Corynebacterium glutamicum for secretory expression of lysozyme as well as construction method and application thereof
By optimizing the signal peptide and promoter combination in Corynebacterium glutamicum and combining with the tat transport system, the efficient secretion and expression of recombinant lysozyme is achieved, which solves the problems of low expression and high cost of lysozyme production in the prior art, and provides an efficient solution for producing lysozyme in the prokaryotic system.
Patent Information
- Application Number
- CN202510324813.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-08-05
AI Technical Summary
In the prior art, the production method of lysozyme has low expression levels, high cost, difficulty in isolation and purification, and ethical and environmental problems, making it difficult to achieve efficient and economical large-scale production.
Corynebacterium glutamate was used as the host bacteria, and the signal peptide screening, promoter and ribosome binding site RBS combination optimization was used, and the secretion and expression of recombinant lysozyme was achieved through overexpression tat transport system, and the culture conditions were optimized to improve the yield and purification efficiency of lysozyme.
The expression of recombinant lysozyme was significantly increased, reaching 0.2g·L-1, reducing purification costs, and enhancing the secretion ability of cells and tolerance to lysozyme, providing a new method for producing lysozyme in an efficient prokaryotic system.
Smart Images

Figure CN120424839A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to a Corynebacterium glutamicum that secretes and expresses lysozyme, and a construction method and application thereof. Background Art
[0002] Lysozyme, also known as acetylmuramin polysaccharide hydrolase, hydrolyzes the β-1,4-glycosidic bond between N-acetylmuramic acid and N-acetylglucosamine in the peptidoglycan layer of bacterial cell walls. As a natural anti-infective agent, lysozyme can reduce antibiotic usage without causing drug resistance, and is widely used in food preservation. Currently, lysozyme preparations are primarily extracted from eggshells and egg whites. However, as demand increases, traditional extraction methods are bound to raise concerns about food safety and environmental pollution. Heterologous expression of recombinant lysozyme using recombinant DNA technology and prokaryotic or eukaryotic expression systems is an effective way to achieve large-scale production and address this issue.
[0003] At present, a series of studies have been conducted on transgenic plants, animal mammary bioreactors, and eukaryotic microorganisms. However, there are still problems such as low activity of expressed lysozyme, high cost, difficulty in separation and purification, and long experimental cycle. However, the use of prokaryotic microorganisms to produce lysozyme has the advantages of short production cycle, simple operation, low cost and high efficiency, and has great industrial production potential and research value.
[0004] Corynebacterium glutamicum is a typical GARS strain, lacking endotoxins and possessing advantages such as efficient secretion, excellent fermentation robustness, and the ability to utilize multiple carbon sources. Its cell wall consists of an intracellular membrane and a layer of peptidoglycan and arabinogalactan covalently linked to mycolic acid. This atypical cell membrane structure provides a certain degree of tolerance to lysozyme. Using the prokaryotic microorganism Corynebacterium glutamicum for lysozyme production is a cost-effective and simple option.
[0005] Lysozyme, a bacterial lytic enzyme, has been widely studied and applied in agriculture, medicine, and biotechnology. While various methods exist for producing lysozyme, including transgenic plants, animal mammary bioreactors, and eukaryotic microorganisms, commercial lysozyme production primarily relies on egg white extraction. Currently, researchers have successfully expressed lysozyme in transgenic plants, such as tobacco and Arabidopsis juncea. However, this approach has several limitations. First, lysozyme expression levels in plants are often low, resulting in reduced efficacy. Second, plant-produced lysozyme can be unstable or inactive, affecting its function. Furthermore, the use of transgenic plants raises questions about environmental safety and public acceptance. There have been reports of using animal mammary bioreactors, such as those used in goats or cattle, to produce lysozyme-enriched milk. While this approach can produce large amounts of lysozyme, it also has several disadvantages. For example, lysozyme expression levels in milk can be variable, and the purification process can be complex and expensive. In addition, the use of animals to produce lysozyme also raises ethical issues and is not suitable for large-scale industrial applications. Another approach is to use recombinant DNA technology and prokaryotic or eukaryotic expression systems to achieve heterologous expression of recombinant lysozyme, which has been widely used for lysozyme expression. The yeast expression system has several advantages, including high expression levels, ease of fermentation, and low production costs. However, yeast-expressed lysozyme may not be equivalent to natural lysozyme, affecting its activity and stability. In addition, the yeast expression system may require additional processing steps to remove contaminants and improve the purity of the lysozyme. However, the expression of lysozyme in prokaryotes is less than ideal. Some researchers have used Escherichia coli to express lysozyme, but most of the expressed lysozymes are inclusion bodies with low lysozyme activity, and often require renaturation and other steps.
[0006] Therefore, there is a need to develop alternative expression systems to produce high-quality lysozyme. Summary of the Invention
[0007] The purpose of this section is to summarize some aspects of the embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the abstract and title of this application to avoid obscuring the purpose of this section, the abstract and the title of the invention, and such simplifications or omissions should not be used to limit the scope of the present invention.
[0008] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.
[0009] To solve the above technical problems, the present invention provides the following technical solutions: a Corynebacterium glutamicum that secretes and expresses lysozyme, comprising: the Corynebacterium glutamicum expresses a sequence that is a signal peptide region and a lysozyme sequence;
[0010] The lysozyme is a sequence shown in any one of SEQ ID NOs. 1 to 3, and the signal peptide region is a signal peptide encoded by a sequence shown in any one of SEQ ID NOs. 4 to 8.
[0011] As a preferred embodiment of the Corynebacterium glutamicum of the present invention, the pXMJ19 series plasmid is used as the expression vector.
[0012] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for constructing Corynebacterium glutamicum that secretes and expresses lysozyme.
[0013] As a preferred embodiment of the method of the present invention, the method comprises:
[0014] Construction of recombinant lysozyme vector pGX19-rlyz;
[0015] Plasmids were constructed after optimization of signal peptide, promoter and ribosome binding site (RBS) combination;
[0016] The constructed plasmid is electroporated into competent cells of Corynebacterium glutamicum to obtain recombinant Corynebacterium glutamicum;
[0017] Cultivation of recombinant Corynebacterium glutamicum.
[0018] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for increasing the expression level of lysozyme.
[0019] As a preferred embodiment of the method of the present invention, the method comprises:
[0020] Signal peptide screening, promoter and ribosome binding site RBS combination optimization, and overexpression delivery system.
[0021] As a preferred embodiment of the method of the present invention, the signal peptide is one of CspB, CspA, CgR0949, PorB, and CgR1514; the promoter is one of Pj2, Ptac, Pm1, and Pdap-e12; the ribosome binding site RBS is one of R760, A16, Y15, and H11; the promoter and the ribosome binding site RBS are combined and optimized to be any combination of Pj2, Ptac, Pm1, Pdap-e12 and R760, A16, Y15, and H11; and the overexpression transport system is the overexpression tatABC transport system.
[0022] Another object of the present invention is to overcome the deficiencies in the prior art and provide a method for producing lysozyme using Corynebacterium glutamicum.
[0023] As a preferred embodiment of the method of the present invention, the recombinant Corynebacterium glutamicum is inoculated into a fermentation medium and cultured for 24 to 30 hours.
[0024] As a preferred embodiment of the method of the present invention, the temperature at which the recombinant Corynebacterium glutamicum secretes and expresses lysozyme is 20-50° C., and the pH at which the recombinant Corynebacterium glutamicum secretes and expresses lysozyme is 7.5-11.
[0025] As a preferred embodiment of the method of the present invention, the Na ion concentration of the lysozyme secreted and expressed by the recombinant Corynebacterium glutamicum is 30-60 mM.
[0026] Another object of the present invention is to overcome the deficiencies in the prior art and provide an application of Corynebacterium glutamicum in increasing the expression of lysozyme.
[0027] Beneficial effects of the present invention:
[0028] 1. This study successfully achieved secretory expression of recombinant lysozyme in the prokaryotic organism C. glutamicum, demonstrating the necessity of signal peptide screening for target proteins.
[0029] 2. Through signal peptide screening, promoter and RBS combination optimization, and transport system overexpression, the present invention significantly increased the secretion of recombinant lysozyme. Compared with the initial strain, the yield increased by 8.3 times. In particular, the CgR0949 signal peptide of the Tat pathway significantly increased the secretion expression of recombinant lysozyme compared with other signal peptides.
[0030] 3. The present invention optimizes the combination of promoter and RBS to maximize the expression of recombinant lysozyme, and finally overexpresses the transport system to further enhance the secretion capacity of the cell, thus achieving the production and secretion of recombinant lysozyme using C. glutamicum as a cell factory;
[0031] 4. The lysozyme yield of C. glutamicum in the present invention reaches 0.2 g·L -1 , its secretion ability is strong and there are few extracellular impurities, which significantly reduces the purification cost. In the future, through cell wall membrane modification, the cell wall synthesis-related genes of C. glutamicum can be knocked out to enhance its secretion ability and tolerance to lysozyme, thereby further increasing the lysozyme production.
[0032] 5. The present invention confirms the potential of prokaryotic system in the efficient production of lysozyme and provides a new reference for the production method of lysozyme. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:
[0034] Figure 1 The lysozyme detection method and the expression of lysozyme from different sources in Example 1 of the present invention are shown; wherein, a is the correlation between fluorescence intensity and enzyme activity; b is the fluorescence change as the substrate and sample react over time; c is a schematic diagram of the construction of lysozyme plasmids from different sources; d is SDS-PAGE and Western blot analysis, A1-3 are rlyz fermentation broth supernatants, B1 is OElyz fermentation supernatant, C1 is T4lyz fermentation supernatant, D1 is the control group, A4, B2, C2, and D2 are rlyz, OElyz, T4lyz, and control group supernatants, respectively; e is a comparison of the extracellular activity of lysozymes from different sources.
[0035] Figure 2 The effects of different signal peptides on lysozyme expression in Example 5 of the present invention; wherein, a is a schematic diagram of various signal peptide plasmids of CspB, CspA, CgR0949, PorB, and CgR1514; b is the expression of various signal peptides, A, B, C, D, E, and F are the control group, CgR0949, PorB, CspA, CspB, and Cg1514, respectively; c is the extracellular enzyme activity of various signal peptides of CspB, CspA, CgR0949, PorB, and CgR1514.
[0036] Figure 3 The optimization of the promoter and RBS combination and the effect of overexpression of the tatABC transport system on protein secretion in Example 6 of the present invention are shown; wherein, a is a schematic diagram of the optimization of the promoter and RBS combination; b is the effect of the optimization of the promoter and RBS combination on the secretion amount of recombinant lysozyme; c is the SDS-PAGE of the BSA quantitative analysis of the extracellular enzymes of various signal peptides of CspB, CspA, CgR0949, PorB, and CgR1514 and the effect of overexpression of the tatABC transport system on protein secretion, A and G are strains after overexpression and without expression of the tatABC transport system, respectively, B, C, D, E, and F are the activities of different concentrations of BSA standards: 0.0625, 0.125, 0.25, 0.5, and 1 (mg / ml), respectively; d is the standard curve of BSA grayscale analysis.
[0037] Figure 4 These are the enzymatic properties of the recombinant lysozyme in Example 6 of the present invention; wherein a represents the effect of Na ion concentration on enzyme activity; b represents the effect of temperature on enzyme activity; and c represents the effect of pH value on enzyme activity.
[0038] Figure 5 This is the effect of different metal ions on enzyme activity in Example 7 of the present invention. DETAILED DESCRIPTION
[0039] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.
[0040] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0041] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.
[0042] The raw materials and reagents used in the present invention: yeast extract, peptone, and BHI were all OXOID, and other salt ion reagents were purchased from Sinopharm Reagents; gel recovery kit, plasmid extraction kit, and PCR high-fidelity enzyme were purchased from Nanjing Novozymes Biotechnology Co., Ltd., homologous recombination enzyme was purchased from Wuhan ABclonal Company, 6*his-tag antibody was purchased from Wuhan Sanying Biotechnology Co., Ltd., color development solution was purchased from Shanghai Tianneng Company, and lysozyme activity detection kit was purchased from Shanghai Tianneng Company. LysozymeAssay Kit (E-22013) was purchased from Thermo
[0043] The genes and primers used were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., and the Escherichia coli DH5α used for plasmid construction was purchased from Shanghai Bioengineering.
[0044] LBB medium (10 g / L sodium chloride, 10 g / L brain heart infusion, 10 g / L peptone, 5 g / L yeast extract); fermentation medium is BHN:BHI (BHI 37.5 g / L) medium supplemented with 10 g / L casein hydrolysate and 10 g / L soy peptone.
[0045] The method used in the present invention is:
[0046] Strain culture and competent culture preparation:
[0047] The culture temperatures for E. coli and C. glutamicum were 37°C and 30°C, respectively. The working concentrations of chloramphenicol were 30 μg / mL and 10 μg / mL, respectively. Normal culture conditions were: an initial inoculation OD600 of 0.2, and when the OD600 reached 1, IPTG was added at a final concentration of 1 mM for induction for 24 h. The rotation speed was 220 rpm / min, and BHN medium was used as the final fermentation medium.
[0048] Competent C. glutamicum was prepared by culturing in NCM medium. 5% inoculum of logarithmic phase cobs was added to NCM medium, cultured at 37°C for 5 h, ice-bathed for 15 min, centrifuged at 5000 rpm / min for 10 min, and washed three times by centrifugation with 10% glycerol that had been ice-bathed in advance. Finally, 90 μl of each tube was resuspended in 10% glycerol and aliquoted into 1.5 ml EP tubes.
[0049] Protein sample preparation and WB analysis:
[0050] After the fermentation of C. glutamicum, the supernatant was collected by centrifugation at 10,000 rpm / min for 10 minutes at 4°C. A portion was diluted with reaction buffer to an appropriate multiple for lysozyme activity detection, and the other portion was denatured and prepared for SDS-PAGE analysis. Ultrasonication was used to prepare intracellular samples: the collected bacteria were washed three times with PSB, finally resuspended in 2 ml of PBS, and ultrasonically disrupted for 8 minutes (25 power, disruption for 2 seconds, pause for 3 seconds). After disruption, the supernatant was centrifuged at 10,000 rpm for 1 minute. The supernatant was the intracellular soluble sample, and the precipitate was the inclusion body.
[0051] After protein electrophoresis, place the electrophoresis tank containing the protein gel and PVDF membrane on an ice water bath, with a constant current of 300 mA for 2 hours. After transfer, wash the PVDF membrane three times with TBST, add TBST containing 5% skim milk powder to block for 1 hour, replace the HRP-6his antibody solution and incubate for 1 hour, and finally wash three times with TBST, add ECL color development solution and use an imager to take pictures and analyze.
[0052] Purification of recombinant lysozyme and analysis of its enzymatic properties:
[0053] After fermentation, 100 ml of the fermentation supernatant was collected by centrifugation at 10,000 rpm for 30 minutes. The sample was filtered through a 0.45 μm filter and then purified using the AKAT system and a His-Tag nickel column. Solution A consisted of 20 mM PB, 10 mM imidazole, 0.5 M NaCl, pH 7.4, and solution B consisted of 20 mM PB, 500 mM imidazole, 0.5 M NaCl, pH 7.4, with an elution concentration of 300 mM imidazole. Finally, ultrafiltration was performed using 50 mM Tris-HCl buffer. The yield of recombinant lysozyme was determined using the BSA quantification method.
[0054] By adding different concentrations of Na ions to Tris-HCL buffer, the effects of different ion concentrations on the activity of recombinant lysozyme were detected; the purified protein was added to Tris-HCL buffer in advance and placed in a PCR instrument with the temperature set in advance to measure the effects on lysozyme activity at different temperatures; different pH buffers were prepared according to the effective pH range of the buffer, using 50mM PB buffer to prepare pH 5.5-7.5, 50mM Tris-HCL buffer to prepare pH 7-9, and 50mM Gly-NaOH buffer to prepare pH 9-11; different ions were added to Tris-HCL buffer to a final concentration of 50mM to explore the effects of different ions on the activity of recombinant lysozyme.
[0055] Unless otherwise specified, the reagents used in the present invention are commercially available.
[0056] Unless otherwise specified, these are conventional methods in the art.
[0057] The plasmids used in the present invention are shown in Table 1, and the primers used in the present invention are shown in Table 2.
[0058] Table 1
[0059]
[0060]
[0061] Table 2
[0062]
[0063]
[0064] Example 1
[0065] 1. High-throughput lysozyme detection method
[0066] The standard samples with different activities were reacted with the substrate at 37℃ for 1 hour. The fluorescence was measured by microplate reader under 485nm excitation and 530nm emission. It can be clearly observed that the fluorescence is proportional to the activity of lysozyme and the stability of the fluorescence generated by the sample increases with time ( Figure 1 ab), through this fluorescence and expression level coupling detection method, strains with high expression levels can be quickly screened through high-throughput screening.
[0067] 2. Construction of recombinant lysozyme vector pGX19-rlyz: The rlyz gene and the bicistronic pXMJ19 vector (obtained from NCBI (https: / / www.ncbi.nlm.nih.gov / )) were digested with HindIII and BamHI, respectively, and then ligated with T4 DNA ligase.
[0068] 3.3. Construction of pGX19-CspB-T4lyz and pGX19-CspB-OElyz: Using pGX19-rlyz as template, PCR amplification was performed using primers T4LYZ-SF and T4LYZ-SR, and primers OELYZ-SF and OELYZ-SR, respectively. The amplified ... Figure 1 c, wherein rlyz (nucleotide sequence as shown in SEQ ID NO.1) is a recombinant lysozyme of artificial predicted origin, T4lyz (nucleotide sequence as shown in SEQ ID NO.2) is a lysozyme derived from Escherichia coli phage, and OElyz (nucleotide sequence as shown in SEQ ID NO.3) is a lysozyme derived from invertebrates.
[0069] The above plasmids were sequenced and verified to be correct by Suzhou Jinweizhi Biotechnology Co., Ltd.
[0070] The reaction system for PCR amplification is shown in Table 3.
[0071] Table 3 PCR reaction system
[0072]
[0073] Example 2
[0074] This example provides the expression of lysozyme from different sources
[0075] 1. Expression of lysozymes from different sources
[0076] The pGX19-CspB-rlyz, pGX19-CspB-T4lyz, and pGX19-CspB-OElyz plasmids constructed in Example 1 were electroporated into C. glutamicum CGMCC1.15647, and fermented and centrifuged. The supernatant was collected for enzyme activity determination and Western blot analysis. Figure 1 As shown in d, recombinant lysozyme was expressed using C. glutamicum, which had fewer extracellular impurities and was beneficial for downstream purification.
[0077] The results are as follows Figure 1 d and Figure 1 e showed that only rlyz from the artificial predicted source number L070 was successfully secreted outside the cell, and its activity was successfully detected in the fermentation supernatant. Lysozymes from the other two sources were not successfully secreted outside the cell. From the SDS-PAGE diagram, it was observed that there was a large amount of accumulation inside the cell and in inclusion bodies. Therefore, rlyz that was successfully secreted and expressed was selected as the target protein for subsequent research. In addition, Figure 1 d It can be seen that when recombinant lysozyme is expressed using C. glutamicum, there are fewer extracellular impurities, which is beneficial for downstream purification.
[0078] Example 3
[0079] This example provides the screening of signal peptides,
[0080] Different signal peptides CspB, CspA, CgR0949, PorB, and CgR1514 of the commonly used Sec pathway and Tat pathway were selected. The specific experimental operations were: construction of pGX19-CgR0949-lyz, pGX19-porB-rlyz, pGX19-CgR1514-rlyz, and pGX19-CspA-rlyz: using pGX19-CspB-rlyz as a template, primers CSPA-F and CSPA-R, PORB-F and PORB-R, CGR0949-F and CGR0949-R, CGR1514-F and CGR1514-R were used for PCR amplification, and homologous recombination was carried out at 50°C for 1h to obtain vectors containing different signal peptides and express them.
[0081] The results are as follows Figure 2 It was shown that when the CgR0949 signal peptide of the Tat pathway was selected, the expression level of recombinant lysozyme increased by 2.4 times compared with the initial Sec pathway signal peptide CspB, while other signal peptides did not promote the secretion of recombinant lysozyme.
[0082] Example 4
[0083] This example provides the optimization of promoter and ribosome binding site RBS combination
[0084] Four promoters with different strengths (P j2 、P tac 、P m1 、P dap-e12 ) and four RBS with different strengths (R760, A16, Y15, H11) were combined for optimization. The optimization diagram is shown in Figure 3 As shown in a, the specific experimental operations are:
[0085] Construction of plasmids with optimized promoter and RBS combination: pGX19-CgR0949-lyz was used as template, and primers R760-F and RBS-R, A16-F and RBS-R, Y15-F and RBS-R, H11-F and RBS-R were used for PCR amplification. Homologous recombination was carried out at 50°C for 1 h to obtain the promoter tac; plasmids ptr-CgR0949-lyz, pta-CgR0949-lyz, pty-CgR0949-lyz, and pth-CgR0949-lyz with different ribosome binding site RBS were used as templates, and primers J2-F and J2-R, M1-F and M1-R, DAP-F and DAP-R were used for PCR amplification to obtain plasmids with different promoter and RBS combinations: pj r-CgR0949-lyz, pja-CgR0949-lyz, pjy-CgR0949-lyz, pjh-CgR0949-lyz, ptr-Cg R0949-lyz, pta-CgR0949-lyz, pty-CgR0949-lyz, pth-CgR0949-lyz, pmr-CgR094 9-lyz, pma-CgR0949-lyz, pmy-CgR0949-lyz, pmh-CgR0949-lyz, pdr-CgR0949-ly z, pda-CgR0949-lyz, pdy-CgR0949-lyz, pdh-CgR0949-lyz; promoter DEP-E12 nucleotide sequence such as SEQ ID NO.9, the promoter M1 nucleotide sequence is shown in SEQ ID NO.10, the promoter T7 nucleotide sequence is shown in SEQ ID NO.11, and the promoter J2 nucleotide sequence is shown in SEQ ID NO.12; the RBS Y15 nucleotide sequence is shown in SEQ ID NO.13, the RBS R760 nucleotide sequence is shown in SEQ ID NO.14, the RBS H11 nucleotide sequence is shown in SEQ ID NO.15, and the RBS A16 nucleotide sequence is shown in SEQ ID NO.16.
[0086] The results are as follows Figure 3bd showed that Pm1-Y15, Ptac-A16, Pm1-A16, and Pj2-A16 all had a positive effect on the secretion of recombinant lysozyme. When the promoter was PJ2 and the RBS was A16, the expression level of recombinant lysozyme increased by 2.3 times compared with the initial strain.
[0087] Example 5
[0088] This example provides a tatABC overexpression system
[0089] In Example 3, it was found that the CgR0949 signal peptide of the Tat pathway had a great positive effect on the secretion of recombinant protein. Therefore, the tatABC transport system was overexpressed to further enhance the host's secretion capacity and increase the secretion amount of recombinant lysozyme. The specific experimental operation was as follows: pja-CgR0949-lyz-tatABC plasmid construction: Using the Bacillus subtilis ATCC663 genome as a template, primers TATAC-SF and TATAC-SR, TATB-SF and TATB-SR were used for PCR amplification to obtain fragments tatAC and tatB, and plasmid pja-CgR0949-lyz was used as a template, and primers VF and VR were used for PCR amplification to obtain a plasmid vector. The three fragments were homologously recombined at 50°C for 1h to obtain the pja-CgR0949-lyz-tatABC plasmid.
[0090] SDS-PAGE results are as follows Figure 3 c shows that overexpression of the tatABC system significantly promotes the secretion of recombinant lysozyme. BSA quantitative analysis shows that the yield of the overexpression transport system increased by 1.5 times, and the shake flask yield can reach 0.2 g·L-1.
[0091] Example 6
[0092] This example explores the enzymatic properties of recombinant lysozyme
[0093] 1. Effect of Na ion concentration on recombinant lysozyme activity
[0094] The effects of different concentrations of Na ions on the activity of recombinant lysozyme were detected by adding different concentrations of Na ions into Tris-HCl buffer.
[0095] The results are as follows Figure 4 As shown in a, the lysozyme activity was the highest when the Na ion concentration was 50 mM. As the ion concentration increased, the activity of lysozyme decreased rapidly. Low concentration of Na ions promoted the activity of recombinant lysozyme, while high concentration had a significant inhibitory effect on the recombinant lysozyme.
[0096] 2 Effect of temperature on recombinant lysozyme activity
[0097] The purified protein was added to Tris-HCL buffer in advance and placed in a PCR instrument with a pre-set temperature to measure the effect of different temperatures on lysozyme activity.
[0098] The results are as follows Figure 4 As shown in Figure b, the recombinant lysozyme has the highest activity at a temperature of 35°C and has high thermal stability at temperatures of 20-50°C. It still retains 80% of the enzyme activity after treatment at this temperature for 1 hour. When the temperature is greater than 50°C, the enzyme activity is significantly lost. Therefore, the optimal temperature for recombinant lysozyme is 35°C.
[0099] 3. Effect of pH on recombinant lysozyme activity
[0100] Use 50mM PB buffer to prepare pH 5.5-7.5, use 50mM Tris-HCl buffer to prepare pH 7-9, and use 50mM Gly-NaOH buffer to prepare pH 9-11. Place the purified enzyme in buffers of different pH values to test the enzyme activity.
[0101] The results are as follows Figure 4 As shown in Figure c, the recombinant lysozyme has the highest activity at pH 7.5, and still retains 80% of the enzyme activity after treatment at pH 7.5-11 for 1 hour. When the pH is lower than 7.5, the enzyme activity is rapidly lost, indicating that the recombinant lysozyme has good stability in an alkaline environment. Therefore, the optimal pH value of the recombinant lysozyme is 7.5.
[0102] 4. Effects of different metal ions on the activity of recombinant lysozyme
[0103] 50 mM of different metal ions, including Cu, were added to Tris-HCl without adding additional ions. 2+ 、Fe 3+ 、Ni + 、Mn 2+ 、Co 2+ Mg 2+ , K + 、Na + 、Al 3+ , Ca 2+ .
[0104] The results are as follows Figure 5 As shown, K + and Na + It has an activating effect on recombinant lysozyme, among which K + The effect is most obvious, Mg 2+ and Ca 2+ It has little effect on the activity of recombinant lysozyme, while other ions have a significant inhibitory effect on recombinant lysozyme.
[0105] synthetic construct
[0106] Sequence Listing
[0107] SEQ ID NO.1
[0108] Artificial Sequence
[0109] ATGAACATCTTCGAAATGCTGCGCAACGATGAAGGCCTGCGCCTGACCCTGTACAAGGATACCGAAGGCTTCTGGACCATCGGCATCGGCCACCTGGTGACCAAGAACCCATCCCTGGCAGTGGCAAAGGCAGAACTGGATCGCATGATCGGCCGCAAGTGCAACGGCACCATCACCCTGGATGAAGCAGAAAAGCTGTTCAACGAAGATGTGGATAAGGCAGTGCGCGGCATCCTGGGCAACGCAAAGCTGAAGCCTGTGTACGATTCCCTGGATGCAGTGCGCCGCTGCGCACTGGTGAACATGGTGTTTCAGATGGGCGTGGCCGGCGTCGCCGGCTTTACCAACTCCCTGCGCATGCTGAAGCAGAAGCGCTGGGATGAAGCAGCAGTGAACCTGGCACAGTCCAAGTGGTACCGTCAGACCCCAAACCGCGCAAAGCGCGTGATCTCCACCTTCAAGACCGGCACCTGGAAGGCATACATCCACCATCACCATCACCACTAA
[0110] SEQ ID NO.2
[0111] ATGAACATCTTCGAAATGCTGCGCAACGATGAAGGCCTGCGCCTGACCCTGTACAAGGATACCGAAGGCTTCTGGACCATCGGCATCGGCCACCTGGTGACCAAGAACCCATCCCTGGCAGTGGCAAAGGCAGAACTGGATCGCATGATCGGCCGCAAGTGCAACGGCACCATCACCCTGGATGAAGCAGAAAAGCTGTTCAACGAAGATGTGGATAAGGCAGTGCGCGGCATCCTGGGCAACGCAAAGCTGAAGCCTGTGTACGATTCCCTGGATGCAGTGCGCCGCTGCGCACTGGTGAACATGGTGTTTCAGATGGGCGTGGCCGGCGTCGCCGGCTTTACCAACTCCCTGCGCATGCTGAAGCAGAAGCGCTGGGATGAAGCAGCAGTGAACCTGGCACAGTCCAAGTGGTACCGTCAGACCCCAAACCGCGCAAAGCGCGTGATCTCCACCTTCAAGACCGGCACCTGGAAGGCATACATCCACCATCACCATCACCACTAA
[0112] SEQ ID NO.3
[0113] ATGATGCAAATAAACCGCCGAGGCTTCTTAAAAGCCACCACAGGACTTGCCACTATCGGCGCTGCCAGCATGTTTATGCCAAAGGCCAACGCCCTTGGAGCAATGTCCGCAGTGCTGGTGCTGGCACTGGTGCTGCTGTCCCTGACCTGCGTGACCGATGCAATCTCCGATGCATGCCTGACCTGCATCTGCAAGCAAGAATCCTACGGCTGCACTCAGATCGGCTGCCGCATGGATGGCCGCTCCCTGTCCTGCGGCTACTTTCAGATCAAGAAGTCCTACTGGATCGATTGCGGCCGCCTGGGCTCCTCCTGGGAAGCATGCGCAGATGATTACAACTGCGCAGTGCGCTGCGTGCGCGCATACATGAAGAAGTACATCGGCAAGTCCGGCTGCACCGCAAACTGCAAGAACTACGCACGCCTGCACAACGGCGGCCCAAAGGGCTGCACCAAGCCATCCACCCTGACCTACTGGAACGCAGTGAAGAACCAAGGCTGCTCCATCAACTCCCACCATCACCATCACCACTAA
[0114] SEQ ID NO.4
[0115] ATGCGCGACACCGCATTTCGTTCCATCAAGGCTAAAGCTCAGGCTAAGCGCCGTTCCCTCTGGATTGCAGCAGGCGCTGTCCCAACCGCAATTGCGTTGACTATGTCCCTGGCACCTATGGCTTCGGCTCAGTCCAGCAAC
[0116] SEQ ID NO.5
[0117] ATGTTTAACAATCGTATCCGCACTGCAGCTCTCGCTGGTGCAATCGCAATCTCCACCGCAGCTTCCGGACTTGTTGTTCCAGCATTCGCTCAGGAA
[0118] SEQ ID NO.6
[0119] ATGAAGCTTTCACACCGCATCGCAGCAATGGCAGCAACCGCAGGCATCACAGTGGCAGCATTCGCAGCACCTGCTTCCGCA
[0120] SEQ ID NO.7
[0121] ATGCAAATCAACCGCCGCGGCTTTTTAAAGGCAACTGCTGGTTTAGCAACCATCGGCGCAGCATCCATGTTCATGCCAAAGGCCAACGCCCTTGGAGCA
[0122] SEQ ID NO.8
[0123] ATGTTAAACAGAGTCAGTCGTATTGCAGGCGCTTCTGCAATCACACTATGCATCGGCTTAACCACAATACTAAGCCCTACTTCCACTGCACAAAGCCTCGAACAG
[0124] SEQ ID NO.9
[0125] TTTTGACACCAAATGAGGGAATGTGGTAGAGTGGAACTC
[0126] SEQ ID NO.10
[0127] CGTGTGCTATAATGGGTGGAA
[0128] SEQ ID NO.11
[0129] GAGCTGTAATACGACTCACTATAGGTGTGGAA
[0130] SEQ ID NO.12
[0131] TGACATTTTTTTAGTTTTGAGTTACAATGGTTG
[0132] SEQ ID NO.13
[0133] CAATTTTCGTACTGAAACATCTTAATCATGCCGCCAAGGTTTCGTA
[0134] SEQ ID NO.14
[0135] CAATTTTCGTACTGAAACATCTTAATCATGCAAGTAATTCTTCCAAATCGAGAGGAGAAAAATTTTCGTA
[0136] SEQ ID NO.15
[0137] CAATTTTCGTACTGAAACATCTTAATCATGCAGAAAGGGTTTCTA
[0138] SEQ ID NO.16
[0139] CAATTTTCGTACTGAAACATCTTAATCATGCGAAAGGATTTCGCTA
[0140] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.
Claims
1. A Corynebacterium glutamicum that secretes and expresses lysozyme, characterized in that: The Corynebacterium glutamicum expresses a sequence that is a signal peptide region and a lysozyme; The lysozyme is a sequence shown in any one of SEQ ID NOs. 1 to 3, and the signal peptide region is a signal peptide encoded by a sequence shown in any one of SEQ ID NOs. 4 to 8.
2. The Corynebacterium glutamicum according to claim 1, wherein: The pXMJ19 series plasmids were used as expression vectors.
3. A method for constructing Corynebacterium glutamicum that secretes and expresses lysozyme, characterized in that: include, Construction of recombinant lysozyme vector pGX19-rlyz; Plasmids were constructed after optimization of signal peptide, promoter and ribosome binding site (RBS) combination; The constructed plasmid is electroporated into competent cells of Corynebacterium glutamicum to obtain recombinant Corynebacterium glutamicum; Cultivation of recombinant Corynebacterium glutamicum.
4. A method for increasing the expression level of lysozyme, characterized in that: include, Signal peptide screening, promoter and ribosome binding site RBS combination optimization, and overexpression delivery system.
5. The method according to any one of claims 1 or 4, characterized in that: The signal peptide is one of CspB, CspA, CgR0949, PorB, and CgR1514; the promoter is one of Pj2, Ptac, Pm1, and Pdap-e12; the ribosome binding site RBS is one of R760, A16, Y15, and H11; the promoter and the ribosome binding site RBS are combined and optimized to be any combination of Pj2, Ptac, Pm1, Pdap-e12 and R760, A16, Y15, and H11; and the overexpression transport system is an overexpression tatABC transport system.
6. A method for producing lysozyme using the Corynebacterium glutamicum according to any one of claims 1 or 4, characterized in that: The recombinant Corynebacterium glutamicum is inoculated into a fermentation medium and cultured for 24 to 30 hours.
7. The method according to claim 6, wherein: The fermentation medium includes BHI 37.5 g / L medium, 10 g / L casein hydrolyzate and 10 g / L soy peptone.
8. The method according to claim 6, wherein: The temperature at which the recombinant Corynebacterium glutamicum secretes and expresses lysozyme is 20-50° C., and the pH at which the recombinant Corynebacterium glutamicum secretes and expresses lysozyme is 7.5-11.
9. The method according to claim 8, wherein: The Na ion concentration of the recombinant Corynebacterium glutamicum secreting and expressing lysozyme is 30-60 mM.
10. Use of the Corynebacterium glutamicum according to claim 1 in increasing the expression level of lysozyme.