Method for improving yield of spermidine through integrated expression of S-adenosylmethionine decarboxylase at different spatial positions

Abstract

The invention provides a method for improving the yield of spermidine by integrating and expressing S-adenosylmethionine decarboxylase at different spatial positions, which comprises the following steps of: integrating an S-adenosylmethionine decarboxylase gene speD I39A / D22A at different positions on a genome of bacillus amyloliquefaciens HSPM1 in a homologous recombination manner; the engineering strain of the bacillus amyloliquefaciens HSPM1 integrated with speD I39A / D22A genes at different spatial positions is successfully constructed. Wherein the spermidine yield of the bacillus amyloliquefaciens HSPM1:: D-8 is increased most remarkably and reaches 155.00 mg / L. Compared with a host bacterium of the bacillus amyloliquefaciens HSPM1, the spermidine yield of the engineering bacterium HSPM1:: D-8 constructed by the invention is increased by 3.84 times.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a method for increasing the yield of spermidine by integrating and expressing S-adenosylmethionine decarboxylase at different spatial positions. Background Art

[0002] Spermidine is a typical aromatic polyamine and has important functions in human health and disease treatment. Spermidine has multiple biological activities such as inducing autophagy, delaying aging, improving memory, protecting cardiovascular system, regulating nerves, etc., and has good application potential in the prevention and treatment of cardiovascular diseases and Alzheimer's disease, and has potential application value in the fields of food additives, health products and medicine. However, spermidine functional foods are made from wheat germ powder and face problems such as difficult purification, low content, high price, etc. The biosynthesis method uses cheap carbon sources to synthesize spermidine, and has advantages such as being green, environmentally friendly, sustainable, simple operation process, easy separation and extraction of products, low cost, etc. compared with chemical synthesis methods and enzyme conversion methods. However, the traditional method uses key genes of the free expression pathway to promote the synthesis of spermidine, and often has problems such as poor genetic stability, easy loss of plasmids, antibiotic pollution, etc. Therefore, how to construct an efficient and stable spermidine cell factory is a key problem that needs to be solved urgently.

[0003] Compared with the free expression mode, regulating the expression of related genes through the genome is beneficial in terms of stability, genetic regulation and metabolic burden. Therefore, integrating the key genes for synthesizing spermidine into the genome of industrial chassis cells for expression is the key means to solve the above problems. However, how to select efficient integration sites is a key problem that needs to be solved urgently. Based on this, the present invention first discovers that integrating the S-adenosylmethionine decarboxylase gene speD I39A / D22A into different spatial positions of Bacillus amyloliquefaciens results in significant differences in spermidine production; among them, the spermidine production of Bacillus amyloliquefaciens HSPM1::D-8 (site 8) is increased most significantly, reaching 155.00 mg / L. Compared with the Bacillus amyloliquefaciens HSPM1 host strain, the present invention integrates the speD I39A / D22A gene into the host strain Bacillus amyloliquefaciens HSPM1, and the spermidine production of the engineered strain HSPM1::D-8 obtained is increased by 3.84 times. The present invention provides a new strategy for the stable expression of high-spermidine-producing engineered strains. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for increasing the yield of spermidine by integrating and expressing S-adenosylmethionine decarboxylase at different spatial positions, and respectively integrating speD at different spatial positions of Bacillus amyloliquefaciens HSPM1 through homologous recombination technology I39A / D22AGenes were used to compare the effects of different integration sites on the production of spermidine, and thus an engineered Bacillus amyloliquefaciens strain with high spermidine production was obtained.

[0005] To achieve the above object, the present invention adopts the following technical measures:

[0006] An engineered Bacillus amyloliquefaciens strain with high spermidine production, wherein the engineered strain is obtained by integrating and expressing the gene speD in Bacillus amyloliquefaciens HSPM1 through homologous recombination I39A / D22A , and the gene speD I39A / D22A has a nucleotide sequence as shown in SEQ ID NO.1, and the sequences of the upstream homologous arm and the downstream homologous arm of the integration site of the gene speD I39A / D22A are as shown in SEQ ID NO.2 and 3. The specific construction method is as follows:

[0007] 1) Using the genomic DNA of Bacillus amyloliquefaciens HSPM1 as a template, PCR amplifying the upstream homologous arm and the downstream homologous arm of the integration site, the sequences of which are as shown in SEQ ID NO.2 and 3;

[0008] Preferably, the primer sequences of the upstream homologous arm are as shown in SEQ ID NO.8 and 9, and the primer sequences of the downstream homologous arm are as shown in SEQ ID NO.10 and 11;

[0009] 2) Connecting the upstream homologous arm of the integration site, the Veg promoter, the gene speD I39A / D22A , the terminator Tamly and the downstream homologous arm together by overlapping extension PCR to form a fusion fragment;

[0010] 3) Using XbaI and BamHI restriction endonucleases to perform double digestion on the fusion fragment and the plasmid T2(2)-ori to obtain a digested gene fragment and a linear plasmid fragment, and then connecting them with a DNA ligase to obtain a knockout plasmid T2(2)-speD I39A / D22A ; transferring the integration plasmid T2(2)-speD I39A / D22A into Bacillus amyloliquefaciens HSPM1, using kanamycin as a screening marker to screen positive transformants;

[0011] 4) After subculturing the positive transformants several times on a medium containing kanamycin at 45°C, performing colony PCR detection to obtain a positive single crossover conjugate strain in which the upstream homologous arm or the downstream homologous arm of the integration site and the genomic DNA of Bacillus amyloliquefaciens HSPM1 have a complete single crossover;

[0012] 5) Select positive single crossover conjugant strains and inoculate them on a medium without kanamycin at 37°C. After several subcultures, double crossover successful integration of the speD gene was obtained by colony PCR screening. I39A / D22A The obtained Bacillus amyloliquefaciens with the integrated speD gene was named HSPM1::D-8.

[0013] Application of the engineered Bacillus amyloliquefaciens HSPM1::D-8 prepared by the above method in improving the production of spermidine: Ferment the engineered strains HSPM1::D-2, HSPM1::D-5, HSPM1::D-8 constructed at different integration sites and the starting strain HSPM1, and measure the spermidine production. The results show that the spermidine production of the engineered Bacillus amyloliquefaciens HSPM1::D-8 is 3.84 times higher than that of the starting strain HSPM1.

[0014] The present invention first attempts to insert the speD gene at different integration sites of Bacillus amyloliquefaciens. I39A / D22A Compared with the starting strain, there are significant differences in the production of spermidine after integrating and expressing the speD gene at different positions. I39A / D22A Among them, the production of Bacillus amyloliquefaciens HSPM1::D-8 is the highest, reaching 155.00 mg / L, providing a new strategy for the excavation of high-efficiency integration sites of spermidine and the improvement of production.

[0015] Compared with the prior art, the present invention has the following advantages and effects:

[0016] 1. The present invention first discovers that inserting the speD gene at different integration sites of the Bacillus amyloliquefaciens genome results in significant differences in the production of spermidine, providing a new strategy for the excavation of high-efficiency integration sites of spermidine. I39A / D22A 2. The production of spermidine by the constructed Bacillus amyloliquefaciens HSPM1::D-8 of the present invention reaches 155.00 mg / L, which is 3.84 times higher than that of the original Bacillus amyloliquefaciens HSPM1.

[0017] 2. The production of spermidine by the constructed Bacillus amyloliquefaciens HSPM1::D-8 of the present invention reaches 155.00 mg / L, which is 3.84 times higher than that of the original Bacillus amyloliquefaciens HSPM1. Description of the drawings

[0018] Figure 1 Effect of integrating the speD gene at different spatial sites of Bacillus amyloliquefaciens HSPM1 on the production of spermidine. I39A / D22A Detailed implementation manners

[0019] For the molecular biology experimental methods without specific conditions in the following examples, all are carried out according to conventional conditions, referring to "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor).

[0020] Description of biological materials:​

[0021] Bacillus amyloliquefaciens HSPM1 and expression vector PBspeD belong to publicly disclosed biomaterials. Bacillus amyloliquefaciens HSPM1 has been disclosed in the article (Functional identification of the speE gene in spermidine synthesis in Bacillus amyloliquefaciens [J]. Food and Fermentation Industries, 2020, 46(7): 6.). The expression vector PBspeD was constructed by inserting the P43 promoter, speD gene, and TamyL terminator into the BamHI and XbaI restriction enzyme cleavage sites of plasmid pHY300PLK. The specific construction method can be referred to the article "Biosynthesis of a Novel Bioactive Metabolite of Spermidine from Bacillus amyloliquefaciens: Gene Mining, Sequence Analysis, and Combined Expression". The above-mentioned biomaterials are currently stored in the Microbial Engineering Laboratory of Huazhong Agricultural University.

[0022] Example 1: Construction of free expression vector PBspeD I39A / D22A Construction

[0023] According to the sequence of the expression vector PBspeD, primer sequences for site-directed mutagenesis D22A were designed. First, using the genomic DNA of Bacillus amyloliquefaciens HSPM1 as a template, the Veg promoter was amplified with primers Veg-F (BamHI) and Veg-R. Subsequently, using the vector PBspeD as a template, fragment A was amplified with primers SpeD-AF and SpeD D22A -AR, fragment B was amplified with primers SpeD D22A -BF and SpeD-BR (XbaI), and the fusion fragment Veg+A+B was obtained by SOE-PCR (overlap extension PCR) with primers Veg-F (BamHI) and SpeD-BR (XbaI).

[0024] The fusion fragment Veg+A+B and plasmid pHY300PLK were double-digested with BamHI and XbaI restriction endonucleases to obtain digested gene fragments and linear plasmid fragments. The digested gene fragments and linear plasmid fragments were ligated with T4 DNA ligase to obtain a ligation product. The ligation product was transformed into Escherichia coli DH5α by the calcium chloride transformation method and screened on an LB medium (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.2) containing tetracycline (20 μg / mL) resistance at 37°C. The transformants were obtained, and the transformants were verified by colony PCR and plasmid PCR (the primers used were: pHY300-F and pHY300-R) to obtain the free expression vector PBspeDD22A . On this basis, using PBspeD D22A as a template, the same method is used to amplify fragments C and D with two pairs of primers SpeD-AF, speD I39A / D22A -AR and SpeD I39A / D22A -BF, SpeD-BR(XbaI). The fusion fragment C+D is obtained by SOE-PCR, and the free expression plasmid PBspeD I39A / D22A is obtained by the same method of restriction enzyme digestion and ligation as above. The nucleotide sequence of the gene speD I39A / D22A is shown in SEQ ID NO.1.

[0025] The primer sequences are as follows:

[0026] Veg-F(BamHI): CGGGATCCCAGTTGAAAACCTGCATAGGAGAG;

[0027] Veg-R: CATTGCAGTTTCAGTTTTTTCAATGCATCCACCTCACTACATTTA TTG;

[0028] SpeDAF: CAATAAATGTAGTGAGGTGGATGTTGAAAAAACTGAAACTG CAATG;

[0029] SpeD D22A -AR: GCAGTTTTGGCGTAGCAGATAGCGTAAATACAAAAACTC AGACTTTTGG;

[0030] SpeD D22A -BF: CCAAAAGTCTGAGTTTTTGTATTTACGCTATCTGCTACGC CAAAACTGC;

[0031] SpeD-BR(XbaI): GCTCTAGACGCAATAATGCCGTCGCA;

[0032] pHY300-F: GTTTATTATCCATACCCTTAC;

[0033] pHY300-R: CAGATTTCGTGATGCTTGTC;

[0034] SpeD I39A / D22A -AR: GGTTGGCATTATAGAGTTCATCGGCATAAGCAATATAA CCGTCGCG;

[0035] SpeDI39A / D22A -BF: CGCGACGGTTATATTGCTTATGCCGATGAACTCTATAA TGCCAACC。

[0036] Example 2: Integrating gene speD at different sites I39A / D22A Construction of engineering bacteria

[0037] 1. Construction of a temperature-sensitive knockout vector

[0038] According to the gene sequence of integration site 8 in the genome DNA of Bacillus amyloliquefaciens HSPM1, upstream homologous arm primers (T2::D(site8)-AF, T2::D(site8)-AR) were designed to amplify the promoter Veg, speD I39A / D22A and terminator TamyL primers (T2::D(site8)-BF, T2::D(site8)-BR) and downstream homologous arm primers (T2::D(site8)-CF, T2::D(site8)-CR); and using the genomic DNA of Bacillus amyloliquefaciens HSPM1 and the free expression plasmid PBspeD[[ID=1?]] I39A / D22A gene as templates for PCR amplification to obtain upstream homologous arm fragments, fragments carrying the promoter Veg, speD I39A / D22A and terminator TamyL fragments and downstream homologous arm fragments. The primer sequences are as follows:

[0039] T2::D(site8)-AF: TCCTGCAGCCCGGGGGATCCCAGTTGAAAACCTGCATAGGAGAG (containing BamHI restriction site);

[0040] T2::D(site8)-AR: CTATTTCGAGAGGCCGTTTTTTGCTCACTTCATTAAAAAAATCCATATC;

[0041] T2::D(site8)BF: GATATGGATTTTTTTAATGAAGTGAGCAAAAAACGGCCTCTCGAAATAG;

[0042] T2::D(site8)-BR: AAGAAAGATATCTAGTTTCTGTTATTCCGCGCAATAATGCCGTCGCA;

[0043] T2::D(site8)-CF: TGCGACGGCATTATTGCGCGGAATAACAGAAACTAGATATCTTTCTT;

[0044] T2::D(site8)-CR: GCGGTGGCGGCCGCTCTAGATAGAAATTGATAAATCCTGGTCGTACA (containing XbaI restriction site).

[0045] The upstream homologous arm gene fragment was obtained by PCR amplification using primer pairs T2::D(site8)-AF and T2::D(site8)-AR. The sequence is shown in SEQ ID NO.2. The gene fragment carrying promoter Veg, speD I39A / D22A and terminator TamyL was obtained by PCR amplification using primer pairs T2::D(site8)-BF and T2::D(site8)-BR. The downstream homologous arm gene fragment was obtained by PCR amplification using primer pairs T2::D(site8)-CF and T2::D(site8)-CR. The sequence is shown in SEQ ID NO.3. The upstream homologous arm, Veg promoter, speD I39A / D22A gene, terminator Tamly and downstream homologous arm were ligated together by overlapping extension PCR to form a fusion fragment.

[0046] The fusion fragment and plasmid T2(2)-ori were double digested with restriction enzymes XbaI and BamHI to obtain digested gene fragments and linear plasmid fragments. The digested gene fragments and linear plasmid fragments were ligated with T4 DNA ligase to obtain a ligation product. The ligation product was transformed into Escherichia coli DH5α by calcium chloride transformation method and screened on LB medium (peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.2) containing kanamycin (20 μg / mL) resistance at 37°C. The transformants were obtained and verified by colony PCR and plasmid PCR (the primers used were: T2-F and T2-R) to obtain the gene integration vector T2(2)-speD I39A / D22A (site8).

[0047] Among them, the sequences of T2-F and T2-R are:

[0048] T2-F: ATGTGATAACTCGGCGTA

[0049] T2-R: GCAAGCAGCAGATTACGC.

[0050] 2. Construction of Bacillus amyloliquefaciens engineering strain HSPM1::D-8

[0051] The integration vector T2(2)-speD corresponding to integration site 8 I39A / D22A(site8) was transferred into Bacillus amyloliquefaciens HSPM1 and screened on a medium containing kanamycin (20 μg / mL) resistance at 37 °C. The transformants were obtained and verified by colony PCR (the primers used were: T2-F1 and T2-R1), and positive transformants were obtained, that is, the integration vector T2(2)-speD was transferred in. I39A / D22A (site8) of Bacillus amyloliquefaciens HSPM1.

[0052] Among them, the sequences of T2-F1 and T2-R1 are:

[0053] T2-F1: ATGTGATAACTCGGCGTATGT

[0054] T2-R1: TTGAAGTGGTGGCCTAACTAC.

[0055] The positive transformants were subcultured 3 times on a medium containing kanamycin resistance at 45 °C, each time for 12 h, and colony PCR was performed with T2-F and T2::D(site8)-CR as primers (or with T2-R and T2::D(site8)-AF as primers) to detect single-exchange strains, and single-exchange strains were obtained.

[0056] The single-exchange strains were inoculated and cultured, and after several subcultures in a medium without kanamycin at 37 °C, the transformants were picked and verified by colony PCR (the primers were T2::D(site8)-AF and T2::D(site8)-CR), and single colonies with the correct band size were picked out. Subsequently, DNA sequencing was performed on the positive transformants for further verification, and the successfully double-exchanged speD I39A / D22A integration strain was named Bacillus amyloliquefaciens HSPM1::D-8.

[0057] 3. speD at other sites I39A / D22A Construction of genetically engineered bacteria with gene integration

[0058] speD at other different spatial positions I39A / D22A The construction methods of genetically engineered bacteria HSPM1::D-2 (site 2) and HSPM1::D-5 (site 5) were the same as above.

[0059] Among them, the upstream and downstream homologous arm sequences of HSPM1::D-2 are shown in SEQ ID NO.4 and SEQ ID NO.5, and the amplification primers used are as follows:

[0060] T2::D(site2)-AF: TCCTGCAGCCCGGGGGATCCCACGGGGAAAGCGGATTAT;

[0061] T2::D(site2)-AR: TCTATTTCGAGAGGCCGTTTTTTAAAACTCTCTCCTTCAATTTACATCTGTT;

[0062] T2::D(site2)-BF: AACAGATGTAAATTGAAGGAGAGAGTTTTAAAAAACGGCCTCTCGAAATAGA;

[0063] T2::D(site2)-BR: GTACCGCACCTTTTCCATCAGCGCAATAATGCCGTCGCA;

[0064] T2::D(site2)-CF: TGCGACGGCATTATTGCGCTGATGGAAAAGGTGCGGTAC;

[0065] T2::D(site2)-CR: GCGGTGGCGGCCGCTCTAGAGGATACACGCACACCGCTTT.

[0066] The upstream and downstream homologous arm sequences of HSPM1::D-5 are shown in SEQ ID NO.6 and SEQ ID NO.7, and the amplification primers used are as follows:

[0067] T2::D(site5)-AF: TCCTGCAGCCCGGGGGATCCACAAACCTGAGCCTCTA CGAAGTG;

[0068] T2::D(site5)-AR: CTATTTCGAGAGGCCGTTTTTTTCGTATCCCCCCTTATT TGGTAAC;

[0069] T2::D(site5)-BF: GTTACCAAATAAGGGGGGATACGAAAAAAACGGCCTC TCGAAATAG;

[0070] T2::D(site5)-BR: GACGGCATTTGCTCCAGTGTAACGCAATAATGCCGTCG CA;

[0071] T2::D(site5)-CF: TGCGACGGCATTATTGCGTTACACTGGAGCAAATGCCG TC;

[0072] T2::D(site5)-CR:GCGGTGGCGGCCGCTCTAGAAGATAAAAATCCTTTCC GACCGC.

[0073] Example 3: Integration of speD at different spatial locations I39A / D22A Effects of genes on spermidine production

[0074] The fermentation seeds were inoculated with LB liquid medium (50 mL in a 250 mL Erlenmeyer flask) and cultured at 140 r / min and 37°C for 8-12 h. 600 When the pH reaches 3.5-4.0, the mixture was inoculated into the fermentation medium (50 mL in a 250 mL Erlenmeyer flask) at a 3% inoculum volume and cultured at 37°C and 180 r / min for 72 h.

[0075] Fermentation medium: xylose 20 g / L, (NH4)2SO4 6.3 g / L, peptone 10 g / L, corn steep liquor 20 g / L, NaCl 2.5 g / L, KH2PO4 3.0 g / L, MgSO4·7H2O 4.2 g / L, urea 2 g / L, aspartic acid 3 g / L, pH adjusted to 6.5 with aqueous ammonia.

[0076] Detection Method and Reagents: Add 1.5 mL of 0.4 mol / L perchloric acid to 0.5 mL of fermentation broth. Vortex the mixture every 15 minutes (repeat four times per hour), then centrifuge at 12,000 rpm for 5 minutes. Transfer 250 μL of the supernatant to a 2 mL collection tube as the derivatization sample. Add 100 μL of 1,7-diaminoheptane (1 mg / mL), 75 μL of saturated NaHCO₃ solution, 50 μL of 2 mol / L NaOH solution, and 500 μL of dansyl chloride (5 mg / mL acetone) as the derivatization reagent, inverting the tube to mix thoroughly. Incubate the tube in a 50°C waterbath, protected from light, for 45 minutes, shaking the tube every 15 minutes. At the 45-minute mark, add 25 μL of 25% aqueous ammonia and invert the tube to mix thoroughly. Continue in a 50°C waterbath, protected from light, and let stand for 15 minutes. 30 μL of 6 mol / L HCl was added to adjust the pH to neutral, 575 μL of acetonitrile was added and shaken upside down for 1 min, and centrifuged at 10,000 rpm for 5 min. 800 μL of the supernatant was filtered through a 0.22 μm organic membrane and then measured.

[0077] An Agilent 1100 HPLC chromatograph was used, with a ZORBAX Eclipse XDB-C18 (4.6 mm × 250 mm, 5 μm) chromatographic column. The mobile phase was gradient eluted with ultrapure water and acetonitrile at a flow rate of 1 mL / min, a detection wavelength of 254 nm, a column temperature of 30 °C, and an injection volume of 10 μL. The content of spermidine was judged according to the peak emergence time and peak area: among them, from 0 to 3 min, 50% ultrapure water and 50% acetonitrile; from 3 to 20 min, 10% ultrapure water and 90% acetonitrile; from 20 to 30 min, 50% ultrapure water and 50% acetonitrile.

[0078] The detection results are as Figure 1 shown. The integrated expression of the speD I39A / D22A gene at 3 integration sites could significantly increase the yield of spermidine. The yield of spermidine in the integrated strains was 83.30 - 155.00 mg / L. Among them, the yield of spermidine in the engineered strain HSPM1::D-8 increased most significantly, reaching 155.00 mg / L, which was 3.84 times higher than that of the starting strain.

Claims

1. An engineered strain of Bacillus amyloliquefaciens that produces high levels of spermidine, characterized in that: The engineered bacteria are generated by homologous recombination in Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) HSPM1 integrated expression gene speD I39A / D22A , the gene speD I39A / D22A The nucleotide sequence of the gene is shown in SEQ ID NO.

1. speD I39A / D22A The sequences of the upstream homology arm and the downstream homology arm of the integration site are shown in SEQ ID NOs. 2 and 3.

2. The method for constructing the Bacillus amyloliquefaciens engineered bacteria according to claim 1, wherein: The following steps are involved: (1) Using the genomic DNA of Bacillus amyloliquefaciens HSPM1 as a template, PCR amplified the upstream homology arm sequence SEQ ID NO.2 and the downstream homology arm sequence SEQ ID NO.3 of the integration site; (2) By overlapping extension PCR, the upstream homology arm, Veg promoter, speD I39A / D22A The gene, terminator TamyL, and downstream homology arms were connected together to form a fusion fragment; (3) Adoption Xba I and Bam The fusion fragment and plasmid T2(2)-ori were double-digested by HI restriction endonuclease to obtain the digested gene fragment and the linear plasmid fragment, which were then connected by DNA ligase to obtain the integrated plasmid T2(2)- speD I39A / D22A ; Integrate plasmid T2(2)- speD I39A / D22A The strain was transformed into Bacillus amyloliquefaciens HSPM1, and kanamycin was used as a selection marker to screen for positive transformants. (4) After the positive transformants were transferred and cultured for several generations on a medium containing kanamycin at 45°C, colony PCR detection was performed to obtain a positive single-crossover conjugant strain in which the upstream homology arm or the downstream homology arm produced a single crossover with the genomic DNA of Bacillus amyloliquefaciens HSPM1; (5) Select the positive single-crossover conjugant strain and inoculate it on a culture medium without kanamycin at 37°C for several generations. The successful integration of double crossover is obtained by colony PCR screening. speD I39A / D22A genes of Bacillus amyloliquefaciens.

3. The method according to claim 2, characterized in that The primer sequences of the upstream homology arms in step (1) are shown in SEQ ID NOs. 8 and 9, and the primer sequences of the downstream homology arms are shown in SEQ ID NOs. 10 and 11.

4. Use of the engineered Bacillus amyloliquefaciens strain according to claim 1 in the production of spermidine.

5. The use according to claim 4, characterized in that The fermentation medium of Bacillus amyloliquefaciens contains xylose, (NH4)2SO4, peptone, corn steep liquor, NaCl, KH2PO4, MgSO4·7H2O, urea and aspartic acid.

Images