP-9:

[0032] 5'( A* )- A* -( C ) A* ( U ) C ( U ) A* ( CA*G ) A* ( A* ) U ( U ) A* ( G ) C ( A* ) U ( U )3';

[0033] 5' A* -( A* )- U ( G ) C ( U ) A* ( A* ) U ( U ) CUG ( U ) A* ... ( G ) A* ( U ) G ( U ) U -( U )- C 3'; siFAP-10:

[0034] 5'(A)- A -(C') A (U) C '](U) A (C'AG) A (A) U (U) A (G) C '](A) U (U)3';

[0035] 5' A -(A)- U (G) C '](U) A (A) U (U) C ' UG (U) A (G) A (U) G (U) U -(U)- C ']3';

[0036] siFAP-11:

[0037] 5'( A )-[A]-( C ')[A]( U )[C']( U )[A]( C ' AG )[A]( A )[U]( U )[A]( G )[C']( A )[U]( U )3';

[0038] 5'[A]-( A )-[U]( G )[C']( U )[A]( A )[U]( U )[C'UG]( U )[A]( G )[A]( U )[G]( U )[U]-([[ID=�5]] U )-[C']3';

[0039] siFAP-12:

[0040] 5'( A )- A -( C ') A ( U ) C ']( U ) A ( C ' AG ) A ( A ) U ( U )A ( G ) C ']( A ) U ( U )3';

[0041] 5' A -( A )- U ( G ) C ']( U ) A ( A ) U ( U ) C ' UG ( U ) A ( G ) A ( U ) G ( U ) U -( U )- C ']3';

[0042] siFAP-13:

[0043] 5'(A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U)3';

[0044] 5'[A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C']3'; siFAP-14:

[0045] 5'(A*)- A* -(C') A* (U) C '](U) A* (C'A*G) A* (A*) U (U) A* (G) C '](A*) U (U)3';

[0046] 5' A* -(A*)- U (G)C '](U) A* (A*) U (U) C ' UG (U) A* (G) A* (U) G (U) U -(U)- C ']3'; siFAP-15:

[0047] 5'( A* )-[A*]-( C ')[A*]( U )[C']( U )[A*]( C ' A*G )[A*]( A* )[U]( U )[A*]( G )[C']( A* )[U]( U )3';

[0048] 5'[A*]-( A* )-[U]( G )[C']( U )[A*]( A* )[U]( U )[C'UG]( U )[A*]( G )[A*]( U )[G]( U )[U]-( U )-[C']3';

[0049] siFAP-16:

[0050] 5'( A* )- A* -( C ') A* ( U ) C ']( U ) A* ( C ' AG ) A* ( A* ) U ( U ) A* ( G ) C ']( A* ) U (U ) 3';

[0051] 5' A* ) - ( A* ) - U ( G ) C ']( U ) A* ( A* ) U ( U ) C ' UG ( U ) A* ( G ) A* ( U ) G ( U ) U ) - ( U ) - C '] 3';

[0052] Wherein, A-, U-, C-, and G- respectively represent ribonucleotides A, U, C, and G modified with phosphorothioate;

[0053] (A), (U), (C), and (G) respectively represent ribonucleotides A, U, C, and G modified with 2'-F;

[0054] [A], [U], [C], and [G] respectively represent ribonucleotides A, U, C, and G modified with 2'-OMe;

[0055] (A) , (U) , (C) and (G) respectively represent ribonucleotides A, U, C, and G modified with 2'-Ara-F;

[0056] [A] , [U] , [C] and [G] respectively represent ribonucleotides A, U, C, and G modified with 2'-O-MOE;

[0057] A*, U*, C*, and G* respectively represent ribonucleotides A, U, C, and G modified with m 6 A;

[0058] A', U', C', and G' respectively represent ribonucleotides A, U, C, and G modified with m 5 C.

[0059] The second technical solution provided by the present invention is an expression vector carrying the siRNA described in the first technical solution.

[0060] The third technical solution provided by the present invention is a host cell containing the siRNA described in the first technical solution, or transformed with the expression vector described in the second technical solution.

[0061] The fourth technical solution provided by the present invention is a pharmaceutical composition, which contains the siRNA described in the first technical solution, or the expression vector described in the second technical solution, or the host cell described in the third technical solution.

[0062] In certain embodiments, the pharmaceutical composition contains a pharmaceutically acceptable carrier or excipient.

[0063] In certain embodiments, the pharmaceutically acceptable carrier includes liposomes, microcells, metal particles, or polymer particles.

[0064] The fifth technical solution provided by the present invention is the use of the siRNA described in the first technical solution, or the expression vector described in the second technical solution, or the host cell described in the third technical solution in the preparation of a drug for preventing, alleviating, and / or treating non-alcoholic steatohepatitis.

[0065] In certain embodiments, the use includes at least one of the following effects:

[0066] (1) Reducing the ratio of liver weight to body weight of an individual;

[0067] (2) Improving the glucose metabolism ability of an individual;

[0068] (3) Repairing liver injury of an individual;

[0069] (4) Reducing the levels of TG and TC in the liver of an individual;

[0070] (5) Alleviating the degree of liver fibrosis of an individual.

[0071] Beneficial effects

[0072] 1. The present invention first proposes that interfering with or silencing the expression of gene FAP can improve MASH. For the MASH model constructed by fragment humanized FGF21 gene-engineered mice fed with MCD diet, it can improve the degree of weight loss, and can also improve the liver weight to body weight ratio, and improve the glucose metabolism ability of mice. It has jointly improved the development of MASH from three aspects: liver injury, liver lipid accumulation, and fibrosis.

[0073] 2. The present invention first proposes a drug for treating MASH prepared using the nucleic acid drug siFAP, which will promote the application of nucleic acid drugs in the clinical treatment of MASH and is of great significance. The research of drugs generally takes 8 - 10 years on average from compound molecules to actually entering clinical trials, and requires a large amount of human and material resources, with huge time costs and economic costs. The solution of the present invention can greatly shorten the time from drug discovery to clinical transformation. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 It shows the expression levels of the FAP gene in the liver tissues of fragment humanized FGF21 transgenic mice and wild - type mice after tail - vein injection of three siFAPs after successful transfection of three siFAPs in the mouse breast cancer cell line 4T1 and successful modeling of MASH. Among them, Figure A shows the relative expression level of the FAP gene in the 4T1 cell line after transfection of three siFAPs; Figure B shows the relative expression level of the FAP gene in the liver of fragment humanized FGF21 transgenic mice; Figure C shows the relative expression level of the FAP gene in the liver of wild - type mice.

[0075] Figure 2 It shows the expression levels of the FAP gene in the liver tissues of fragment humanized FGF21 transgenic mice and wild - type mice after tail - vein injection of the third siFAP - 1 to the third siFAP - 16 after successful transfection of the third siFAP - 1 to the third siFAP - 16 in the mouse breast cancer cell line 4T1 and successful modeling of MASH. Figure A shows the relative expression level of the FAP gene in the 4T1 cell line after transfection of the third siFAP - 1 to the third siFAP - 16; Figure B shows the relative expression level of the FAP gene in the liver of fragment humanized FGF21 transgenic mice after tail - vein injection of the third siFAP - 1 to the third siFAP - 16; Figure C shows the relative expression level of the FAP gene in the liver of wild - type mice after tail - vein injection of the third siFAP - 1 to the third siFAP - 16.

[0076] Figure 3 It shows the changes in body weight and liver weight / body weight of fragment humanized FGF21 transgenic mice and wild - type mice after tail - vein injection of the third siFAP - 16 after successful modeling of MASH. Figure A shows the change in body weight of wild - type mice from 10 weeks of age to 17 weeks of age during modeling; Figure B shows the change in body weight of fragment humanized FGF21 mice from 10 weeks of age to 17 weeks of age during modeling; Figure C shows the change in liver weight / body weight of the two types of mice from 10 weeks of age to 15 weeks of age during modeling; Figure D shows the change in liver weight / body weight after drug intervention in the two groups of mice after successful modeling at 15 weeks of age.

[0077] Figure 4Results of glucose tolerance tests of fragment humanized FGF21 genetically engineered mice and wild-type mice at different modeling times. Figure A shows the glucose tolerance results of two groups of mice from 10 weeks of age to 12 weeks of age after 2 weeks of modeling; Figure B shows the glucose tolerance results of two groups of mice at 15 weeks of age after 5 weeks of modeling; Figure C shows the glucose tolerance results of two groups of mice at 17 weeks of age after 2 weeks of drug administration while modeling for 7 weeks.

[0078] Figure 5 Changes in aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in the serum, which are liver injury indicators, of fragment humanized FGF21 genetically engineered mice and wild-type mice at different modeling times and drug administration time segments. Figures A and C respectively show the changes in serum AST and ALT of wild-type mice from 10 weeks of age to 17 weeks of age after modeling; Figures B and D respectively show the changes in serum AST and ALT of fragment humanized FGF21 mice from 10 weeks of age to 17 weeks of age after modeling; Figures E and F show the changes in serum AST and ALT of the two groups of mice at different drug administration time points during the same modeling time.

[0079] Figure 6 Changes in triglyceride (TG) and cholesterol (TC) in the liver, which are liver injury indicators, of fragment humanized FGF21 genetically engineered mice and wild-type mice at different modeling times and drug administration time segments. Figures A and C respectively show the changes in liver TG and TC of wild-type mice from 10 weeks of age to 17 weeks of age after modeling; Figures B and D respectively show the changes in liver TG and TC of fragment humanized FGF21 mice from 10 weeks of age to 17 weeks of age after modeling; Figures E and F show the changes in liver TG and TC of the two groups of mice at different drug administration time points during the same modeling time.

[0080] Figure 7 Liver staining section diagrams of fragment humanized FGF21 genetically engineered mice and wild-type mice at different modeling times and drug administration time segments. Figure A shows HE staining of the two groups of mice at different time points; Figure B shows Oil Red O staining of the two groups of mice at different time points; Figure C shows Sirius red staining of the two groups of mice at different time points; Figure D shows Masson staining of the two groups of mice at different time points. Detailed implementation manners

[0081] The following are descriptions of the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0082] Raw materials used in the embodiments:

[0083] 1. C57BL / 6J wild-type mice were purchased from Cyagen Biosciences (Suzhou) Inc.

[0084] 2. The C57BL / 6J fragment humanized FGF21 gene-engineered mice were purchased from Cyagen Biosciences (Suzhou) Inc.

[0085] 3. The mouse breast cancer cell line 4T1 was obtained from ATCC.

[0086] 4. siNC was from Jiangsu Saisuofei Biotechnology, and the specific sequence is as follows:

[0087] 5'UUCUCCGAACGUGUCACGUTT 3';

[0088] 5'ACGUGACACGUUCGGAGAATT 3'.

[0089] Example 1 Synthesis of unmodified siRNA and LNP-siFAP

[0090] The siRNA was designed according to the full-length FAP mRNA sequence, and the activities of all candidate siRNAs were evaluated based on the basic design principles of siRNA, and the siRNA was initially designed and synthesized. All sequences were from the NCBI gene database.

[0091] The first kind:

[0092] 5'GGGUGUUUAUGAAGUUGAAGA 3' (SEQ ID NO.3);

[0093] 5'UUCAACUUCAUAAACACCCAG 3' (SEQ ID NO.4);

[0094] The second kind:

[0095] 5'GUCAGAAGUUCAAGUGCUA 3' (SEQ ID NO.5);

[0096] 5'UAGCACUUGAACUUCUGACUU 3' (SEQ ID NO.6);

[0097] The third kind:

[0098] 5'AACAUCUACAGAAUUAGCAUU 3' (SEQ ID NO.1);

[0099] 5'AAUGCUAAUUCUGUAGAUGUUUC 3' (SEQ ID NO.2).

[0100] Synthesis of LNP-siFAP:

[0101] 1. Determine N / P (6) and phospholipid concentration (12 mM, 7.5 mg / mL);

[0102] 2. Prepare a compound lipid ethanol solution, Dlin-MC3-DMA / DSPC / cholesterol / PEG-2000-DMG = 50 / 10 / 38.5 / 1.5 (mM);

[0103] 3. Quantify siRNA using the Invitrogen Qubit 4 instrument with sodium citrate buffer as the solvent;

[0104] 4. Mixing in microfluidics: Install the chip in the adapter and pre-rinse the chip with ethanol and sodium citrate buffer. Assemble the prepared compound lipid ethanol solution, siRNA-sodium citrate buffer, collection tube, and waste liquid tube, with the compound lipid ethanol solution on one side and the siRNA-sodium citrate buffer on the other side;

[0105] 5. Synthesize LNP-siFAP at a flow rate ratio of 1:3 and a total flow rate of 16 ml / min;

[0106] 6. Detect particle size and PDI;

[0107] 7. Ultrafiltration;

[0108] 8. Determine the encapsulation efficiency and utilization rate of LNP:

[0109] Encapsulation efficiency (%) = [(reading after demulsification - reading before demulsification) / reading after demulsification] * 100%;

[0110] RNA utilization rate (%) = [(reading after demulsification - reading before demulsification) * final product volume / total RNA input] * 100%.

[0111] Measurement results:

[0112] Particle size of the initial LNP synthesis product: 77.66 ± 1.16 nm

[0113] PDI of the initial LNP synthesis product: 0.038 ± 0.031

[0114] Particle size of the final LNP ultrafiltration product: 136.2 ± 1.16 nm

[0115] PDI of the final LNP ultrafiltration product: 0.078 ± 0.012

[0116] Encapsulation efficiency (%) = [(68.5 ng - 3.7 ng) / (68.5 ng)] * 100% = 94.6%

[0117] RNA utilization rate (%) = [(68.5 ng - 3.7 ng) * (5000 ul) / (3.5 mg)] * 100% = 92.6%.

[0118] Example 2 Screening of siFAP and Verification of Knockdown Effect and Interference Ability

[0119] I. In Vitro Experiment

[0120] When the three siFAPs in Example 1 grew to the logarithmic phase in the murine breast cancer cell line 4T1, they were transfected. After 36 h, the cells were processed to collect RNA, and qRT-PCR was used to verify gene expression.

[0121] II. In Vivo Experiment

[0122] (I) Construction method of fragment humanized FGF21 gene-engineered mice:

[0123] 1. Vector design, construction and in vitro transcription: Cyagen Biosciences Suzhou Co., Ltd. designed the sequences of gRNA and Donor Oligo according to gene information and experimental requirements, synthesized Donor Oligo, constructed the gRNA vector, and performed in vitro transcription of the gRNA vector and Cas9 vector.

[0124] 2. Microinjection and identification of F0 generation C57BL / 6J mice: gRNA and Cas9 mRNA were co-injected into fertilized eggs, and the microinjected fertilized eggs were sent back into the oviduct of surrogate mice. After the mice were born, PCR and sequencing were performed for identification to obtain positive F0 mice.

[0125] 3. Breeding and identification of F1 generation mice: Sexually mature positive F0 mice were respectively mated with wild-type mice for one generation to obtain F1 generation mice (heterozygous).

[0126] 4. Breeding and identification of fragment humanized FGF21 mice: Sexually mature F1 generation mice were mated to obtain homozygous fragment FGF21 mice, and gene identification was performed by PCR and sequencing.

[0127] (II) Construction of MASH model mice and experimental grouping:

[0128] 60 fragment humanized FGF21 gene-engineered C57BL / 6J mice at 10 weeks of age and 60 wild-type mice of the same age were taken. The two types of mice were each divided into 4 groups, namely the control group, the model group, the drug administration group (LNP-siFAP synthesized from three types of siFAP), and the empty vector drug administration group (LNP-siNC). Each group had at least 15 mice. The control group was fed normal feed, and the other groups were fed MCD feed for 7 weeks. Intravenous injection was started at 15 weeks of age, with a dosage of 2 mg / kg, once every 3 days for two consecutive weeks. At least 3 mice from each group were sacrificed at 12 weeks, 15 weeks, and 16 weeks of age, and all were sacrificed at 17 weeks of age. Blood and tissues were placed in a -80 °C refrigerator for preservation for subsequent experiments. qRT-PCR was used to verify gene expression.

[0129] III. Experimental Results

[0130] The results are as Figure 1 shown in and Table 1. In the 4T1 cell line, transfection with the third type of siFAP could knockdown FAP to 0.287, successfully reducing the expression of FAP significantly. In the liver tissue of fragment humanized FGF21 mice, injection of LNP-siFAP (the third type of siFAP) could knockdown FAP to 0.284. In the liver of wild-type mice, injection of LNP-siFAP (the third type of siFAP) could knockdown FAP to 0.220. Thus, among the siRNAs designed in Example 1 of the present invention, to a certain extent, they all have the ability to interfere with the expression of the target gene. However, among them, the third type of siFAP has a more excellent ability to interfere with gene expression. Therefore, subsequent research was carried out on the third type of siFAP.

[0131] Table 1 Relative expression levels of gene FAP in cells and tissues after adding different types of siFAP

[0132]

[0133] Example 3 Modification of the third type of siFAP and verification of knockdown effect and interference ability

[0134] Base modification was carried out on the third type of siFAP screened in Example 2 above and synthesized by a biological company. Among them: A-, U-, C-, and G- represent ribonucleotides A, U, C, and G modified by phosphorothioate respectively;

[0135] (A), (U), (C), and (G) represent ribonucleotides A, U, C, and G modified by 2'-F respectively;

[0136] [A], [U], [C], and [G] represent ribonucleotides A, U, C, and G modified by 2'-OMe respectively;

[0137] (A) 、 (U) 、 (C) and (G) represent ribonucleotides A, U, C, and G modified with 2′-Ara-F, respectively;

[0138] [A] 、 [U] 、 [C] and [G] represent 2′-O-MOE-modified ribonucleotides A, U, C, and G, respectively;

[0139] A*, U*, C* and G* represent the m 6 A-modified ribonucleotides A, U, C, and G;

[0140] A', U', C' and G' respectively represent the 5 C-modified ribonucleotides A, U, C, and G;

[0141] The base-modified sequences for siFAP (the third siRNA mentioned above) are shown below: siFAP-1 to siFAP-16: siFAP-1:

[0142] 5'(A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U)3';

[0143] 5'[A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3';

[0144] siFAP-2:

[0145] 5'(A)-[ A ]-(C)[ A ](U)[ C ](U)[ A ](CAG)[ A ](A)[ U ](U)[ A ](G)[ C ](A)[ U ](U)3';

[0146] 5'[ A ]-(A)-[ U ](G)[ C ](U)[ A ](A)[ U ](U)[CUG (U) A (G) A (U) G (U) U -(U)- C 3';

[0147] siFAP-3:

[0148] 5'( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U )3';

[0149] 5'[A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C]3';

[0150] siFAP-4:

[0151] 5'( A )- A -( C ) A ( U ) C ( U ) A ( CAG ) A ( A ) U ( U ) A ( G ) C ( A ) U ( U )3';

[0152] 5' A -( A )- U (G ) C ( U ) A ( A ) U ( U ) CUG ( U ) A ( G ) A ( U ) G ( U ) U -( U )- C 3';

[0153] siFAP - 5:

[0154] 5'(A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3';

[0155] 5'[A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C]3'; siFAP - 6:

[0156] 5'(A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U)3';

[0157] 5'[A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C']3';

[0158] siFAP - 7:

[0159] 5'(A*)- A* -(C) A* (U) C (U) A* (CA*G) A* (A*) U (U) A* (G) C (A*) U (U)3';

[0160] 5' A*-(A*)- U (G) C (U) A* (A*) U (U) CUG (U) A* (G) A* (U) G (U) U -(U)- C 3';siFAP-8:

[0161] 5'( A* )-[A*]-( C )[A*]( U )[C]( U )[A*]( CA*G )[A*]( A* )[U]( U )[A*]( G )[C]( A* )[U]( U )3';

[0162] 5'[A*]-( A* )-[U]( G )[C]( U )[A*]( A* )[U]( U )[CUG]( U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C]3';

[0163] siFAP-9:

[0164] 5'( A* )- A* -( C ) A* ( U ) C ( U ) A* ( CA*G ) A* ( A* ) U ( U ) A* ( G ) C ( A* ) U ( U )3';

[0165] 5' A* )-( A* )- U ( G ) C ( U ) A* ( A* ) U ( U ) CUG ( U ) A* ( G ) A* ( U ) G ( U ) U )-( U )- C 3';

[0166] siFAP-10:

[0167] 5'(A)- A )-(C') A (U) C )'(U) A (C'AG) A (A) U (U) A (G) C )'(A) U (U)3';

[0168] 5' A )-(A)- U (G) C )'(U) A (A) U (U) C '] UG (U) A (G) A (U) G (U) U )-(U)- C )'3';

[0169] siFAP-11:

[0170] 5'( A )-[A]-( C )'[A]( U )[C']( U )[A]( C '] AG )[A](A )[U]( U )[A]( G )[C']( A )[U]( U )3';

[0171] 5'[A]-( A )-[U]( G )[C']( U )[A]( A )[U]( U )[C'UG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C']3';

[0172] siFAP-12:

[0173] 5'( A )- A )-( C )' A ( U ) C )']( U ) A ( C )' AG ) A ( A ) U ( U ) A ( G ) C )']( A ) U ( U )3';

[0174] 5' A )-( A )- U ( G ) C )']( U ) A ( A ) U ( U ) C )' UG ( U ) A ( G ) A ( U ) G ( U )U -( U )- C ']3';

[0175] siFAP-13:

[0176] 5'(A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U)3';

[0177] 5'[A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C']3';

[0178] siFAP-14:

[0179] 5'(A*)- A* -(C') A* (U) C '](U) A* (C'A*G) A* (A*) U (U) A* (G) C '](A*) U (U)3';

[0180] 5' A* -(A*)- U (G) C '](U) A* (A*) U (U) C ' UG (U) A* (G) A* (U) G (U) U -(U)- C ']3';

[0181] siFAP-15:

[0182] 5'( A* )-[A*]-( C ')[A*]( U )[C']( U )[A*]( C ' A*G )[A*]( A* )[U]( U )[A*](G )[C']( A* )[U]( U )3';

[0183] 5'[A*]-( A* )-[U]( G )[C']( U )[A*]( A* )[U]( U )[C'UG]( U )[A*]( G )[A*]( U )[G]( U )[U]-( U )-[C']3';

[0184] siFAP-16:

[0185] 5'( A* )- A* -( C ') A* ( U ) C ']( U ) A* ( C ' AG ) A* ( A* ) U ( U ) A* ([[ID=6,5]] G ) C ']( A* ) U ( U )3';

[0186] 5' A* -( A* )- U ( G ) C ']( U ) A* ( A* ) U ( U ) C ' UG ( U ) A* ( G ) A* ( U ) G ( U ) U -( U )-C ']3'.

[0187] Name the third modified siFAP among the above 16 kinds as the third siFAP-1 to the third siFAP-16. When the murine breast cancer cell line 4T1 grows to the logarithmic phase, transfect it. After 36 hours, process the cells to collect RNA, and verify the expression of the FAP gene by qRT-PCR. Prepare LNP-modified siFAP in the same manner as in Example 1. Refer to the modeling method and drug administration method in Example 2 to verify the expression level of the FAP gene in mouse tissues.

[0188] Table 2 Relative expression levels of the FAP gene in cells and tissues after adding different types of the third siFAP

[0189]

[0190]

[0191] The results are as Figure 2 shown in and Table 2. Whether in the 4T1 cell line or in the mouse model, after transfecting the modified third siFAP-1 to the third siFAP-16, the effect of knocking down FAP is better than that of the third siFAP, and the modification makes the ability of siRNA to interfere with gene expression more excellent. After tail vein injection of the third siFAP-1 to the third siFAP-16 into fragment humanized FGF21 mice, the effect of the third siFAP-16 is the best, and it can knock down the FAP gene to 0.077. Then, select the third siFAP-16 for subsequent research, and observe different indexes after tail vein injection into mice to verify the drug effect.

[0192] Example 4 Changes in body weight and blood glucose of MASH mice after tail vein injection of the third siFAP-16

[0193] (I) Method for constructing fragment humanized FGF21 genetically engineered mice:

[0194] Construct according to the method in Example 2.

[0195] (II) Construction and experimental grouping of MASH model mice:

[0196] 60 10-week-old C57BL / 6J mice with fragment humanized FGF21 gene engineered and 60 wild-type mice of the same age were each divided into 4 groups, namely the control group, the model group, the drug administration group (LNP-siFAP synthesized by the third siFAP-16), and the drug administration empty vector group (LNP-siNC), with at least 15 mice in each group. The control group was fed normal feed, and the other groups were fed MCD feed for 7 weeks. Intravenous injection was started at the age of 15 weeks, with a dosage of 2 mg / kg, once every 3 days for two weeks. The body weight of the mice was measured weekly to observe the change in body weight. At the ages of 12 weeks, 15 weeks, and 17 weeks, after fasting the mice in each group for 16 h, the fasting blood glucose of each group of mice was measured. Then, 20% glucose solution was intraperitoneally injected into each group of mice, and the blood glucose of the mice was measured and the data were recorded at 5 time points of 15 min, 30 min, 60 min, 90 min, and 120 min, and then used for data analysis. At least 3 mice in each group were sacrificed and sampled at the ages of 12 weeks, 15 weeks, and 16 weeks, and all were sacrificed and sampled at the age of 17 weeks. The blood and tissues were placed in a -80 °C refrigerator for preservation for subsequent experiments.

[0197] (III) Test results

[0198] Figure 3 A shows the change in body weight of wild-type mice. From the start of modeling at 10 weeks of age to 17 weeks of age, the body weight of the mice gradually decreased. Figure 3 B shows the change in body weight of fragment humanized FGF21 mice. From the start of modeling at 10 weeks of age to 15 weeks of age, intravenous injection was continuously administered for 2 weeks until 17 weeks of age, and the body weight of the mice gradually decreased. However, after intravenous injection of the drug, it can be seen that the rate of body weight decrease was less than that of the model group. The change in the body weight of the mice is shown in Table 3. Figure 3 C shows the liver weight / body weight of each group of mice. As the modeling time increased, the liver weight / body weight of the model group continued to increase. Figure 3 D shows the liver weight / body weight of the mice after drug administration. It can be obtained that after intravenous injection of the drug in fragment humanized FGF21 gene mice, the liver weight / body weight decreased significantly. The liver weight / body weight ratio of the mice is shown in Table 4. Figure 4 A, 4B, and 4C are respectively the line graph of the glucose tolerance test and the bar graph of the area under the curve of mice at 12 weeks, 15 weeks, and 17 weeks of age. It can be seen that the glucose metabolism of the mice was slightly improved after drug administration.

[0199] In summary, the third siFAP-16 has a significant knockdown effect on the FAP gene in the liver of mice, and can increase the expression of endogenous FGF21, slightly improve weight loss, significantly improve the liver weight / body weight, and also slightly improve the glucose metabolism ability of mice after drug administration.

[0200] Table 3 Changes in body weight of mice in different groups at different weeks

[0201]

[0202] Table 4 Liver weight to body weight ratio of 17-week-old mice in different groups

[0203]

[0204]

[0205] Effect of the third siFAP-16 on MASH model mice in terms of liver injury, fat accumulation and fibrosis in Example 4

[0206] 60 10-week-old C57BL / 6J mice with fragment humanized FGF21 gene engineering and 60 wild-type mice of the same age were taken. The two types of mice were each divided into 4 groups, namely the control group, the model group, the drug administration group and the drug administration empty vector group, with at least 15 mice in each group. The control group was fed with normal feed, and the other groups were fed with MCD feed for 7 weeks. At the age of 15 weeks, the third siFAP-16 was injected via the tail vein, with a dosage of 2 mg / kg, once every 3 days for two weeks. At least 3 mice in each group were sacrificed and sampled at the ages of 12 weeks, 15 weeks, 16 weeks and 17 weeks, and all were sacrificed and sampled at the age of 17 weeks. The blood and tissues were placed in a -80 °C refrigerator for preservation for subsequent experiments. The contents of AST and ALT in the mouse serum were measured using a kit from Nanjing Jiancheng. After collecting blood from the mouse eyeballs, it was left to stand at room temperature for 60 min, centrifuged at 5000 rpm at 10 °C for 30 min, and the supernatant was taken as a sample for detection. The contents of TG and TC in the mouse liver were detected using a kit from Nanjing Jiancheng. The mouse liver and normal saline were added to an EP tube in proportion, and the liver was ground using a tissue homogenizer, and then centrifuged at 2500 rpm for 10 min, and the supernatant was taken as a sample for detection. The mouse liver was taken, fixed with 4% paraformaldehyde, embedded in paraffin for section staining after overnight fixation, and the effects of the drug on fat accumulation and fibrosis were observed.

[0207] The results are as Figures 5 - 7 shown. Figure 5 A and 5C show the changes in serum AST and ALT of wild-type mice from the start of modeling at 10 weeks of age to 17 weeks of age. As the modeling time increased, the AST and ALT in the serum continuously increased, and the liver injury was obvious. Figure 5 B and 5D show that as the modeling time increased in fragment humanized FGF21 mice, the AST and ALT in the serum continuously increased, and the increase amplitude was significantly higher than that of wild-type mice. Figure 5 From E and 5F, it can be seen that after drug administration, the serum AST and ALT indexes of fragment humanized FGF21 mice decreased significantly, and the drug effect was remarkable, and the liver injury could be repaired.

[0208] Figure 6 A and 6C show the changes in liver TG and TC of wild-type mice from 10 weeks of age to 17 weeks of age during the modeling process. As the modeling time increases, TG in the liver increases significantly. Figure 6 For B and 6D, which are fragment humanized FGF21 mice, as the modeling time increases, liver TG increases significantly. Figure 6 From E and 6F, it can be seen that after administration, the liver TG and TC indexes of fragment humanized FGF21 mice decrease.

[0209] Figure 7 Figure A shows the HE staining of fragment humanized FGF21 mice and wild-type mice at different modeling times and administration times. Figure 7B is the Oil Red O staining image, Figure 7C is the Sirius Red staining image, and Figure 7D is the Masson staining image. As can be seen from the figure, starting from 10 weeks of age in mice, after modeling until 15 weeks of age and then continuing to model and continuously administering drugs for 2 weeks until 17 weeks of age, as the modeling time increases, lipid accumulation in the liver of fragment humanized FGF21 mice is more severe than that of wild-type mice, and the therapeutic effect after administration is more obvious than that of wild-type mice.

[0210] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. An siRNA molecule that inhibits the expression of the FAP gene, characterized in that, A double-stranded siRNA molecule composed of a single-stranded RNA shown in SEQ ID NO.1 and complementary to the single-stranded RNA shown in SEQ ID NO.2; each nucleotide in the siRNA is independently a modified or unmodified nucleotide.

2. The siRNA molecule according to claim 1, wherein At least one nucleotide in the double-stranded siRNA molecule is a modified nucleotide.

3. The siRNA molecule according to claim 1 or 2, characterized in that, The modification is selected from at least one of phosphorothioate, 2'-F, 2'-OMe, 2'-Ara-F, 2'-O-MOE, m 6 A or m 5 C.

4. The siRNA molecule according to any one of claims 1 to 3, characterized in that, The double-stranded siRNA molecule is shown as any one of siFAP-1 to siFAP-16: siFAP-1: 5'(A)-[A]-(C)[A](U)[C](U)[A](CAG)[A](A)[U](U)[A](G)[C](A)[U](U)3'; 5'[A]-(A)-[U](G)[C](U)[A](A)[U](U)[CUG](U)[A](G)[A](U)[G](U)[U]-(U)-[C]3'; siFAP-2: 5'(A)- A -(C) A (U) C (U) A (CAG) A (A) U (U) A (G) C (A) U (U)3'; 5' A -(A)- U (G) C (U) A (A) U (U) CUG (U) A (G) A (U) G (U) U -(U)- C 3'; siFAP-3: 5'( A )-[A]-( C )[A]( U )[C]( U )[A]( CAG )[A]( A )[U]( U )[A]( G )[C]( A )[U]( U )3'; 5'[A]-( A )-[U]( G )[C]( U )[A]( A )[U]( U )[CUG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C]3'; siFAP-4: 5'( A )-[ A ]-( C )[ A ]( U )[ C ]( U )[ A ]( CAG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ]( A )[ U ]( U )3'； 5'[ A ]-( A )-[ U ]( G )[ C ]( U )[ A ]( A )[ U ]( U )[ CUG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ]3'； siFAP-5: 5'(A*)-[A*]-(C)[A*](U)[C](U)[A*](CA*G)[A*](A*)[U](U)[A*](G)[C](A*)[U](U)3'; 5'[A*]-(A*)-[U](G)[C](U)[A*](A*)[U](U)[CUG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C]3'; siFAP-6: 5'(A)-[A]-(C')[A](U)[C'](U)[A](C'AG)[A](A)[U](U)[A](G)[C'](A)[U](U)3'; 5'[A]-(A)-[U](G)[C'](U)[A](A)[U](U)[C'UG](U)[A](G)[A](U)[G](U)[U]-(U)-[C']3'; siFAP-7: 5'(A*)- A* -(C) A* (U) C (U) A* (CA*G) A* (A*) U (U) A* (G) C (A*) U (U)3'; 5' A* -(A*)- U (G) C (U) A* (A*) U (U) CUG (U) A* (G) A* (U) G (U) U -(U)- C 3'; siFAP-8: 5'( A* )-[A*]-( C )[A*]( U )[C]( U )[A*]( CA*G )[A*]( A* )[U]( U )[A*]( G )[C]( A* )[U]( U )3'; 5'[A*]-( A* )-[U]( G )[C]( U )[A*]( A* )[U]( U )[CUG]( U )[A*]( G )[A*l]( U )[G]( U )[U]-( U )-[C]3'; siFAP-9: 5'( A* )-[ A* ]-( C )[ A* ]( U )[ C ]( U )[ A* ]( CA*G )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ]( A* )[ U ]( U )3'； 5'[ A* ]-( A* )-[ U ]( G )[ C ]( U )[ A* ]( A* )[ U ]( U )[ CUG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ]3'； siFAP-10: 5'(A)- A -(C') A (U) C '](U) A (C'AG) A (A) U (U) A (G) C '](A) U (U)3'; 5' A -(A)- U (G) C '](U) A (A) U (U) C ' UG (U) A (G) A (U) G (U) U -(U)- C ']3'; siFAP-11: 5'( A )-[A]-( C )'[A]( U )[C']( U )[A]( C ' AG )[A]( A )[U]( U )[A]( G )[C']( A )[U]( U )3'; 5'[A]-( A )-[U]( G )[C']( U )[A]( A )[U]( U )[C'UG]( U )[A]( G )[A]( U )[G]( U )[U]-( U )-[C']3'; siFAP-12: 5'( A )-[ A ]-( C ')[ A ]( U )[ C ']( U )[ A ]( C ' AG )[ A ]( A )[ U ]( U )[ A ]( G )[ C ']( A )[ U ]( U )3'； 5'[ A ]-( A )-[ U ]( G )[ C ']( U )[ A ]( A )[ U ]( U )[ C ' UG ]( U )[ A ]( G )[ A ]( U )[ G ]( U )[ U ]-( U )-[ C ']3'； siFAP-13: 5'(A*)-[A*]-(C')[A*](U)[C'](U)[A*](C'A*G)[A*](A*)[U](U)[A*](G)[C'](A*)[U](U)3'; 5'[A*]-(A*)-[U](G)[C'](U)[A*](A*)[U](U)[C'UG](U)[A*](G)[A*](U)[G](U)[U]-(U)-[C']3'; siFAP-14: 5'(A*)- A* -(C') A* (U) C '](U) A* (C'A*G) A* (A*) U (U) A* (G) C '](A*) U (U)3'; 5' A* -(A*)- U (G) C '](U) A* (A*) U (U) C ' UG (U) A* (G) A* (U) G (U) U -(U)- C ']3'; siFAP-15: 5'( A* )-[A*]-( C )')[A*]( U )[C']( U )[A*]( C ' A*G )[A*]( A* )[U]( U )[A*]( G )[C']( A* )[U]( U )3'; 5'[A*]-( A* )-[U]( G )[C']( U )[A*]( A* )[U]( U )[C'UG]( U )[A*]( G )[A*]( U )[G]( U )[U]-( U )-[C']3'; siFAP-16: 5'( A* )-[ A* ]-( C ')[ A* ]( U )[ C ']( U )[ A* ]( C ' AG )[ A* ]( A* )[ U ]( U )[ A* ]( G )[ C ']( A* )[ U ]( U )3'； 5'[ A* ]-( A* )-[ U ]( G )[ C ']( U )[ A* ]( A* )[ U ]( U )[ C ' UG ]( U )[ A* ]( G )[ A* ]( U )[ G ]( U )[ U ]-( U )-[ C ']3'； Wherein, A-, U-, C-, G- respectively represent ribonucleotides A, U, C, and G modified by phosphorothioate; (A), (U), (C) and (G) respectively represent ribonucleotides A, U, C and G modified with 2'-F; [A], [U], [C] and [G] respectively represent ribonucleotides A, U, C and G modified with 2'-OMe; (A) , (U) , (C) and (G) respectively represent ribonucleotides A, U, C, and G modified with 2'-Ara-F; [A] , [U] , [C] and [G] respectively represent ribonucleotides A, U, C, and G modified with 2'-O-MOE; A*, U*, C* and G* respectively represent ribonucleotides A, U, C and G modified by m 6 A; A', U', C' and G' respectively represent ribonucleotides A, U, C and G modified by m 5 C.

5. An expression vector carrying the siRNA according to any one of claims 1 to 4.

6. A host cell containing the siRNA according to any one of claims 1 to 4, or transformed with the expression vector according to claim 5.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition contains the siRNA according to any one of claims 1 to 4, or the expression vector according to claim 5, or the host cell according to claim 6.

8. The composition according to claim 7, wherein The pharmaceutical composition contains a pharmaceutically acceptable carrier or excipient; optionally, the pharmaceutically acceptable carrier includes liposomes, microcells, metal particles, or polymer particles.

9. Use of the siRNA according to any one of claims 1 to 4, or the expression vector according to claim 5, or the host cell according to claim 6 in the preparation of a drug for preventing, alleviating and / or treating non-alcoholic fatty liver hepatitis.

10. The application according to claim 9, characterized in that, The use at least includes one of the following effects: (1) Reducing the ratio of liver weight to body weight of an individual; (2) Improving the glucose metabolism ability of an individual; (3) Repairing liver injury of an individual; (4) Reducing the levels of TG and TC in the liver of an individual; (5) Alleviating the degree of liver fibrosis of an individual.

Images