A gene modification system, cell strain and application for knocking out a pig TRIM29 gene

By knocking out the TRIM29 gene in pigs using CRISPR/Cas9 technology, a gene modification system and cell line were prepared, solving the problem of insufficient resistance of pigs to pseudorabies virus in existing technologies. This achieved efficient and economical antiviral breeding results and cultivated a new breed of pigs with broad-spectrum disease resistance.

CN120400159BActive Publication Date: 2026-07-03SOUTH CHINA AGRICULTURAL UNIVERSITY

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH CHINA AGRICULTURAL UNIVERSITY
Filing Date
2025-05-12
Publication Date
2026-07-03

Smart Images

  • Figure CN120400159B_ABST
    Figure CN120400159B_ABST
Patent Text Reader

Abstract

This invention discloses a gene modification system for knocking out the TRIM29 gene in pigs, a TRIM29 gene-modified cell line prepared using this system, and the application of this system in preparing TRIM29 gene-modified pigs, pseudorabies virus (PRV) resistant pigs, or breeding new PRV-resistant pig breeds. This system can efficiently screen for stably heritable TRIM29 gene-modified cell lines with a double isotransfer mutation genotype after the GACCTCCAGCTACTTCAAGCA sequence site in the TRIM29 gene, which is stably heritable. Using this gene modification system or the TRIM29 gene-modified cell line, TRIM29 gene-modified pigs can be prepared. These gene-modified pigs have elevated type I interferon levels, exhibit strong resistance to PRV, and may also be resistant to multiple type I IFN-sensitive viruses, making them a broad-spectrum resistant pig with good market competitiveness and application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of animal genetic engineering and animal breeding technology, and in particular to a gene modification system, cell line and application for knocking out the pig TRIM29 gene. Background Technology

[0002] Pseudorabies is a significant viral disease affecting the pig industry, caused by Pseudorabies virus (PRV). PRV is a herpesvirus 1 that primarily infects pigs. Infected pigs commonly exhibit symptoms such as difficulty breathing and lethargy; fattening pigs experience stunted growth and slow weight gain, severely impacting their economic efficiency; sows suffer reproductive disorders such as abortion; and piglets exhibit symptoms like vomiting and diarrhea, with PRV infection particularly causing high mortality rates in piglets. PRV is one of the most serious infectious diseases affecting the healthy development of my country's pig industry, experiencing frequent outbreaks and causing enormous losses. PRV infection was first detected in my country in the 1960s. Since the 1990s, most pig farms in my country have used the Bartha-K61 vaccine strain to control PRV. This vaccine control method has indeed achieved significant results, with the disease being effectively controlled for a considerable period, and even eradicated in some farms. However, in 2011, due to the mutation of the PRV strain, the virus became more virulent, and the cross-protective ability of vaccines weakened. Even though many pig farms were fully immunized with PRV vaccines, PRV outbreaks still occurred, and the prevalence of PRV worsened again. The current situation regarding PRV control remains complex and severe, and it is one of the key challenges and pain points in pig production.

[0003] Modifying specific genomic loci in pigs using genetic breeding strategies can fundamentally enhance their resistance to PRV or various pathogen infections, leading to the development of new breeds with enhanced natural disease resistance. This approach offers advantages such as convenience, efficiency, and low cost, making it an important alternative strategy for vaccines and biosecurity control, and a key means for future livestock and poultry biobreeding. Identifying and modifying gene loci involved in virus-host interactions is crucial for disease-resistant biobreeding.

[0004] Therefore, it is urgent to study a new gene locus and edit or modify this locus to prepare genetically modified pigs that can resist PRV, so that they have disease resistance to PRV. Summary of the Invention

[0005] The purpose of this invention is to provide a gene modification system for knocking out the TRIM29 gene in pigs, a cell line prepared by the system, and its applications, and to use the gene modification system or cell line to prepare gene-modified pigs resistant to pseudorabies virus, thereby solving the above-mentioned problems.

[0006] According to a first aspect of the present invention, a gene modification system for knocking out the TRIM29 gene is provided. This system comprises a gRNA nucleotide sequence or an expression vector containing a gRNA nucleotide sequence and a Cas9 expression vector or Cas9 protein, wherein the gRNA nucleotide sequence is shown in SEQ ID No:1. Thus, this system allows for the direct injection of porcine zygotes to prepare genetically modified pigs with the TRIM29 gene knocked out. These genotype-modified pigs exhibit significant resistance to PRV, naturally resisting pseudorabies virus or alleviating post-infection symptoms. This significantly reduces the use of anti-PRV drugs, lowers drug residues and disease control costs and infection risks, improves the antiviral capacity of pigs, and enhances their immunity and market competitiveness.

[0007] According to a second aspect of the present invention, a TRIM29 gene-modified cell line is provided, wherein the TRIM29 gene is knocked out in the cell line, and a double isotropic shift mutation genotype is formed in the TRIM29 gene after the GACCTCCAGCTACTTCAAGCA sequence site. The double isotropic shift mutation refers to the deletion of one base on one strand and the addition of one base on the other strand of the double-stranded DNA after the sequence site. Therefore, by using this cell line as a nuclear donor cell for nuclear transfer and performing somatic cell cloning, genetically modified pigs with the TRIM29 gene knocked out can be prepared. These genetically modified pigs exhibit strong resistance to PRV, can naturally resist pseudorabies virus or reduce post-infection symptoms and mortality, improve the pig's natural immunity and antiviral ability, and reduce the cost and burden of corresponding vaccines, drugs, and biosecurity control. Disease-resistant pigs bred by this method will have good market competitiveness and play a positive role in improving the economic benefits of the livestock industry.

[0008] In some embodiments, the cell line is a TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO, and the TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO has the accession number GDMCC No:65878.

[0009] In some embodiments, the cell line is prepared using the gene modification system described above.

[0010] According to a third aspect of the present invention, a method for preparing TRIM29 gene-modified pigs is provided. This method involves injecting the gene-modification system into pig zygotes, then transferring the zygotes into the uterus of a surrogate sow. Once piglets are born, TRIM29 gene-modified pigs can be obtained. Therefore, this method eliminates the need for screening positive cell lines and somatic cell cloning, making it simpler and easier to operate. Furthermore, the obtained TRIM29 gene-modified pigs exhibit significant resistance to PRV, and because the TRIM29 gene is knocked out, these gene-modified pigs may also possess resistance to multiple IFN-sensitive viruses, making them a broad-spectrum disease-resistant pig.

[0011] According to a fourth aspect of the present invention, a method for preparing TRIM29 gene-modified pigs is provided. This method involves somatic cell cloning of the cell line as a nuclear donor cell for nuclear transfer to obtain TRIM29 gene-modified pigs. Therefore, since the cell line can be stably inherited, this method has a higher success rate in obtaining TRIM29 gene-modified positive pigs. Furthermore, these gene-modified pigs exhibit significant resistance to PRV, and because the TRIM29 gene is knocked out, they may also possess resistance to various IFN-sensitive viruses, making them a broad-spectrum disease-resistant pig.

[0012] According to a fifth aspect of the invention, the application of the aforementioned gene modification system in the preparation of pseudorabies virus-resistant pigs or the breeding of new PRV-resistant pig breeds is provided. Thus, the pseudorabies virus-resistant pigs or new PRV-resistant pig breeds obtained through this application exhibit significant resistance to PRV, and because the TRIM29 gene is knocked out, these gene-modified pigs may also possess resistance to a variety of IFN-sensitive viruses, representing a broad-spectrum resistant pig or a new broad-spectrum resistant pig breed.

[0013] According to a sixth aspect of the present invention, the application of the described gene modification system in the preparation of a TRIM29 gene-modified cell line is provided. A TRIM29 gene-modified cell line is prepared using this system. This cell line can be used as a nuclear donor cell for somatic cell cloning to prepare TRIM29 gene-modified cloned pigs. This cell line can also be used as research material for studies such as antiviral research in pigs.

[0014] According to a seventh aspect of the present invention, the use of the aforementioned cell line in the preparation of porcine antiviral products is provided. Thus, this cell line can be used as research material for the preparation of porcine anti-pseudorabies virus products or for the research and preparation of other antiviral products.

[0015] According to an eighth aspect of the invention, the cell line described herein is provided for use in preparing pseudorabies virus-resistant pigs or breeding new PRV-resistant pig breeds. Thus, the pseudorabies virus-resistant pigs or new PRV-resistant pig breeds obtained through this application exhibit significant resistance to PRV, and because the TRIM29 gene is knocked out, these gene-modified pigs may be resistant to multiple IFN-sensitive viruses, representing a broad-spectrum resistant pig or a new broad-spectrum resistant pig breed. Furthermore, this application has a high success rate in obtaining positive pigs, and the genotype of the prepared positive pigs can be stably inherited, thereby enabling the breeding of new pseudorabies virus-resistant pig breeds.

[0016] The beneficial effects of this application are:

[0017] This application discloses a gene modification system for knocking out the TRIM29 gene, a TRIM29 gene-modified cell line TRIM29 KO prepared using this system, and the application of this system in preparing TRIM29 gene-modified pigs, preparing pseudorabies virus-resistant pigs, or breeding new pseudorabies virus-resistant pig breeds. Through this system, a stably heritable TRIM29 gene-modified cell line TRIM29 KO can be efficiently screened. This TRIM29 KO cell line contains a double isotransfer mutation genotype of the TRIM29 gene after the GACCTCCAGCTACTTCAAGCA sequence site, and this genotype can be stably inherited. Using this gene modification system or the TRIM29 gene-modified cell line TRIM29 KO, TRIM29 gene-modified positive pigs can be prepared. These positive pigs exhibit significant resistance to PRV, and because the TRIM29 gene is knocked out, these gene-modified pigs may also have resistance to multiple IFN-sensitive viruses, making them a broad-spectrum resistant pig. By breeding these positive pigs, a new breed of pig resistant to pseudorabies virus can be obtained. This new breed of pig has significant resistance to PRV and can naturally resist pseudorabies virus or reduce post-infection symptoms. This can greatly reduce the use of anti-PRV drugs, reduce drug residues, disease control costs and infection risks, improve the antiviral ability of this new breed of pig, and enhance its immunity and market competitiveness. Attached Figure Description

[0018] Figure 1 This is a diagram showing the structure and modification sites of the TRIM29 gene.

[0019] Figure 2 Image of a TRIM29 gene-modified positive pig;

[0020] Figure 3 The image shows the results of detecting the expression level of the target protein in TRIM29 gene-modified positive pigs.

[0021] Figure 4The mortality curves of experimental pigs (TRIM29 gene-modified pigs) and control pigs in the PRV infection experiment are shown.

[0022] Figure 5 The graph shows the changes in body temperature between TRIM29 gene-modified pigs and control pigs in the PRV infection experiment; where KO represents TRIM29 gene-modified pigs and WT represents control pigs, and the values ​​in the graph represent the p-values ​​for statistical difference analysis between groups, with p<0.05 indicating a significant difference;

[0023] Figure 6 The figure shows the results of TRIM29 gene-modified pigs and control pigs in the PRV infection experiment: KO represents TRIM29 gene-modified pigs, WT represents control pigs, and the values ​​in the figure represent the p-values ​​of the statistical difference analysis between groups, with p<0.05 indicating a significant difference.

[0024] Figure 7 The figure shows the results of viral load detection in various organs of TRIM29 gene-modified pigs and control pigs in the PRV infection experiment: where KO represents TRIM29 gene-modified pigs, WT represents control pigs, and the values ​​in the figure represent the p-values ​​of statistical difference analysis between groups, with p<0.05 indicating a significant difference;

[0025] Figure 8 Figure 1 shows the results of PRV antibody level detection in TRIM29 gene-modified pigs and control pigs after challenge in the PRV infection experiment: KO represents TRIM29 gene-modified pigs, WT represents control pigs, the left figure shows the gB (gb) antibody detection results, and the right figure shows the gE (ge) antibody detection results. The values ​​in the figure represent the p-values ​​of the statistical difference analysis between groups, and p<0.05 indicates a significant difference.

[0026] Figure 9 The graph shows the IFN-I levels of TRIM29 gene-modified pigs and control pigs after challenge in the PRV infection experiment: KO represents TRIM29 gene-modified pigs, WT represents control pigs, the left graph shows the IFNα detection results, and the right graph shows the IFNβ detection results. The values ​​in the graph represent the p-values ​​for statistical difference analysis between groups, and p<0.05 indicates a significant difference. Detailed Implementation

[0027] The invention will now be described in further detail with reference to the accompanying drawings.

[0028] Example 1: Gene modification system for knocking out the TRIM29 gene and preparation of TRIM29 gene-modified positive cell lines.

[0029] (1) Synthesize TRIM29 gRNA.

[0030] The location of gRNA targets in the TRIM29 genome is as follows: Figure 1 As shown, the *gacctccagctacttcagca* sequence in exon 1 of the porcine TRIM29 gene was selected as the target site to construct the guide RNA (gRNA) for the CRISPR / Cas targeting system. The synthesized gRNA was designated TRIM29 gRNA, and its full-length nucleotide sequence is shown in SEQ ID No: 1: *gaccuccagcuacuucagcaGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU*. The lowercase letters represent the complementary sequence recognizing the TRIM29 target site, and the uppercase letters represent the gRNA backbone sequence. Since the synthesized sequence is RNA, while the target sequence described above is DNA, the corresponding *T* was replaced with *U* during gRNA synthesis.

[0031] (2) Cell transfection and screening of TRIM29 gene-modified positive cells.

[0032] Primary isolated porcine fibroblasts ( pig fibroblast cells Cells were cultured to a confluence of 80% or higher, digested, centrifuged to remove the culture medium, and then resuspended in PBS. A mixture of TRIM29 gRNA (sequence shown in SEQ ID No:1) and Cas9 protein (M0667M, NEB) was added to the cells (in other methods, a Cas9 expression vector expressing Cas9 protein can also be used). (In other methods, the TRIM29 gRNA sequence can be constructed into an expression vector and co-transfected with the Cas9 expression vector or Cas9 protein). Electroporation transfection was then performed. After electroporation, cells were divided into 10 x 10 cm culture dishes, approximately 1000 cells per dish, and cultured in DMEM + 15% FBS medium at 37°C in a 5% CO2 incubator. After 10 days, transfected cells formed appropriately sized single clones. At this point, single-cell clones were picked and transferred to 48-well plates. Once all 48 wells were confluent, approximately 1 / 10 of the cells were used for genotyping, and the remaining 9 / 10 cells were passaged to 24 wells for further culture into cell lines. Cells used for genotyping were centrifuged to remove the culture medium, and then resuspended in 10 μl of cell lysis buffer (4 mg / ml proteinase K + 0.5% NP40 dissolved in sterile water). The cells were lysed at 56°C for 30 min, followed by proteinase K inactivation at 98°C for 10 min. One μl of the lysis buffer was used directly as a template for PCR detection.

[0033] Sequencing analysis revealed that the selected positive cell lines possessed a double isotropic frameshift mutation genotype. Specifically, the TRIM29 gene sequence exhibited a deletion and an addition of one base after the gRNA target sequence (GACCTCCAGCTACTCAGCA), resulting in a double frameshift mutation. The sequencing results were: GACCTCCAGCTACTCAGCA (-1bp) or GACCTCCAGCTACTTCAAGCA (+1bp). In the double-stranded DNA of these positive cells, both complementary DNA strands exhibited frameshift mutations (one strand of the double-stranded DNA had a deletion of one base, and the other strand had an addition of one base). This selected positive cell line was named TRIM29 KO, a TRIM29 gene-modified porcine fibroblast cell line, and was preserved. Its taxonomic name is *Sus*, *Boar equina*. Sus scrofa The depositary institution is Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Province. The deposit date is February 13, 2025, and the accession number is GDMCC No:65878.

[0034] Example 2: Preparation of TRIM29 gene-modified pigs.

[0035] Using the positive cell line obtained in Example 1 (TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO) as the nuclear donor cell for nuclear transfer, it was implanted into enucleated, in vitro matured porcine oocytes. After electrofusion and activation, reconstructed embryos were formed. These reconstructed embryos were surgically implanted into the uterus of recipient sows in estrus at the same time to induce pregnancy, with approximately 200 reconstructed embryos transferred into each recipient sow. The first ultrasound examination to confirm pregnancy was performed 30 days post-surgery, and subsequent ultrasound monitoring of pregnancy was conducted regularly. Embryo transfer details and cloned pig birth details are shown in Table 1. Photographs of TRIM29 gene-modified positive pigs are shown in [Table 1]. Figure 2 Ear skin tissue was collected from cloned pigs, and the expression of the TRIM29 gene was detected. Western blot analysis confirmed that TRIM29 gene-modified positive cloned pigs did not express TRIM29 protein, indicating that the TRIM29 gene was knocked out in the TRIM29 gene-modified positive cloned pigs, and the TRIM29 gene-modified pigs were successfully prepared (results are shown below). Figure 3 (As shown).

[0036] Table 1. Summary of Gene Knockout Pig Cloning Preparation

[0037] Pig breeds from which donor cells are derived donor cell genetic modification Number of cloned embryos transferred Pregnancy status Number of piglets born Number of survivors Big White TRIM29 (-1 / +1) 220 have 4 2 Big White TRIM29 (-1 / +1) 220 none Big White TRIM29 (-1 / +1) 220 have 7 6 Big White TRIM29 (-1 / +1) 204 have 5 4 Big White TRIM29 (-1 / +1) 200 none Big White TRIM29 (-1 / +1) 200 have 7 7 Big White TRIM29 (-1 / +1) 200 have 8 7 Big White TRIM29 (-1 / +1) 200 none Big White TRIM29 (-1 / +1) 181 none Big White TRIM29 (-1 / +1) 181 none

[0038] By breeding and propagating TRIM29 gene-modified positive cloned pigs, a new TRIM29 gene-modified positive pig breed can be obtained. This new breed of pig has significant resistance to PRV and may also be resistant to a variety of type I IFN-sensitive viruses, making it a broad-spectrum disease-resistant pig breed.

[0039] Example 3: Disease resistance test of TRIM29 gene-modified pigs.

[0040] Six 5-month-old TRIM29 gene-modified pigs and 15 control Large White pigs were selected and placed in a shielded challenge experimental area, housed together, and given free access to feed and water. Serum samples were collected from the experimental pigs before challenge to ensure that PRV antigen and antibody (gB and gE) were negative. Challenge was performed via nasal spray of viral fluid. The experimental period was 9 days, with each pig infected with 8 × 10⁸ PRVs. 8 A dose of PRV virus (the PRV isolate GD-YH was preserved and classified as porcine alpha herpesvirus) was administered. Varicellovirus suidalpha 1, The depositary institution was the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit date of February 17, 2025 and accession number CGMCC No. 46376. Disease phenotypes and body temperatures of the experimental pigs were recorded daily after infection. Pharyngeal swabs were collected on days 2, 4, 6, and 8 post-infection to detect PRV shedding. Serum samples were collected from each pig on days 7 and 9 post-challenge to detect PRV antibody levels. Viral load was quantified using probe-based quantitative PCR; antibody levels (gB and gE antibodies) in serum were detected using blocking ELISA. The experiment was stopped on day 9, at which point all control group pigs had died or were in a near-death state. Serum, lungs, brains, and tonsils were collected from all experimental pigs, fixed with paraformaldehyde, and cryopreserved at -80°C. PRV viral load, IFNα, and IFNβ levels were measured in the collected samples. Viral load was quantified using probe-based quantitative PCR; serum IFNα and IFNβ were detected using an ELISA kit.

[0041] Results of body temperature changes in pigs after viral challenge: Figure 5 As shown in the diagram: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. The results indicate that TRIM29 gene-modified pigs exhibited milder clinical symptoms and lower fever, while control pigs generally showed more severe clinical symptoms, including high fever. The mortality rate of pigs after challenge is shown in the diagram. Figure 4 As shown in the diagram: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. The results indicate that the mortality rate of TRIM29 gene-modified pigs was lower than that of the control group. The results of virus shedding levels in pigs after challenge are shown below. Figure 6As shown: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. The results showed that the viral shedding level of TRIM29 gene-modified pigs was significantly lower than that of wild-type Large White pigs in the control group on days 2, 4, 6, and 8 (p<0.05). The viral load results of various organs in the pigs after challenge are shown below. Figure 7 As shown in the diagram: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. The results indicate that the PRV viral load in the brain, lungs, and tonsils of TRIM29 gene-modified pigs was significantly higher than that in control pigs (p<0.05). Serum PRV antibody levels were also measured. Figure 8 In the diagram: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. Figure 8 The left and middle figures represent gB antibody expression levels, and the results show that the gB antibody levels in genetically modified pigs were significantly lower than those in the control group (p<0.05); while Figure 8 The right-hand figure shows the gE antibody expression level, indicating that the gE antibody level in genetically modified pigs was significantly lower than that in the control group (p<0.05). Serum IFNα and IFNβ detection results are shown below. Figure 9 In the diagram: KO represents TRIM29 gene-modified pigs, and WT represents control pigs. Figure 9 The left and middle figures show the IFNα expression level. The results indicate that the serum IFNα expression level of the genetically modified pigs was significantly higher than that of the control group pigs (p<0.05). Figure 9 The right-middle figure shows the IFNβ expression level. The results indicate that the serum IFNβ expression level of the genetically modified pigs was significantly higher than that of the control group (p<0.05), confirming that TRIM29 has a high level of type I IFN response and that TRIM29 deletion can significantly improve the disease resistance of genetically modified pigs.

[0042] The above results indicate that TRIM29 gene-modified pigs exhibit significant resistance to PRV. Because the TRIM29 gene is knocked out, these gene-modified pigs may also possess resistance to a variety of IFN-sensitive viruses, making them a broad-spectrum resistant pig species.

[0043] Example 4: Preparation of TRIM29 gene-modified positive pigs and breeding of new breeds.

[0044] In addition to the preparation method in Example 2, the gRNA nucleotide sequence synthesized in Example 1, or an expression vector containing the gRNA nucleotide sequence, and a Cas9 expression vector or Cas9 protein can be injected into pig zygotes. The zygotes are then transplanted into the uterus of a surrogate sow. After the piglets are born, the genotype of the piglets after the GACCTCCAGCTACTTCAAGCA sequence site or the protein expression of the TRIM29 gene can be detected. Positive pigs with the TRIM29 gene knocked out can be retained for propagation and breeding to obtain a new TRIM29 gene-modified positive pig breed. This new breed of pig has significant resistance to PRV and may also be resistant to a variety of IFN-sensitive viruses, making it a broad-spectrum disease-resistant pig breed.

[0045] In summary, this invention utilizes gene editing and animal cloning techniques to produce TRIM29-modified cloned positive pigs. These cloned positive pigs lack TRIM29 gene expression throughout their bodies, and the deletion of this gene has no significant impact on their normal physiological functions. Under viral infection, the IFN-I innate immune system of these gene-modified pigs exhibits a more sensitive response, secreting more IFN-I in response to viral infection. Therefore, they demonstrate a stronger viral clearance effect in the early stages of viral invasion of the host, reducing viral infectivity and improving the survival rate of pigs under viral infection conditions. High-dose PRV challenge tests showed that, compared to control pigs of the same breed and age, the TRIM29 gene-modified pigs exhibited significant resistance to PRV. Due to the knockout of the TRIM29 gene, these gene-modified pigs may possess resistance to multiple IFN-sensitive viruses, making them a broad-spectrum resistant pig.

Claims

1. A TRIM29 genetically modified cell line, wherein, The TRIM29 gene in the cell line was knocked out, and the TRIM29 gene in the cell line formed a double isotransfer frameshift mutation genotype after the GACCTCCAGCTACTTCAAGCA sequence site. The double isotransfer frameshift mutation means that one strand of the double-stranded DNA is missing one base and the other strand is added one base after the sequence site. The cell line is a TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO, and the preservation number of the TRIM29 gene-modified porcine fibroblast cell line TRIM29 KO is GDMCC No:65878.

2. A method of making a TRIM29 genetically modified pig, wherein, The method describes the preparation of TRIM29 gene-modified pigs by using the cell line described in claim 1 as the nuclear donor cell for nuclear transplantation through somatic cell cloning.

3. The application of the cell line described in claim 1 in the preparation of pseudorabies virus-resistant pigs or the breeding of new PRV-resistant pig breeds.