Primer group, kit and method for detecting GII type norovirus

Abstract

The invention relates to the technical field of molecular biology, in particular to a primer group, a kit and a method for detecting GII type norovirus. The invention discloses a primer group for detecting a GII type norovirus. The primer group can be used for LAMP (Loop-Mediated Isothermal Amplification) to quickly amplify the sequence of the GII type norovirus. The invention further discloses a method for rapidly detecting the GII type norovirus, according to the method, a certain amount of dUTP and UDG are added into an LAMP amplification system, the probability of false positive can be reduced, meanwhile, gene amplification is conducted through LAMP, the method has the advantages of being rapid and convenient to use, an amplified product is tested through LFD, and a result can be visually displayed on LFD. The method has the advantages of rapidness, high efficiency and certain anti-pollution capability.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a primer set, a kit and a method for detecting GII type norovirus, and more specifically to a primer set, a kit and a detection method for UDG-LAMP-LFD detection of GII type norovirus in aquatic products. Background Art

[0002] Norovirus, a common foodborne virus, can cause symptoms such as fever and diarrhea in humans. It is particularly harmful to infants, young children, and those with weakened immune systems, resulting in a significant global disease burden. Norovirus transmission exhibits a distinct seasonal pattern, with the highest prevalence in winter. It is highly resilient to adverse environmental conditions and can survive within its host for extended periods. Foodborne transmission is a key mechanism for norovirus outbreaks, with aquatic products serving as a significant reservoir. In recent years, norovirus has also been detected in fresh produce such as frozen berries and lettuce. Due to its high contagiousness and difficulty in prevention and control, foodborne norovirus infections can significantly impact public health systems and national economies. Detecting norovirus before food is distributed is a powerful tool for preventing outbreaks and safeguarding public health. It also plays a crucial role in maintaining the credibility of the food industry and socioeconomic stability.

[0003] Currently, the detection techniques for norovirus can be roughly divided into two categories. One is the nucleic acid detection technique based on molecular biology, and the other is the immunological detection technique. The nucleic acid detection techniques for norovirus include polymerase chain reaction (PCR), isothermal amplification technique, next-generation sequencing (NGS), etc. Real-time fluorescence quantitative PCR is considered the "gold standard" for norovirus detection. It has high specificity but takes a long time, and like conventional PCR, it requires a specific cyclic heating device. Compared with the PCR technique, the isothermal amplification technique has been widely studied because of its high sensitivity, short time consumption, and no need for specific equipment. The isothermal amplification technique includes loop-mediated isothermal amplification technique, recombinase polymerase amplification technique, rolling circle amplification technique, etc. Among them, the loop-mediated isothermal amplification technique (LAMP) can achieve a large amount of amplification of the target sequence within one hour at a temperature of 60-65°C without the aid of a specific thermal cycling instrument, and is suitable for on-site detection at the grass-roots level. The LAMP results can be interpreted in various ways. Common methods include the following: (1) Interpretation in combination with agarose gel electrophoresis: This method requires taking the product for electrophoresis experiment after the LAMP reaction is completed, which takes a long time; (2) Dye method: The commonly used dyes can be divided into two types: fluorescent dyes and visual dyes. The former needs to be analyzed with the help of a qPCR instrument or ultraviolet light source, while the latter can directly judge positive samples through color change; (3) Coupled with a lateral flow dipstick (LFD): This method has stronger specificity and can directly interpret the results with the naked eye through the test line, greatly shortening the detection time.

[0004] One of the most significant disadvantages of loop-mediated isothermal amplification is the easy occurrence of false positives. Since loop-mediated isothermal amplification requires the design of 2-3 pairs of primers, the risk of primer mismatch increases, and primer dimers are easily formed. Moreover, non-specific amplification will occur when the concentrations of dNTPs and magnesium ions in the reaction system are too high or too low. In addition, open detection methods such as agarose gel electrophoresis and LFD are prone to form aerosol pollution in the air, and their high sensitivity is more susceptible to aerosol influence, resulting in the generation of false positive phenomena.

[0005] Therefore, there is an urgent need to develop a visual method for detecting norovirus that can be fast, efficient, and have a certain anti-pollution ability. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies of the above-mentioned existing technologies, and provide a visual method for detecting norovirus in aquatic products that is fast, efficient and has a certain anti-pollution ability. UDG (Uracil-DNA Glycosylase) is introduced into the loop-mediated isothermal amplification system. By using dUTP to replace dTTP, the uracil on the DNA strand of the accidentally incorporated old product is destroyed by the UDG enzyme at the beginning of the reaction, thereby greatly reducing the occurrence of false positive results. At the same time, biotin and 6-carboxyfluorescein (6-FAM) are used to modify the internal primers respectively, and a lateral flow test strip is used to interpret the results. The present invention creatively combines LAMP and LFD to construct a rapid anti-pollution detection technology for GII norovirus in aquatic products, providing strong technical support for reducing the risk of norovirus transmission and maintaining public health.

[0007] In the first aspect of the present invention, a primer set for detecting GII norovirus is provided, which includes external primers and internal primers. The external primers include an external upstream primer F3 and an external downstream primer B3, and the internal primers include an internal upstream primer FIP and an internal downstream primer BIP;

[0008] The nucleotide sequence of the external upstream primer F3 is shown in SEQ ID NO:1;

[0009] The nucleotide sequence of the external downstream primer B3 is shown in SEQ ID NO:2;

[0010] The nucleotide sequence of the internal upstream primer FIP is shown in SEQ ID NO:3;

[0011] The nucleotide sequence of the internal downstream primer BIP is shown in SEQ ID NO:4.

[0012] Further, the 5' end of the internal upstream primer FIP is labeled with Biotin, and the 5' end of the internal downstream primer BIP is labeled with 6-FAM.

[0013] In the second aspect of the present invention, a kit for detecting G II norovirus is provided, and the kit includes the above-mentioned primer set.

[0014] In the third aspect of the present invention, a method for detecting GII norovirus is provided, which includes the following steps:

[0015] S1: Extract the RNA of the sample to be tested as a template;

[0016] S2: Use the above-mentioned primer set to perform fluorescence LAMP amplification on the RNA extracted in step S1;

[0017] S3: Dilute the amplification product prepared in step S2, drop all the diluted product onto the sample pad of the nucleic acid colloidal gold test strip for LFD detection, let it stand at room temperature for 5 - 10 min in a flat position, and then interpret the result.

[0018] Specifically, if both the C and T lines show color, it is a positive result; if only the C line shows color, it is a negative result; if the T line shows color and the C line does not, it indicates that the test strip is incorrect and re - sampling is required.

[0019] Furthermore, in step S2, the LAMP reaction system includes the following components: d(A / C / G)TP, 10×Buffer, MgSO4, FIP, BIP, F3, B3, BstⅡ DNA polymerase, Eve Green (20× in water), template, dUTP, UDG.

[0020] Furthermore, in the LAMP reaction system, the final concentration of dUTP is 1.0 mM, and the final concentration of UDG is 0.04 U / μL.

[0021] Furthermore, in step S2, the LAMP amplification reaction temperature is 63 °C.

[0022] Furthermore, in step S2, the LAMP amplification reaction time is 40 min.

[0023] Furthermore, in step S2, the LAMP reaction system is: 3 μL dNTP (where dUTP is used to completely replace dTTP in the reaction), 2.5 μL 10×Buffer, 2 μL 100 mmol / L MgSO4, 4 μL 10 μmol / L FIP / BIP, 0.5 μL 10 μmol / L F3 / B3, 1 μL BstⅡ DNA polymerase, 0.75 μL Eve Green (20× in water), 1 μL template, and sterile water is added to make the volume up to 25 μL.

[0024] The present invention also provides the application of the above - mentioned primer set or the above - mentioned kit in detecting GII norovirus in aquatic products.

[0025] Optionally, the aquatic products include oysters, razor clams, white clams, and hard clams.

[0026] The beneficial effects of the present invention at least include:

[0027] (1) The present invention can rapidly and visually detect GⅡ norovirus in aquatic products;

[0028] (2) The detection method of the present invention improves the disadvantage of easy false positives in loop - mediated isothermal amplification and does not require the assistance of a thermal cycling instrument, which is particularly suitable for on - site rapid detection. Description of the Drawings

[0029] Figure 1 Schematic diagram of the specific positions of the primers.

[0030] Figure 2 Optimization result graph of dUTP concentration. (A) Real-time fluorescence LAMP graph; (B) Agarose gel electrophoresis graph: from left to right are M-100bp Marker, N-negative control, 1-0.2 mM dUTP, 2-0.4 mM dUTP, 3-0.6 mM dUTP, 4-0.8 mM dUTP, 5-1.0 mM dUTP, 6-1.2 mM dUTP, 7-1.4 mM dUTP, 8-1.6 mM dUTP.

[0031] Figure 3 Optimization result graph of UDG concentration. (A)(B) Effects of different UDG enzyme addition amounts on the reaction; (C)(D) Exploration of anti-pollution ability under different UDG enzyme additions; (A) Real-time fluorescence LAMP graph; (B) Agarose gel electrophoresis graph: from left to right are M-100bp Marker, N-negative control, 1-0.00 U / μL UDG enzyme, 2-0.008 U / μL UDG enzyme, 3-0.016 U / μL UDG enzyme, 4-0.024 U / μL UDG enzyme, 5-0.032 U / μL UDG enzyme, 6-0.040 U / μL UDG enzyme, 7-0.048 U / μL UDG enzyme, 8-0.056 U / μL UDG enzyme; (C) Real-time fluorescence LAMP graph; (D) Agarose gel electrophoresis graph: from left to right are M-100bp Marker, N-negative control, 1-0.00 U / μL UDG enzyme, 2-0.008 U / μL UDG enzyme, 3-0.016 U / μL UDG enzyme, 4-0.024 U / μL UDG enzyme, 5-0.032 U / μL UDG enzyme, 6-0.040 U / μL UDG enzyme.

[0032] Figure 4 Graph for exploring the anti-pollution ability of UDG enzyme (the product is diluted 10 4 -10 16 times), (A) Real-time fluorescence LAMP graph; (B) Agarose gel electrophoresis graph: from left to right are M-100bp Marker, N-negative control, 1-positive control, 2-10 4 times diluted product, 3-10 6 times diluted product, 4-10 8 times diluted product, 5-10 10 times diluted product, 6-10 12 times diluted product, 7-10 14 times diluted product, 8-10 16Doubly diluted product.

[0033] Figure 5 It is a graph showing the exploration results of the detection ability of LAMP-LFD at different reaction times. (A) LFD results; (B) Agarose gel electrophoresis diagram. From left to right, they are: M - 100bp Marker, N - negative control, 1 - 20min, 2 - 30min, 3 - 40min, 4 - 50min, 5 - 60min, 6 - 70min.

[0034] Figure 6 It is a graph showing the exploration results of the detection ability of LAMP-LFD at different reaction temperatures. From left to right, they are: M - 100bp Marker, N - negative control, 1 - 59℃, 2 - 60℃, 3 - 61℃, 4 - 62℃, 5 - 63℃, 6 - 64℃, 7 - 65℃, 8 - 66℃.

[0035] Figure 7 It is a graph showing the exploration results of the detection specificity of LAMP-LFD. From left to right, they are: M - 100bp Marker, 1 - GⅡ Norovirus, 2 - Hepatitis A virus, 3 - Sapovirus, 4 - Rotavirus, 5 - Vibrio parahaemolyticus, 6 - Listeria monocytogenes, 7 - Escherichia coli.

[0036] Figure 8 It is a graph showing the exploration results of the sensitivity of UDG-LAMP-LFD. From left to right, they are: N - negative control, 1 - 10 4 copies / μL, 2 - 10 3 copies / μL, 3 - 10 2 copies / μL, 4 - 10 1 copies / μL, 5 - 9 copies / μL, 6 - 8 copies / μL, 7 - 7 copies / μL, 8 - 6 copies / μL, 9 - 5 copies / μL.

[0037] Figure 9 It is a graph showing the detection results of Norovirus in razor clam samples. (A) Results of LFD positive samples: N - negative control; (B) Agarose gel electrophoresis: M - 100bp Marker, N - negative control.

[0038] Figure 10 It is a graph showing the detection results of Norovirus in surf clam samples. (A) Results of LFD positive samples: N - negative control; (B) Agarose gel electrophoresis: M - 100bp Marker, N - negative control.

[0039] Figure 11Graph of norovirus detection results for blood clam samples. (A) Results of LFD positive samples: N - negative control; (B) Agarose gel electrophoresis: M - 100bp Marker, N - negative control.

[0040] Figure 12 Graph of norovirus detection results for oyster samples. (A) Results of LFD positive samples: N - negative control; (B) Agarose gel electrophoresis: M - 100bp Marker, N - negative control. Detailed implementation manners

[0041] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0042] In addition, the technical solutions between the various embodiments of the present invention can be combined with each other, but it must be based on the fact that those of ordinary skill in the art can implement it. When the combination of technical solutions appears to be contradictory or unable to be implemented, it should be considered that such a combination of technical solutions does not exist and is not within the protection scope required by the present invention.

[0043] The materials and methods used in the present invention are as follows:

[0044] 1. Bacterial strains

[0045] Escherichia coli, Listeria monocytogenes, and Vibrio parahaemolyticus are preserved in the Laboratory of Risk Assessment for Aquatic Product Storage and Quality Safety of the Ministry of Agriculture and Rural Affairs, Shanghai Ocean University. The rotavirus and sapovirus used are recombinant plasmids synthesized from conserved sequences, and the glycerol bacteria are all preserved in a -80°C refrigerator.

[0046] 2. Reagents and instruments

[0047] Reagents: LB broth, LB agar, and BHI broth were purchased from Beijing Land Bridge Technology Co., Ltd.; BstII DNA Polymerase Large Fragment, dUTP, dATP, dCTP, dGTP, Heat-labile UDG, and RTv Reverse Transcriptase were purchased from Nanjing Novoprotein Biological Technology Co., Ltd.; UDG enzyme was purchased from Jiangsu CWBIO Co., Ltd.; Eve Green (20× in water) was purchased from Yeasen Biotech Co., Ltd. (Shanghai); Nucleic acid colloidal gold test strip (single-label) was purchased from Wuhan Junuode Biotechnology Co., Ltd.; Bacterial genomic DNA extraction kit, Viral genomic RNA extraction kit, and Plasmid miniprep kit were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.

[0048] Instruments: Laminar flow hood: Model HCB-1300VS, Qingdao Haier Biomedical Co., Ltd.; -80 °C low-temperature refrigerator: Model DW-86L338J, Qingdao Haier Biomedical Co., Ltd.; Electrophoresis apparatus: Model DYY 6C, Beijing Liuyi Instrument Factory; Oscillator: Model Lab Dancer, IKA (Guangzhou) Instrument and Equipment Co., Ltd.; Palm centrifuge: Model miniG, IKA (Guangzhou) Instrument and Equipment Co., Ltd.; Gel imaging system: Model Invitrogen iBright, Thermo Fisher Scientific (China) Co., Ltd.; PCR instrument: Model Biometra TOne 96G, Analytik Jena (Beijing) Co., Ltd.; qPCR instrument: Model qTower3, Analytik Jena (Beijing) Co., Ltd.; Micro ultraviolet-visible spectrophotometer: Model Nanodrop One, Thermo Fisher Scientific (China) Co., Ltd.

[0049] 3. Construction of recombinant plasmid and primer design

[0050] For the experiment, a highly conserved sequence at the junction of ORF1 and ORF2 of GII norovirus (GeneBank accession number: X86557) was selected to construct the recombinant plasmid. The specific sequence information is as Figure 1 shown. PrimerExplorer V5 was used for LAMP primer design. The detailed primer sequences are shown in Table 1. The plasmids and primers used in the experiment were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0051] Table 1 Primer sequences for LAMP detection of GII norovirus

[0052] Primer Name Sequence (5’to 3’) Number F3 GGCTCCCAGCTTTGTGAAT SEQ ID NO:1 B3 CGCTCCACAGTATCTCACCT SEQ ID NO:2 FIP CGGGCTCCAGAGCCATAACCTTGACGCCAACCCATCTGAT SEQ ID NO:3 BIP GTGGCGGGCCAACAAAACGTAACTGTGAACTCTCCACCAGG SEQ ID NO:4

[0053] 4. Construction and optimization of UDG-LAMP system

[0054] The specific basic LAMP optimization system is as follows: 3 μL dNTP, 2.5 μL 10× Buffer, 2 μL 100 mmol / L MgSO4, 4 μL 10 μmol / L FIP / BIP, 0.5 μL 10 μmol / L F3 / B3, 1 μL BstⅡ DNA polymerase, 1 μL template, and nuclease-free water is used to make up the volume to 25 μL. The reaction conditions are: constant temperature reaction at 63 °C for 50 min, and then enzyme inactivation at 85 °C for 5 min.

[0055] To develop a LAMP system with the ability to prevent aerosol contamination and reduce the generation of false positive results, through single factor experiments, dUTP / UDG was introduced into the system, and the reaction system was optimized from two aspects: the addition amount of dUTP and the dosage of UDG enzyme. The results were judged by agarose gel electrophoresis and real-time fluorescence LAMP diagrams.

[0056] The real-time fluorescence LAMP system is: 3 μL dNTP, 2.5 μL 10× Buffer, 2 μL 100 mmol / L MgSO4, 4 μL 10 μmol / L FIP / BIP, 0.5 μL 10 μmol / L F3 / B3, 1 μL BstⅡ DNA polymerase, 0.75 μL Eve Green (20× in water), 1 μL template, and nuclease-free water is used to make up the volume to 25 μL. React at 63 °C for 60 min, and then inactivate at 85 °C for 5 min;

[0057] Optimization of the addition amount of dUTP: Without changing the concentration of d(A / C / G)TP, dUTP is used to completely replace dTTP to participate in the reaction, so that the final concentration of dUTP in the system is 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6 mM respectively. The experimental results are observed by real-time fluorescence LAMP and agarose gel electrophoresis, and all experiments are repeated three times;

[0058] Optimization of the addition amount of UDG enzyme: Adjust the final concentration of UDG enzyme in the system to 0.008 U, 0.016 U, 0.024 U, 0.032 U, 0.040 U, 0.048 U, 0.056 U. The reaction conditions are set as incubation at 25 °C for 10 min, then amplification at 63 °C for 50 min, and finally enzyme inactivation at 85 °C for 5 min. The addition range of UDG enzyme is judged by real-time fluorescence LAMP and agarose gel electrophoresis. By adding amplified products to simulate aerosol contamination, the optimal addition amount of UDG enzyme is determined. The amplified products are diluted 10 10 times, and then added to the system as a template for reaction. The optimal addition amount of UDG enzyme is judged by real-time fluorescence LAMP and agarose gel electrophoresis;

[0059] Detection of the anti-contamination ability of UDG enzyme: The amplified products are serially diluted to obtain 104 , 10 6 , 10 8 , 10 10 , 10 12 , 10 14 , 10 16 The amplified products diluted by 10 times are then added as templates to the system optimized in the previous step for reaction, and the anti-contamination ability of UDG enzyme is judged by real-time fluorescence LAMP and agarose gel electrophoresis.

[0060] 5. Optimization of UDG-LAMP-LFD reaction conditions

[0061] Construction of UDG-LAMP-LFD reaction system: Modify the internal upstream primer FIP with Biotin and the internal downstream primer BIP with 6-FAM. After reacting according to the optimized system, dilute the LAMP reaction products 20 times with enzyme-free water to make the total volume of the diluted products 100 μL, and then drop all the diluted products onto the sample pad of the nucleic acid colloidal gold test strip for LAMP-LFD detection. Read the results after standing at room temperature for 5 min. Positive results are indicated by the appearance of both C and T lines, negative results are indicated by the appearance of only the C line, and the appearance of the T line and the non-appearance of the C line indicate that the test strip is incorrect and re-sampling is required.

[0062] Optimization of UDG-LAMP-LFD reaction temperature: Keep other conditions unchanged and adjust the reaction temperatures to 59, 60, 61, 62, 63, 64, 65, and 66 °C respectively. Judge the experimental results by the test strip and agarose gel electrophoresis, and all experiments are repeated three times.

[0063] Optimization of reaction time: Keep other conditions unchanged and adjust the reaction time in the LAMP amplification stage to 20, 30, 40, 50, 60, and 70 min respectively. Judge the experimental results by the test strip and agarose gel electrophoresis, and all experiments are repeated three times.

[0064] 6. Specificity determination of UDG-LAMP-LFD

[0065] To verify the specificity of UDG-LAMP-LFD for the detection of GII norovirus, Escherichia coli, Listeria monocytogenes, Vibrio parahaemolyticus, rotavirus, and sapovirus were used as test samples for specificity determination. All strains were preserved in this laboratory. After activation of the bacterial strains, genomic DNA extraction kits were used to extract DNA, and the concentration was measured using Nanodrop and then stored at -20 °C in the refrigerator for later use. After activation of the glycerol bacteria containing the recombinant plasmids with the conserved sequences of rotavirus and sapovirus, plasmid extraction kits were used to extract plasmids, and the quality was evaluated using Nanodrop and then stored at -20 °C in the refrigerator for later use.

[0066] 7. Sensitivity determination of UDG-LAMP-LFD

[0067] The recombinant plasmid was serially diluted to obtain templates with concentrations of 1x10 4 , 1x10 3 , 1x10 2 , 1x10 1 , 9, 8, 7, 6, 5 copies / μL. Sterile water was used as a negative control. The optimized UDG-LAMP-LFD was used to detect the sensitivity of norovirus genome. The sensitivity was evaluated according to the detection results, and all experiments were repeated three times.

[0068] 8. Detection of actual samples

[0069] 50 oysters, 50 razor clams, 50 white clams, and 50 hard clams were purchased from Shanghai Luchaogang Seafood Market and transported to the laboratory on ice. After arriving at the laboratory, (2.0 ± 0.2) g of digestive gland was extracted in a sterile and enzyme-free environment. After grinding with 500 μL of PBS buffer or normal saline on ice at low temperature, 400 μL of the supernatant was aspirated and mixed with 40% PEG8000 solution to make the final concentration of PEG8000 in the mixture 10%. The mixture was placed on ice for 3 - 6 h. After precipitation, it was centrifuged at 12000 r / min at 4°C for 30 min. The excess supernatant was aspirated to make the final volume of the mixture 200 μL, and RNA was extracted according to the operating method of the virus RNA extraction kit. 0.5 μL of heat-resistant reverse transcriptase was added to the UDG-LAMP-LFD system to achieve one-step detection. 1 μL of RNA was added to the system for amplification, and the detection results were verified according to the primer-probe combination described in ISO 15216-2:2019 (see Table 2). All experiments were repeated three times.

[0070] Table 2 Primer and probe sequences for qPCR detection of GII norovirus

[0071]

[0072] The following specifically illustrates the proposed solution of the present invention through corresponding results:

[0073] Example 1 Construction and optimization of the UDG-LAMP system

[0074] 1. Optimization of dUTP concentration

[0075] The results are as Figure 2As shown, when the dUTP concentration is between 0.2 - 1.6 mM, typical ladder bands are generated in the agarose gel electrophoresis. Through real-time fluorescence LAMP, it is found that when the dUTP concentration in the system is 0.8 mM, the Ct value is the smallest, but its fluorescence signal intensity is lower than that at 1.0 mM. Considering both the Ct value and the signal intensity, 1.0 mM is selected as the optimal condition for subsequent experiments.

[0076] 2. Optimization of UDG enzyme concentration

[0077] Optimize the concentration of UDG enzyme at a concentration range of 0.008 U - 0.056 U. As Figure 3 (A)(B) shows, as the concentration of UDG enzyme in the system increases, the degree of reaction inhibition also increases. When the UDG enzyme concentration reaches 0.048 U / μL, the LAMP reaction is significantly inhibited; when the UDG enzyme concentration reaches 0.056 U / μL, the LAMP reaction is completely inhibited. Combining the real-time fluorescence LAMP graph and the agarose gel electrophoresis graph, it is considered that the suitable application range of UDG enzyme is 0.008 - 0.040 U / μL. Dilute the amplification product 10 10 times and add it to the system as a template for reaction. As Figure 3 (C)(D) shows, when the concentration of UDG enzyme is 0.040 U / μL, there is basically no amplification in the system. Therefore, 0.040 U / μL is the optimal addition amount of UDG enzyme.

[0078] 3. Detection of the contamination prevention ability of UDG enzyme

[0079] As Figure 4 (A)(B) shows, after gradient diluting the amplification product and adding it to the system as a template for reaction, when the amplification product is diluted 10 10 times, there is basically no amplification in the system, indicating that the system can hydrolyze contaminants diluted up to 10 10 times at most.

[0080] Example 2 Optimization of UDG-LAMP-LFD reaction conditions

[0081] 1. Optimization of the UDG-LAMP-LFD reaction time

[0082] As Figure 5 (A) shows, when the reaction time in the amplification stage is adjusted between 20 - 70 min, the test strip LFD can display the results normally; while Figure 5(B) It was found that starting from 40 minutes of reaction time in the amplification stage, the electrophoresis bands became clear and bright. However, when the reaction time in the amplification stage was higher than 60 minutes, the electrophoresis bands began to become blurred. Combining with the previous real-time fluorescence LAMP graph, when the reaction time in the amplification stage was 40 minutes, the reaction basically reached the plateau. Therefore, it was considered that 40 - 60 minutes was the optimal range of reaction time in the amplification stage, and 40 minutes was the best reaction time in the amplification stage.

[0083] 2. Optimization of the reaction temperature of UDG-LAMP-LFD

[0084] As Figure 6 shown, when the reaction amplification time was adjusted between 58 - 66 °C, the LFD test strip had obvious quality control lines and detection lines. Combining with the agarose gel electrophoresis results, it was found that when the reaction temperature was 63 °C, the electrophoresis bands were the clearest and brightest. Therefore, it was considered that 63 °C was the best reaction temperature.

[0085] 3. Specificity determination of UDG-LAMP-LFD

[0086] The amplification results were as Figure 7 shown. Figure 7 The test samples in

[0087] were respectively: 1 - GII norovirus, 2 - hepatitis A virus, 3 - sapovirus, 4 - rotavirus, 5 - Vibrio parahaemolyticus, 6 - Listeria monocytogenes, 7 - Escherichia coli. The results showed that only GII norovirus showed positive results. The agarose gel electrophoresis presented typical ladder-like bands, and the LFD test strip had obvious quality control lines and detection lines, indicating that the established UDG-LAMP-LFD system had strong specificity.

[0088] As Figure 8 shown, when the template concentration in the system was lower than 7 copies / μL, the detection line of the LFD test strip did not show color, and no bands were produced in the agarose gel electrophoresis, indicating that the detection sensitivity of the established UDG-LAMP-LFD system was 7 copies / μL.

[0089] 5. Detection of actual samples

[0090] As Figures 9 - 12 shown, the one-step UDG-LAMP-LFD was used to detect the contamination of GII norovirus in the samples of razor clams, white clams, blood clams, and oysters purchased from the market. 11 positive samples of razor clams, 10 positive samples of white clams, 6 positive samples of blood clams, and 10 positive samples of oysters were detected. The detection rates are shown in Table 3. And the detection results were completely consistent with qPCR, indicating that the established one-step UDG-LAMP-LFD could be used for the detection of GII norovirus in aquatic products.

[0091] Table 3 Actual Sample Detection Rate

[0092] Name Positive Detection of UDG - LAMP - LFD Positive Detection of qPCR Detection Rate Razor Clam 11 11 22％ White Clam 10 10 20％ Blood Clam 6 6 12％ Oyster 10 10 20％

[0093] It should be noted that in this article, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements, but also includes other elements not explicitly listed, or further includes elements inherent to such process, method, article or device. Without more limitations, an element defined by the statement "including one..." does not exclude the existence of additional identical elements in the process, method, article or device including that element.

[0094] The serial numbers of the embodiments of the present invention above are only for description and do not represent the superiority or inferiority of the embodiments.

[0095] The above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the purpose and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A primer set for detecting GII norovirus, characterized in that, It includes an external primer and an internal primer. The external primer includes an external upstream primer F3 and an external downstream primer B3, and the internal primer includes an internal upstream primer FIP and an internal downstream primer BIP; The nucleotide sequence of the external upstream primer F3 is shown in SEQ ID NO:1; The nucleotide sequence of the external downstream primer B3 is shown in SEQ ID NO:2; The nucleotide sequence of the internal upstream primer FIP is shown in SEQ ID NO:3; The nucleotide sequence of the internal downstream primer BIP is shown in SEQ ID NO:

4.

2. The primer set according to claim 1, characterized in that, The 5'-end of the internal upstream primer FIP is labeled with Biotin, and the 5'-end of the internal downstream primer BIP is labeled with 6-FAM.

3. A kit for detecting G II type norovirus, characterized in that, The kit contains the primer set according to claim 1 or 2.

4. A detection method for GII norovirus, characterized in that, It includes the following steps: S1: Extract the RNA of the sample to be tested as a template; S2: Use the primer set described in claim 1 or 2 to perform fluorescence LAMP amplification on the RNA extracted in step S1; S3: Dilute the amplification product prepared in step S2, drop all the diluted products onto the sample pad of the nucleic acid colloidal gold test strip for LFD detection, and read the result after lying flat at room temperature and standing still.

5. The detection method according to claim 4, wherein In step S2, the LAMP reaction system includes the following components: d(A / C / G)TP, 10×Buffer, MgSO4, FIP, BIP, F3, B3, BstⅡ DNA polymerase, Eve Green (20× in water), template, dUTP, UDG.

6. The detection method according to claim 5, wherein In the LAMP reaction system, the final concentration of dUTP is 1.0 mM, and the final concentration of UDG is 0.04 U / μL.

7. The detection method according to claim 4, wherein In step S2, the LAMP amplification reaction temperature is 63 °C.

8. The detection method according to claim 4, wherein In step S2, the LAMP amplification reaction time is 40 min.

9. The application of the primer set according to claim 1 or 2 or the kit according to claim 3 in detecting norovirus GII in aquatic products.

Images