Primer and probe for efficiently detecting bursaphelenchus xylophilus
By designing specific primers and probes and optimizing fluorescent PCR amplification program, the high misjudgment rate and low sensitivity problems in pine nematode detection are solved, and efficient and fast detection results are achieved, suitable for grassroots quarantine and field environments.
Patent Information
- Application Number
- CN202510611526.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-01
AI Technical Summary
The prior art has high misjudgment rate, cumbersome operation, low sensitivity and difficulty in designing primer probes when detecting pine nematodes, which is difficult to meet the high specificity, high sensitivity, fast and convenient detection needs of grassroots quarantine and outdoor environments.
Design specific primers and probes, combined with optimized fluorescence PCR amplification program, including specific upstream and downstream primers and TaqMan probes, annealing temperature and reaction systems, to achieve high specificity and high sensitivity detection for pine nematodes.
It has achieved high specificity, high sensitivity and rapid detection of pine nematodes, which is significantly better than traditional methods, and provides key technical support for the early warning and prevention of pine nematodes disease.
Smart Images

Figure CN120400366A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and specifically, relates to a primer and a probe for efficiently detecting Bursaphelenchus xylophilus. Background Art
[0002] Pine wilt disease is listed as one of the most destructive forest diseases in the world. Bursaphelenchus xylophilus, the pathogen that causes pine wilt disease, rapid and accurate detection of this pathogen is crucial for epidemic prevention and control.
[0003] Traditional methods rely on morphological characteristics such as the length of the tail tip process of female nematodes to distinguish Bursaphelenchus xylophilus from related species. However, the morphology of larvae is highly similar, adult nematodes need to be artificially cultured, and it is easily interfered by factors such as mixed insect states and insufficient sample size, with a misjudgment rate as high as 30%. The PCR detection method requires electrophoresis interpretation, which is cumbersome to operate and has a risk of aerosol contamination, with low sensitivity and unable to meet the detection requirements of trace samples. For some other molecular biology detections, the probe design is not optimized, and there is a problem of primer-dependent artifact interference. In addition, the screening of highly conserved target genes in the genome of Bursaphelenchus xylophilus is insufficient, resulting in great difficulty in primer and probe design, further restricting the improvement of detection performance.
[0004] In summary, in grass-roots quarantine and field environments, there is an urgent need for a detection primer and probe with high specificity, high sensitivity, rapidity and convenience. Summary of the Invention
[0005] The purpose of the present invention is to provide a primer and a probe for efficiently detecting Bursaphelenchus xylophilus to solve the problems raised in the background art.
[0006] The purpose of the present invention can be achieved by the following technical solutions:
[0007] A primer and a probe for efficiently detecting Bursaphelenchus xylophilus, the primer and the probe specifically include an upstream primer, a downstream primer and a TaqMan probe;
[0008] Among them, the upstream primer is SJ-Bxy-F, and the specific sequence is GCTGGATCATTACCGATCCTAT (SEQ ID NO: 1);
[0009] The downstream primer is SJ-Bxy-R, and the specific sequence is TCTCGGCTTCCATGCGAACCAT (SEQ ID NO: 2);
[0010] The TaqMan probe is SJ-Bxy-P, and the specific sequence is TGATGCGATTGGTGA (SEQ ID NO: 3) 。
[0011] Furthermore, the 5'-end of the TaqMan probe is labeled with the fluorescent group FAM, and the 3'-end is labeled with the quenching group MGB.
[0012] Furthermore, the usage method of the primer and the probe is as follows:
[0013] S1. Sample treatment: Mix the sample with the nucleic acid extraction solution, grind it, and then extract DNA;
[0014] S2. Fluorescent PCR amplification: Use the primer and the probe to amplify the DNA obtained in step S1;
[0015] S3. Interpretation: If the cycle threshold (Ct value) in the FAM channel ≤ 35 and a typical amplification curve appears, it is determined as positive.
[0016] Furthermore, in step S2, the specific procedure for the amplification is as follows:
[0017] Digestion: Treat at 24 - 28°C for 1 - 3 minutes;
[0018] Pre-denaturation: Treat at 94 - 98°C for 30 seconds to 2 minutes;
[0019] Denaturation: Treat at 94 - 98°C for 5 - 15 seconds;
[0020] Annealing and extension: Treat at 55 - 65°C for 8 - 15 seconds, and cycle 35 - 45 times.
[0021] Further preferably, in step S2, the specific procedure for the amplification is as follows:
[0022] Digestion: Treat at 25°C for 2 minutes;
[0023] Pre-denaturation: Treat at 9,5°C for 1 minute;
[0024] Denaturation: Treat at 95°C for 5 seconds;
[0025] Annealing and extension: Treat at 60 ± 2°C for 10 seconds, and cycle 40 times.
[0026] Advantages of the present invention:
[0027] In the technical solution of the present invention, the primer and the probe provided only generate amplification signals for the specific gene sequence of Bursaphelenchus xylophilus, and have no cross-reaction with other related nematodes such as Bursaphelenchus mucronatus and Aphelenchoides resinosis, showing the characteristic of high specificity. By optimizing the primer / probe design, annealing temperature and reaction system, the present invention realizes the high specificity, high sensitivity, rapid detection and multi-scenario applicability of Bursaphelenchus xylophilus, which is significantly superior to the traditional morphological identification and conventional PCR methods, and provides key technical support for the early warning and prevention and control of Bursaphelenchus xylophilus disease. Description of the Drawings
[0028] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can also be obtained based on these drawings.
[0029] Figure 1 It is the amplification curve of positive plasmid standards with different gradients in the embodiments of the present invention.
[0030] Figure 2 It is the standard curve graph of real-time fluorescence quantitative PCR in the embodiments of the present invention.
[0031] Figure 3 It is the amplification curve of the specificity test in the embodiments of the present invention. Figure 4 It is the amplification curve of the repeatability test in the embodiments of the present invention. Specific Embodiments
[0032] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0033] Example 1
[0034] A primer and probe for efficiently detecting Bursaphelenchus xylophilus, the primer and probe specifically include an upstream primer, a downstream primer and a TaqMan probe;
[0035] Among them, the upstream primer is SJ-Bxy-F, and the specific sequence is GCTGGATCATTACCGATCCTAT (SEQ ID NO: 1);
[0036] The downstream primer is SJ-Bxy-R, and the specific sequence is TCTCGGCTTCCATGCGAACCAT (SEQ ID NO: 2);
[0037] The TaqMan probe is SJ-Bxy-P, and its specific sequence is FAM-TGATGCGATTGGTGA-MGB (SEQ ID NO: 3); the 5' end of the TaqMan probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quenching group MGB. The specific sequence is AGGTGAACCTTCGGCTGGATCATTACCGATCCTATGACACATTTATT CGTGCTCGTCACGATGATGCGATTGGTGACTTCGGTTGCCGCGCATG ATGGCGGTTCGATTCGCGTCGTTCCGCCTACTGATGG (SEQ ID NO: 4).
[0038] The usage methods of the above primers and probes are as follows:
[0039] S1. Sample treatment: Put the sample into a 1.5 mL centrifuge tube, add 500 μL of DNA & RNA-free enzyme water, rotate and grind with a grinding rod for 2 minutes. Take 200 μL of the supernatant of the ground suspension and transfer it to a 1.5 mL centrifuge tube. Then, perform nucleic acid extraction according to the instructions in the nucleic acid extraction kit (iFlashDx, magnetic bead method animal tissue and cell DNA extraction kit, RN013). Finally, store the obtained nucleic acid at -20 °C;
[0040] S2. Fluorescent PCR amplification: Use the above primers and probes to amplify the DNA obtained in step S1. The specific amplification system includes the following components (as shown in Table 1):
[0041] Table 1
[0042]
[0043]
[0044] The specific procedure for the above amplification is shown in Table 2 below:
[0045] Table 2
[0046]
[0047] S3. Interpretation: If the Ct value in the FAM channel ≤ 35 and a typical amplification curve appears, it is determined to be positive; specifically, the positive plasmid of Bursaphelenchus xylophilus (the sequence is as shown in SEQ ID NO: 5) is diluted in a 10-fold gradient, and the diluted standard product is used as the template for fluorescence quantitative PCR, with concentrations of 2.1×10 7 copies / mL, 2.1×10 6 copies / mL, 2.1×10 5 copies / mL, 2.1×10 4copies / mL, 2.1×10 3 copies / mL, 2.1×10 2 copies / mL, 2.1×10 copies / mL. Using the obtained positive plasmid standards with different gradients as templates, TaqMan qPCR detection was performed under the aforementioned reaction conditions. Each group of experiments was repeated 4 times, and the amplification curves are as shown in Figure 1 shown. The test results are shown in Table 3 below. Subsequently, with the Ct value as the ordinate and the logarithm of the initial template concentration as the abscissa, a standard curve was plotted, and the standard curve is as shown in Figure 2 shown. The standard curve is y = -3.5405x + 41.348, R 2 = 0.9972.
[0048] Table 3
[0049]
[0050] From Figure 1 , Figure 2 and the results in Table 3, it can be seen that the lowest detection concentration is 2.1×10 3 copies / mL.
[0051] Now, a specificity test was conducted on the primers and probes obtained in Example 1. The above primers and probes were used to detect Bursaphelenchus xylophilus, Bursaphelenchus mucronatus, Aphelenchoides rubroculus, and Aphelenchoides bicaudatus as controls, and 3 replicates were set for each gene sample. The test results are shown in Table 4 below, and the amplification curves are as shown in Figure 3 shown.
[0052] Table 4
[0053] Sample Ct1 Ct2 Ct3 Bursaphelenchus xylophilus 27.697 27.953 27.944 Bursaphelenchus mucronatus Not detected Not detected Not detected Aphelenchoides koreanus Not detected Not detected Not detected Aphelenchoides bicaudatus Not detected Not detected Not detected
[0054] From Table 4 and Figure 3 the results in it, it can be seen that the primers and probes provided in Example 1 have good specificity for Bursaphelenchus xylophilus.
[0055] Now, a repeatability test was conducted on the primers and probes prepared in Example 1. Specifically, 1 high-concentration sample (Sample 1) and 1 low-concentration sample (Sample 2) were selected for 10 repeatability detections respectively. A negative control group was set with enzyme-free and sterile water, and the average Ct value, standard deviation (SD), and coefficient of variation (CV) were calculated to evaluate the repeatability of the established method. The specific test results are shown in Table 5 below, and the amplification curves are as shown in Figure 4 shown.
[0056] Table 5
[0057]
[0058]
[0059] As can be seen from the results in Table 5 and Figure 4 in, in 10 repeated detections, the standard deviation of the Ct value of Sample 1 is small and the coefficient of variation is low, indicating that this method has excellent repeatability for the detection of high-concentration samples and is suitable for accurate quantification. The coefficient of variation in Sample 2 is also much lower than the CV≤5% usually required for qPCR repeatability, indicating that this method has good repeatability for the detection of low-concentration samples.
[0060] Comparative Example 1
[0061] The difference between this comparative example and Example 1 is that in step S2, the temperature of annealing and extension is set to 56°C.
[0062] Comparative Example 2
[0063] The difference between this comparative example and Example 1 is that in step S2, the temperature of annealing and extension is set to 58°C.
[0064] Comparative Example 3
[0065] The difference between this comparative example and Example 1 is that in step S2, the temperature of annealing and extension is set to 62°C.
[0066] Now, the detection thresholds of the primers and probes in Example 1 and Comparative Examples 1-3 are tested. Specifically, two samples (PC1 and PC2) are selected and the primers, probes, and amplification programs in Example 1 and Comparative Examples 1-3 are used to detect the corresponding average Ct values. The specific test results are shown in Table 6 below.
[0067] Table 6
[0068]
[0069]
[0070] As can be seen from the results in Table 6, the primers, probes, and amplification program in Example 1 show the most precise detection threshold during the detection of the two samples. Under this amplification program, the amplification efficiency is the highest and the binding of the primers to the template is the best.
[0071] In the description of the specification, the description referring to terms such as "one embodiment", "example", "specific example", etc. means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in a suitable manner in any one or more embodiments or examples.
[0072] The above content is only an example and illustration of the concept of the present invention. Those skilled in the art of the present technology can make various modifications or supplements to the described specific embodiments or use similar ways to replace them. As long as they do not deviate from the concept of the invention or exceed the scope defined by the claims of the present invention, they should all fall within the protection scope of the present invention.
Claims
1. A primer and a probe for efficiently detecting Bursaphelenchus xylophilus, characterized in that: Specifically, it includes an upstream primer, a downstream primer and a TaqMan probe; Among them, the upstream primer is SJ-Bxy-F, and the specific sequence is shown in SEQ ID NO:1; The downstream primer is SJ-Bxy-R, and the specific sequence is shown in SEQ ID NO:2; The TaqMan probe is SJ-Bxy-P, and the specific sequence is shown in SEQ ID NO:
3.
2. The primer and probe for efficiently detecting Bursaphelenchus xylophilus according to claim 1, characterized in that: The 5' end of the TaqMan probe is labeled with the fluorescent group FAM, and the 3' end is labeled with the quenching group MGB.
3. The primer and probe for efficiently detecting Bursaphelenchus xylophilus according to claim 1, characterized in that: The usage method of the primer and the probe is as follows: S1. Sample treatment: Mix the sample with the nucleic acid extraction solution, grind it and then extract DNA; S2. Fluorescent PCR amplification: Use the primer and the probe to amplify the DNA obtained in step S1; S3. Judgment: If the cycle threshold of the FAM channel ≤ 35 and a typical amplification curve appears, it is determined to be positive.
4. The primer and probe for efficiently detecting Bursaphelenchus xylophilus according to claim 3, wherein In step S2, the specific procedure of the amplification is as follows: Digestion: Treat at 24 - 28 °C for 1 - 3 minutes; Pre-denaturation: Treat at 94 - 98 °C for 30 seconds to 2 minutes; Denaturation: Treat at 94 - 98 °C for 5 - 15 seconds; Annealing and extension: Treat at 55 - 65 °C for 8 - 15 seconds, and cycle 35 - 45 times.
5. The primer and probe for highly efficiently detecting Bursaphelenchus xylophilus according to claim 4, characterized in that: The annealing and extension temperature of the primer and the probe is specifically 60 ± 2 °C.
Citation Information
Patent Citations
Special primer pair for pine beam thread insect PCR detection
CN101041851A
Kit for detecting pine beam nematode and detecting process thereof
CN101338342A
Primers, kits and method for fluorescent quantitative PCR detection of bursaphelenchus xylophilus or bursaphelenchus mucronatus
CN112538532A
Kit for detecting pine wood nematodes and method for detecting pine wood nematodes
CN119736403A
Detection kit for pine wood nematode and detection method therefor
CN1880472A