SNP (Single Nucleotide Polymorphism) molecular marker related to conception rate of young cow, detection product and application of SNP molecular marker

Abstract

The invention discloses an SNP molecular marker related to the conception rate of young cows, a detection product and application of the SNP molecular marker, and belongs to the technical field of dairy cow breeding markers. The SNP molecular marker is chr6: g. 103355581Cgt, and the SNP molecular marker is a molecular marker. The method comprises the following steps of: taking a bovine reference genome version UMD3.1 as a standard for a coordinate position, numbering Assessment in NCBI (National Center of Biotechnology Information) as GCF000003055.6, and numbering a chromosome as AC 000163.1; the young cows are cows which are 12-24 months old and do not lay calves. By detecting the genotype of the SNP site, the conception rate condition can be effectively judged, parent individuals with the higher young cow conception rate can be screened, early selection of genotype individuals with the high young cow conception rate is achieved, the frequency of the genotype with the high young cow conception rate in a dairy cow group is increased, and the reproduction rate of the dairy cow group is increased; the service life of cows is prolonged, the treatment cost is saved, the breeding cost is reduced, and the pasture income is increased.

Description

Technical Field

[0001] The present invention relates to the technical field of dairy cattle breeding markers, and particularly relates to an SNP molecular marker related to the conception rate of young cows, a detection product thereof, and applications thereof. Background Art

[0002] With the development of modern animal husbandry towards intensification and high efficiency, the reproductive efficiency of young cows has become a key factor affecting the economic benefits of pastures and the sustainable development of the industry. The conception rate of young cows is not only directly related to the renewal speed of the cattle herd and the improvement of production capacity, but also a core indicator for measuring the technical level of reproductive management. However, in the existing technology, the conception rate of young cows still faces multiple challenges: the traditional estrus synchronization program is complex in operation, and the inaccurate dosage of hormones leads to insufficient ovulation synchronization; the early embryonic mortality rate after insemination is high (about 60%-70% occurs within 16 days after insemination); and the disconnection between nutritional regulation and reproductive health management further exacerbates the instability of the conception rate.

[0003] The conception rate of young cows is one of the core indicators determining the reproductive efficiency and production benefits of dairy cattle herds. Research shows that for every 1% increase in the first insemination conception rate of young cows, the feeding cost during the non-pregnant period of the pasture can be significantly reduced by about 12%, and the calving interval can be shortened to within 365 days. However, the current reproductive management of young cows still faces technical bottlenecks: traditional phenotypic selection methods rely on the statistics of reproductive records, with a long cycle and slow genetic progress.

[0004] In recent years, with the increase in high-density SNP chip data, the opportunity to identify important mutations has become higher. Identifying causal variants through association mapping or assigning QTLs to one or several genes may help to identify genes controlling the conception rate of young cows. The conception rate of dairy cattle young cows is a complex trait controlled by multiple genes, and it is still necessary to further explore relevant gene loci. Summary of the Invention

[0005] The purpose of the present invention is to address the problem that there is less research on genes related to the conception rate of young cows in the existing technology, which cannot meet the needs of guiding production practice, and to provide an SNP molecular marker related to the conception rate of young cows, as well as related detection products and applications.

[0006] The technical solution of the present invention is described in detail as follows: In the first aspect, the present invention provides an SNP molecular marker related to the conception rate of young cows, and the SNP molecular marker is chr6:g.103355581C>T, and the coordinate position is based on the bovine reference genome version UMD3.1, the Assembly accession number in NCBI is GCF_000003055.6, and the chromosome number is AC 000163.1; The young cows are cows that are 12 to 24 months old and have not calved yet.

[0007] Optionally or preferably, the above SNP molecular marker is the 173rd nucleotide shown in SEQ ID NO: 1 in the sequence listing, and the polymorphism is C or T.

[0008] In a second aspect, the present invention provides the application of the above SNP molecular marker in judging the conception rate of young cows. The SNP molecular marker genotypes of young cows with high to low conception rates are TT, CT, and CC in sequence.

[0009] Optionally or preferably, in the above application, the method for judging the conception rate of young cows includes the following steps: (1) Extract the genomic DNA of the young cows to be tested; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2 to 3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker. The 173rd position of the amplification product is the SNP molecular marker; (3) Sequence the amplification product. The SNP molecular marker genotypes of young cows with high to low conception rates are TT, CT, and CC in sequence.

[0010] In a third aspect, the present invention provides the application of the above molecular marker in the assisted breeding of dairy cows. The SNP molecular marker genotypes of young cows of dairy cows with high to low conception rates are TT, CT, and CC in sequence.

[0011] In a fourth aspect, the present invention provides a product for detecting the above SNP molecular marker, which is a primer pair, and the nucleotide sequence is as shown in SEQ ID NOs: 2 to 3.

[0012] In a fifth aspect, the present invention provides another product for detecting the above SNP molecular marker, which is a detection kit, including a primer pair, and the nucleotide sequence of the primer pair is as shown in SEQ ID NOs: 2 to 3.

[0013] In a sixth aspect, the present invention provides the application of the above detection product in judging the conception rate of young cows. The SNP molecular marker genotypes of young cows with high to low conception rates are TT, CT, and CC in sequence.

[0014] In a seventh aspect, the present invention provides the application of the above detection product in the assisted breeding of dairy cows. The SNP molecular marker genotypes of young cows in dairy cows with high to low conception rates are TT, CT, and CC in sequence.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention conducts genotype identification in a dairy cow population using the Bovine SNP50 chip and discovers that there is 1 SNP (chr6:g.103355581C>T). Through the association analysis of the genotype of the dairy cow population and the genomic estimated breeding value of the conception rate trait of young dairy cows, it is proved that this SNP molecular marker is significantly correlated with the conception rate trait of young dairy cows. By detecting the genotype of this SNP locus, the conception rate can be effectively judged, which can be used to screen parental individuals with higher conception rates of young dairy cows, realize the early selection of genotype individuals with high conception rates of young dairy cows, increase the frequency of genotypes with high conception rates of young dairy cows in the dairy cow population, thereby improving the reproductive rate of the dairy cow population, increasing the service life of cows, saving treatment costs, reducing breeding costs, increasing ranch income, and laying a foundation for cultivating excellent new dairy cow strains with high conception rates of young dairy cows. In addition, related detection products of the above SNP molecular marker can also be developed into products related to the breeding of Chinese Holstein cows. Detailed implementation manners

[0016] In order to enable those skilled in the art of the present technology to better understand the solution of this application, the following will describe this application clearly and completely in combination with the embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of this application. The instruments and reagents used in the embodiments are all from commercial channels unless otherwise specified.

[0017] Example 1 SNP locus screening and superior genotype identification 1. Screening of SNP loci (1) A total of 2506 blood or hair follicle samples of Chinese Holstein young cows were collected from 4 large-scale farms across the country. The locations of the farms and the number of samples collected from each farm are shown in Table 1.

[0018] Table 1. Locations of farms where samples were collected and the number of samples collected (2) Genomic DNA was extracted from the samples, and the genotypes of the genomic DNA of the collected samples were determined using the Illumina BovineSNP50 chip. The determination of genotypes was performed by Neogen BioScience (Shanghai) Co., Ltd., and a total of 47,843 SNP marker loci genotypes were obtained.

[0019] (3) According to the genotypes, the genomic estimated breeding value (GEBV) of the conception rate of young cows for each individual was estimated. The genomic estimated breeding value was performed by Neogen BioScience (Shanghai) Co., Ltd.

[0020] (4)Using the GEMMA software, a genome-wide association analysis was performed on the genomic breeding value of the conception rate of young cows based on genotype data. The analysis model used a mixed linear model, with the pasture location and the age of the cows in months as covariates. The FDR method was used for multiple testing correction. The results of the association analysis showed that the most significant 1 SNP locus was located on chromosome 6, at position 103355581, and the significance P value was 0.005869.

[0021] 2. Identification of the dominant genotype of the SNP locus Among the 2506 Chinese Holstein cows collected, 751 individuals with the CC homozygous genotype were identified at the above SNP locus, and the mean genomic estimated breeding value of their young cow conception rate was 0.1796; 1136 individuals with the CT heterozygous genotype were identified, and the mean genomic estimated breeding value of their young cow conception rate was 0.2956; 619 individuals with the TT homozygous genotype were identified, and the mean genomic estimated breeding value of their young cow conception rate was 0.4340. In genomic genetic evaluation, the higher the genomic estimated breeding value of the young cow conception rate, the better. Therefore, the TT genotype of this SNP locus is the dominant genotype.

[0022] Example 2 Association analysis between SNP locus genotype and young cow conception rate 1. Amplification of the sequence where the SNP locus is located, detection and analysis of SNP genotype and allele frequency distribution To determine whether the SNP locus genotype screened in this application is related to the conception rate of young cows in cattle, 1042 Chinese Holstein young cows were selected for the association analysis between genotype and genomic estimated breeding value of young cow conception rate.

[0023] (1)Collection of bovine tail vein blood 1042 cows with genomic estimated breeding value of young cow conception rate were selected from three pastures as test materials, and the tail vein blood of the cows was collected.

[0024] (2)Genomic DNA extraction Take 500 μL of whole blood, add 500 μL of STE lysis buffer, sequentially add 50 μL of 10% SDS and 5 μL of proteinase K (20 mg / mL), and lyse at 56°C for about 3 h until the lysate becomes clear. Add an equal volume of saturated phenol (250 μL) and chloroform / isoamyl alcohol (24:1) (250 μL), gently shake for 20 min, and centrifuge at 12000 rpm for 10 min. Take the supernatant and repeat the above steps until there is no protein layer between the aqueous and organic phases. Take the supernatant, add an equal volume of chloroform / isoamyl alcohol, gently shake for 20 min, and centrifuge at 12000 rpm for 10 min. Take the supernatant, add 1 / 10 volume of 3M NaAc (pH 5.2) and 2 volumes of cold absolute ethanol, shake well, stand at -20°C for 20 min, and centrifuge at 12500 rpm for 20 min. Precipitate the nucleic acid at the bottom of the tube. Discard the supernatant, wash the precipitate with 70% ethanol. Collect the precipitate and air-dry it until all the ethanol has evaporated. Add 20 μL of TE (containing RNase A) to dissolve the DNA, stand at 37°C for about 30 min, and then store at 4°C. Detect the DNA sample by 1% agarose gel electrophoresis and detect the concentration and purity by ultraviolet spectrophotometer.

[0025] (3)Primer design According to the gene sequence of cattle where the SNP locus screened in Example 1 is located, design a pair of specific primers. Among them, The forward primer is 5F (SEQ ID NO: 2): 5’-GACTTGTGCGGTCATTTGGG-3’; The reverse primer is 3R (SEQ ID NO: 3): 5’-GGAGGCAGAAGGCAACAAAC-3’.

[0026] (4)Multiplex polymerase chain reaction Use the genomic DNA extracted in step (2) as a template and the primers designed in step (3) for PCR amplification. The reaction system is as follows: 10×Buffer 1 μL, 2.5 mM dNTP 0.8 μL, 2.5 mM MgCl2 0.6 μL, forward primer (10 μM) 0.1 μL, reverse primer (10 μM) 0.5 μL, Taq enzyme (5 U / μL) 0.1 μL, template 0.5 μL, LCGreen saturated fluorescent dye 0.7 μL, and add H2O to make up to 10 μL.

[0027] The amplification reaction is completed on an Applied Biosystem PCR system. The PCR reaction conditions are as follows: 95°C for 5 min; 95°C for 30 s, 59°C for 30 s, 72°C for 1 min; 35 cycles; 72°C for 5 min.

[0028] The obtained PCR amplification products were detected for genotypes by Sanger sequencing, and the sequences are as follows: GACTTGTGCGGTCATTTGGGCTTACTCTTGTTTCATTTATTTTTATCTAGAGTCAAAGTTGATTTGTCCACATTAATACAGAATGACATCTACTGCTTTATTTCATACTGCAGTATAAATTTAACCCCCAATTTTTAGATTCAGTAGATTTGGATAGATTCGTAAGAAAGGT C AGGAAGAGAAGACAAACATCACTTTCTCCTTCAGTATTCAACTTTTAGTATTGAGGTTGTTTGGGTTTTTCCATAAGATCATAGGGGAAAACCCAAAAGAACTTCTTGGCCAACCCATTATCTGCCACTTAGGTAGAGTTTGTTGCCTTCTGCCTCC (SEQ ID NO: 1). The SNP locus is located at position 173, and the polymorphism is C or T, which is indicated by bold and underlined in the sequence.

[0029] (5) Distribution frequencies of different genotypes at the SNP locus The analysis results of the allele frequency distribution at the SNP locus are shown in Table 2.

[0030] Table 2 Distribution results of different genotypes at the SNP locus in the Chinese Holstein cattle population The results showed that in all the detected populations, the CC gene frequency was 32.25%, the CT genotype frequency was 47.02%, the TT genotype frequency was 20.73%, and the CT genotype was the dominant genotype.

[0031] (6) Association between different genotypes at the SNP locus and genomic estimated breeding value of conception rate An association analysis was performed between the SNP locus genotypes of 1042 Chinese Holstein cattle and the genomic estimated breeding value of the conception rate of young cows.

[0032] Table 3 Results of the association analysis between the SNP locus genotypes and the genomic estimated breeding value of the conception rate of young cows The results showed that the average genomic estimated breeding value of individuals with the CC genotype was 0.1978, that of individuals with the CT genotype was 0.2567, and that of individuals with the TT genotype was 0.4436. The PLINK v1.90 software was used to analyze the correlation between different genotypes and the conception rate trait of young dairy cows. The results showed a significant correlation between the genotype and the genomic breeding value (P value was 1.34e-04). The genotype of the SNP locus with the highest genomic estimated breeding value for the conception rate of young dairy cows was TT.

[0033] In this article, specific examples are used to elaborate on the inventive concept in detail. The description of the above embodiments is only used to help understand the core idea of the present invention. It should be noted that for those of ordinary skill in the art, any obvious modifications, equivalent substitutions, or other improvements made without departing from the inventive concept should be included within the protection scope of the present invention.

Claims

1. A SNP molecular marker related to the conception rate of young cows, characterized in that, The SNP molecular marker is chr6:g.103355581C>T, and the coordinate position is based on the bovine reference genome version UMD3.1, with the Assembly accession number GCF_000003055.6 in NCBI and the chromosome number AC 000163.1; The young cows are cows that are 12 to 24 months old and have not calved.

2. The SNP molecular marker according to claim 1, wherein The SNP molecular marker is the 173rd nucleotide shown in SEQ ID NO: 1 in the sequence listing, and the polymorphism is C or T.

3. Use of the SNP molecular marker according to claim 1 or 2 in judging the conception rate of young cows, characterized in that, The SNP molecular marker genotypes of young cows with the highest to lowest conception rates are TT, CT, and CC in sequence.

4. The application according to claim 3, characterized in that, The method for judging the high or low conception rate of young cows includes the following steps: (1) Extract the genomic DNA of the young cows to be tested; (2) Using the genomic DNA obtained in step (1) as a template and the nucleotide sequences shown in SEQ ID NOs: 2 to 3 as primers, perform PCR amplification to obtain an amplification product containing the SNP molecular marker. The 173rd position of the amplification product is the SNP molecular marker; (3) Sequence the amplification product. The SNP molecular marker genotypes of the highest to lowest conception rates are TT, CT, and CC in sequence.

5. Use of the molecular marker according to claim 1 or 2 in the assisted breeding of dairy cows, characterized in that, The SNP molecular marker genotypes of young cows in dairy cows with the highest to lowest conception rates are TT, CT, and CC in sequence.

6. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that, The product is a primer pair, and the nucleotide sequences are as shown in SEQ ID NOs: 2 to 3.

7. A product for detecting the SNP molecular marker according to claim 1 or 2, characterized in that The product is a detection kit, including a primer pair, and the nucleotide sequences of the primer pair are as shown in SEQ ID NOs: 2 to 3.

8. Use of the product according to claim 7 in judging the conception rate of young cows, characterized in that, The SNP molecular marker genotypes of young cows with the highest to lowest conception rates are TT, CT, and CC in sequence.

9. Use of the product according to claim 7 in the assisted breeding of dairy cows, characterized in that, The SNP molecular marker genotypes of young cows in dairy cows with the highest to lowest conception rates are TT, CT, and CC in sequence.

Images