Antisense oligonucleotide and application thereof in ovarian cancer treatment

Abstract

The invention discloses antisense oligonucleotide and application thereof in ovarian cancer treatment, and belongs to the technical field of ovarian cancer gene therapy. The antisense oligonucleotide has a nucleotide sequence as shown in SEQ ID NO. 1 (sequence identifier number 1). An in-vitro experiment result shows that the compound can retard a cell cycle and induce cell apoptosis in a human ovarian cancer cell line. When being combined with a PARP inhibitor olaparide, the compound shows a remarkable synergistic anti-tumor effect, so that the compound has the potential of overcoming the drug resistance problem of the PARP inhibitor. In a C57BL / 6 mouse subcutaneous transplantation tumor model, injection of ASO1 in the tumor can significantly slow down tumor growth and reduce tumor volume. The invention provides a scheme with a brand-new action mechanism for ovarian cancer treatment, and particularly shows an important clinical value for platinum drug-resistant or recurrent ovarian cancer patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of ovarian cancer gene therapy, and particularly relates to an antisense oligonucleotide and its application in the treatment of ovarian cancer. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.

[0003] Ovarian cancer is one of the gynecological malignancies with the highest mortality rate, and its clinical treatment faces severe challenges. The current standard treatment regimen is mainly tumor cell reduction surgery combined with platinum-based chemotherapy, but clinical observations show that 44% of patients experience recurrence and metastasis after initial treatment. Although the advent of PARP inhibitors (PARPi) has significantly improved the progression-free survival (PFS) of patients with BRCA1 / 2 mutant ovarian cancer, especially as a maintenance therapy in platinum-sensitive recurrent serous ovarian cancer, the problem of acquired drug resistance caused by long-term use is becoming increasingly prominent, and some cases even have cross-resistance to chemotherapy drugs such as cisplatin. This situation highlights the urgent need to develop new treatment strategies.

[0004] Recent studies have shown that abnormal post-transcriptional gene regulation plays a crucial role in tumor development and progression. RNA splicing, a key mechanism of post-transcriptional gene regulation, is involved in the maturation of approximately 95% of human multi-exon genes. Clinical cohort studies have revealed that splicing events are 30% more frequent in tumor tissue than in normal tissue. In ovarian cancer, aberrant expression of splicing factors such as BUD31 and PQBP1 has been shown to induce aberrant splicing of key genes such as BCL2L12 and BAX, thereby promoting tumor progression by regulating apoptosis pathways. This suggests that targeting RNA splicing regulatory networks may provide new avenues for ovarian cancer treatment.

[0005] Cyclin-dependent kinase 2 (CDK2) has attracted considerable attention as a potential target for cancer therapy. While it is believed to play a key role in cell cycle regulation, genetic knockout models have shown that CDK2-deficient mice are viable, providing a theoretical basis for the development of highly safe CDK2-targeted drugs. Following the successful use of CDK4 / 6 inhibitors in the treatment of advanced breast cancer, drug development targeting CDK2 has entered the clinical translation phase, with several CDK2 small molecule inhibitors currently in clinical trials.

[0006] It is noteworthy that RNA therapeutics are leading the third pharmaceutical revolution, following small molecule drugs and antibody drugs. Among them, antisense oligonucleotides (ASOs), as the most mature technology platform, have been clinically applied through two main mechanisms: RNAase H-mediated mRNA degradation, and regulation of pre-mRNA alternative splicing. The FDA has approved several ASO drugs based on splicing regulation mechanisms, providing an important technical path for the development of new treatments for ovarian cancer. However, there are currently no ASO drugs that treat ovarian cancer by regulating CDK2. Summary of the Invention

[0007] To address the deficiencies of the prior art, the present invention provides an antisense oligonucleotide and its use in the treatment of ovarian cancer. The antisense oligonucleotide (ASO) provided by the present invention can target and regulate CDK2 gene expression, specifically binding to alternative splicing regulatory elements of CDK2 pre-mRNA to correct abnormal splicing of the gene. The antisense oligonucleotide provided by the present invention can downregulate CDK2 expression, thereby activating the apoptosis pathway, and can be used as an apoptosis inducer and a potential drug for the treatment of ovarian cancer.

[0008] In order to achieve the above object, the technical solution of the present invention is:

[0009] The first aspect of the present invention provides an antisense oligonucleotide, wherein the antisense oligonucleotide:

[0010] (I) having the nucleotide sequence shown in SEQ ID NO.1; or

[0011] (II) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences of the nucleotide sequence shown in (I), and having the same or similar function as the nucleotide sequence shown in (I); or

[0012] (III) A nucleotide sequence having at least 80% nucleotide identity with the nucleotide sequence shown in (I) or (II).

[0013] In some embodiments of the present invention, the antisense oligonucleotide has a nucleotide sequence that is 85%, 90%, 95%, 96%, 97%, 98% or more identical to the nucleotide sequence shown in (I) or (II).

[0014] In some embodiments of the present invention, the antisense oligonucleotide further has a chemical modification.

[0015] In some embodiments of the present invention, the chemical modification is a phosphorothioate backbone modification.

[0016] The second aspect of the present invention provides the use of a therapeutically effective amount of an antisense oligonucleotide or a composition thereof in the preparation of a medicament for treating ovarian cancer;

[0017] The antisense oligonucleotide is the antisense oligonucleotide mentioned above.

[0018] In some embodiments of the present invention, the composition comprises at least one additional active agent that is a biologic.

[0019] In some embodiments of the present invention, the biologic is a PARP inhibitor.

[0020] In some embodiments of the invention, the active agent is Olaparib.

[0021] The third aspect of the present invention provides a pharmaceutical composition for treating ovarian cancer, wherein the pharmaceutical composition comprises the above-mentioned antisense oligonucleotide.

[0022] In some embodiments of the present invention, the pharmaceutical composition further comprises Olaparib.

[0023] The beneficial effects of the present invention are:

[0024] Based on analysis of the TCGA and GTEx databases, this study discovered that ovarian cancer has a different CDK2 splicing pattern and higher CDK2 levels than normal tissue, potentially providing a new marker for early molecular typing of ovarian cancer. To this end, the present invention provides an antisense oligonucleotide targeting CDK2 alternative splicing and demonstrates in vitro that this antisense oligonucleotide can induce apoptosis in ovarian cancer cells, opening up a new path for precision medicine treatment of ovarian cancer.

[0025] The present invention also proves through experiments that the combination of the antisense oligonucleotide targeting CDK2 variable splicing and the PARP inhibitor Olaparib has a synergistic effect in inducing apoptosis of ovarian cancer cells, providing a treatment plan with a new mechanism of action for the treatment of ovarian cancer, especially showing important clinical value for patients with platinum-resistant or recurrent ovarian cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0027] Figure 1: This is a correlation diagram of the expression and splicing characteristics of CDK2 in ovarian cancer in Example 1 of the present invention; wherein A is the RNA expression of CDK2 in various types of tumors; B is the RNA expression of CDK2 in 418 ovarian cancer samples in the TCGA database and 88 normal ovarian tissues in the GTEx database; C is the protein level and Thr160 phosphorylation level of CDK2 in ovarian cancer samples and normal ovarian tissues in the CPTAC database; D is the expression ratio of the two main transcripts of CDK2 in ovarian cancer and normal tissues in the UCSC database; E is the visualization result of CDK2 splicing pattern in ovarian cancer and normal tissues in IGV by RNA-seq analysis; F is the correlation analysis of CDK2 expression level and intron 1 retention rate in 374 ovarian cancer samples in the TCGA database;

[0028] Figure 2 Figure 2 is a graph showing that the ASO targeting CDK2 in Example 2 of the present invention can promote the retention of CDK2 intron 1 and downregulate the expression of CDK2; wherein, A is a schematic diagram of the ASO design site; B is the change in fluorescence intensity over time in ovarian cancer cells after transfection of a fluorescently labeled ASO (ASO-FAM); C is an immunofluorescence image of ovarian cancer cells 48 hours after transfection with ASO-FAM; D is RT-qPCR verification of ASO's regulation of CDK2 alternative splicing and expression; E is semi-quantitative PCR verification of ASO1's regulation of CDK2 alternative splicing; F is an RNA stability experiment, demonstrating that CDK2 intron 1 retention transcripts are degraded by the NMD pathway; G is a Western blot verification of the downregulation efficiency of four ASOs on CDK2 protein levels; H is a Western blot verification of the efficiency of different concentrations of ASO1 in downregulating CDK2 protein expression;

[0029] Figure 3 Figure 3 is a graph showing the inhibition of ovarian cancer cell proliferation by the antisense oligonucleotide ASO1 in Example 3 of the present invention; wherein, A is the cell viability detected by the MTT assay and the half-inhibitory concentration (IC50) of ASO1 in two ovarian cancer cell lines, HEYA8 and OVCAR3; B is the IC50 statistics of ASO1 in human fibroblasts, human fallopian tube fimbriae epithelial cells and different ovarian cancer cell lines; C is the results of the clone formation experiment of HEYA8 and A2780 cell lines; D is the statistical result of the number of clones formed in Figure C; E is the EdU experimental result of HEYA8 and OVCAR3 cell lines; F is the statistical result of the proportion of EdU-positive signal cells in E; G is the growth curve of HEYA8 and OVCAR3 cell lines after treatment with different concentrations of ASO1;

[0030] Figure 4Figure 4 shows the antisense oligonucleotide ASO1 blocking the cell cycle of ovarian cancer cells and inducing apoptosis of ovarian cancer cells in Example 4 of the present invention; wherein, A is the proportion of ovarian cancer cells in different cell cycle stages in the control group and the ASO1-treated group detected by flow cytometry after PI staining; B is the change in the levels of cell cycle marker proteins after ASO1 treatment detected by western blot; C is the apoptosis ratio of ovarian cancer cells in the control group and the ASO1-treated group detected by flow cytometry after Annexin V-PE / 7-AAD staining; D is the change in the levels of apoptosis-related marker proteins after ASO1 treatment detected by western blot;

[0031] Figure 5 Figure 5 is a graph showing the DNA damage induced by ASO1 in ovarian cancer cells in Example 5 of the present invention; A is a comet assay showing the immunofluorescence results of DNA damage induced by ASO1 in ovarian cancer cells; B is a graph showing the DNA damage induced by ASO1 in ovarian cancer cells. Figure 5 A shows the statistical graph of comet tail length; C shows the changes in the protein levels of DNA damage and repair markers in ovarian cancer cells after ASO1 treatment by western blot; D shows the changes in the expression of DNA damage and repair markers by immunofluorescence after 2 Gy radiation exposure after ASO1 treatment; E shows the statistical results of the number of damage and repair marker foci formed in D;

[0032] Figure 6 This is a correlation graph showing the synergistic effect of the combination of ASO1 targeting CDK2 and the PARP inhibitor Olaparib in inducing apoptosis in ovarian cancer cells in Example 6 of the present invention; wherein A represents the effect on cell viability when the ovarian cancer cell line is treated with ASO1 or Olaparib alone or in combination, CI represents the drug combination index, CI < 1 indicates a synergistic effect, CI = 1 indicates an additive effect, and CI > 1 indicates an antagonistic effect; B represents the apoptotic ratio of ovarian cancer cells when the HEYA8 cell line is treated with ASO1 or Olaparib alone or in combination as detected by flow cytometry; C represents the statistics of the proportion of apoptotic cells in Figure B; D represents the changes in the protein levels of apoptosis pathway markers when HEYA8 cell line is treated with ASO1 or Olaparib alone or in combination as detected by western blot;

[0033] Figure 7 These are graphs related to the in vivo experiments demonstrating that ASO1 inhibits ovarian cancer growth in Example 7 of the present invention; wherein A is an image of in vivo imaging of mice after subcutaneous tumor formation of luciferase-labeled ID8 cells and statistical results of fluorescence signal intensity; B is an image of the tumor after dissection; C is an immunohistochemical analysis of the expression of the proliferation marker Ki67 in tumor sections; D is a statistical graph of tumor weight; and E is a statistical graph of tumor volume changes.

[0034] Figure 8This is a schematic diagram of the principle of antisense oligonucleotides inducing cell apoptosis provided by the present invention. DETAILED DESCRIPTION

[0035] The present invention discloses an antisense oligonucleotide and its application in antisense oligonucleotides. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0036] In a typical embodiment of the present invention, an antisense oligonucleotide is provided, wherein the antisense oligonucleotide:

[0037] (I) having the nucleotide sequence shown in SEQ ID NO.1; or

[0038] (II) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences of the nucleotide sequence shown in (I), and having the same or similar function as the nucleotide sequence shown in (I); or

[0039] (III) A nucleotide sequence having at least 80% nucleotide identity with the nucleotide sequence shown in (I) or (II).

[0040] The present invention provides an antisense oligonucleotide that regulates the splicing pattern of CDK2, which can target and regulate CDK2 gene expression. Based on the principle of complementary base pairing, the antisense oligonucleotide specifically binds to the alternative splicing regulatory element of CDK2 pre-mRNA, hindering the spliceosome from splicing CDK2 pre-mRNA through steric hindrance, thereby changing the alternative splicing pattern of CDK2 and regulating CDK2 expression, thereby correcting the abnormal splicing of the gene.

[0041] In some examples of this embodiment, the antisense oligonucleotide has a nucleotide sequence that is 85%, 90%, 95%, 96%, 97%, 98% or more 99% identical to the nucleotide sequence shown in (I) or (II).

[0042] In some examples of this embodiment, the antisense oligonucleotide further has a chemical modification.

[0043] In some examples of this embodiment, the chemical modification is a phosphorothioate backbone modification.

[0044] Specifically, the sequence of the antisense oligonucleotide is:

[0045] CDK2-ASO1:C*C*A*C*T*CACGTG*T*C*C*A*G(SEQ ID NO.1)

[0046] (* represents phosphorothioate backbone modification)

[0047] Experimental verification has shown that the antisense oligonucleotide can downregulate the expression of CDK2, thereby activating the cell apoptosis pathway, and can be used as a cell apoptosis inducer. It is also a potential drug for the treatment of ovarian cancer.

[0048] Therefore, in another typical embodiment of the present invention, there is provided a use of a therapeutically effective amount of an antisense oligonucleotide or a composition thereof in the preparation of a medicament for treating ovarian cancer;

[0049] The antisense oligonucleotide is the antisense oligonucleotide mentioned above.

[0050] In some examples of this embodiment, the composition comprises at least one additional active agent that is a biologic.

[0051] In some examples of this embodiment, the biologic is a PARP inhibitor.

[0052] In some examples of this embodiment, the active agent is olaparib.

[0053] In a third exemplary embodiment of the present invention, a pharmaceutical composition for treating ovarian cancer is provided, wherein the pharmaceutical composition comprises the above-mentioned antisense oligonucleotide.

[0054] According to the present invention, the concept of "treatment" refers to any measure applicable to the treatment of ovarian cancer-related diseases, or preventive treatment of such diseases or symptoms, or avoiding the recurrence of such diseases, such as recurrence after the end of the treatment period or treatment of symptoms of the disease that has already occurred, or pre-intervention to prevent, inhibit or reduce the occurrence of such diseases or symptoms.

[0055] In some examples of this embodiment, the pharmaceutical composition further comprises Olaparib.

[0056] In some examples of this embodiment, the pharmaceutical composition further comprises an inactive pharmaceutical ingredient, which may be a carrier, excipient, diluent, or the like commonly used in pharmacy. Furthermore, according to conventional methods, the pharmaceutical composition may be prepared into oral dosage forms, topical preparations, suppositories, and sterile injectable solutions such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and sprays.

[0057] The non-drug active ingredients such as carriers, excipients and diluents that may be included are well known in the art, and those skilled in the art can determine whether they meet clinical standards.

[0058] In some examples of this embodiment, the carriers, excipients and diluents include but are not limited to lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil.

[0059] In some examples of this embodiment, the pharmaceutical composition can be administered to the body in a known manner. For example, it can be delivered to the tissue of interest by systemic intravenous delivery or local injection. Alternatively, it can be administered intravenously, transdermally, intranasally, through the mucosa, or by other delivery methods. Such administration can be carried out via a single dose or multiple doses. It will be appreciated by those skilled in the art that the actual dose to be administered in the present invention can vary to a great extent depending on a variety of factors, such as the target cell, the type of organism or its tissue, the general condition of the subject to be treated, the route of administration, the mode of administration, etc.

[0060] In some examples of this embodiment, the subject to which the pharmaceutical composition is administered can be humans and non-human mammals, such as mice, rats, guinea pigs, rabbits, dogs, monkeys, orangutans, etc.

[0061] Based on the analysis of TCGA and GTEx databases, this paper found that ovarian cancer has a different CDK2 splicing pattern and higher CDK2 levels than normal tissues, which has the potential to provide new markers for the early molecular typing of ovarian cancer.

[0062] Based on bioinformatics analysis, the present invention proposes for the first time that abnormal splicing of CDK2, a key cell cycle kinase, occurs in ovarian cancer, and that abnormal splicing events are associated with increased expression levels. Based on this discovery, antisense oligonucleotides targeting CDK2 alternative splicing were innovatively designed, and in vitro experiments demonstrated that antisense oligonucleotides targeting CDK2 can induce apoptosis in ovarian cancer cells. It is worth noting that the combination of ASO1 targeting CDK2 and the PARP inhibitor Olaparib has a synergistic effect in inducing apoptosis in ovarian cancer cells. The present invention provides a treatment regimen with a novel mechanism of action for the treatment of ovarian cancer, and in particular, it shows important clinical value for patients with platinum-resistant or recurrent ovarian cancer.

[0063] The antisense oligonucleotide provided by the present invention and the raw materials and reagents used in its application in the treatment of ovarian cancer can all be purchased from the market.

[0064] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0065] Example 1 Clarifying the Expression and Splicing Characteristics of CDK2 in Ovarian Cancer

[0066] By integrating and analyzing the pan-cancer gene expression profiles of the TCGA and GTEx databases, it was found that the CDK2 gene showed a significant high expression feature in many types of malignant tumors including ovarian cancer ( Figure 1 Focusing on ovarian cancer, differential expression analysis was performed on 418 ovarian cancer samples collected from the TCGA database and 88 normal ovarian tissue samples from the GTEx database ( Figure 1 Middle (B) ), the results showed that the mRNA expression level of CDK2 in ovarian cancer tissues was significantly upregulated compared with that in normal tissues (p = 0.0427).

[0067] Through systematic analysis of proteomics data from the CPTAC database ( Figure 1 In (C), the expression level of CDK2 protein in ovarian cancer tissues was significantly higher than that in the normal control group (p<0.001). At the same time, the phosphorylation level of Thr160, which is closely related to CDK2 activation, was also significantly higher than that in the control group (p=0.0189).

[0068] There are two major transcripts of CDK2 in human tissues. I) A full-length transcript with complete coding capacity (CDK2-FL); II) A transcript retaining intron 1 (CDK2-IR). This transcript contains a premature termination codon (PTC) sequence that triggers nonsense-mediated mRNA degradation (NMD), resulting in a significant decrease in stability. Through analysis of the UCSC database and sequencing of clinical samples in our laboratory ( Figure 1 In (D), it was found that the proportion of CDK2-FL transcripts in ovarian cancer was significantly higher than that in normal tissues. It is worth noting that the total expression level of CDK2 showed a significant negative correlation with the retention rate of intron 1 (r = -0.1857, p = 0.0003) ( Figure 1 (E) and (F)), suggesting that abnormal splicing regulation of the CDK2 gene may be one of the reasons for its abnormally increased expression in ovarian cancer.

[0069] Example 2 Design and Efficiency Verification of Antisense Oligonucleotides Targeting CDK2

[0070] In this example, four antisense oligonucleotides (ASOs) were designed around the classical splice sites at both ends of CDK2 intron 1, such as Figure 2 As shown in (A).

[0071] CDK2-ASO1:C*C*A*C*T*CACGTG*T*C*C*A*G(SEQ ID NO.1)

[0072] CDK2-ASO2:G*T*A*C*A*G*AGGCCA*C*T*C*A*C(SEQ ID NO.2)

[0073] CDK2-ASO3:C*T*T*G*G*A*GAGGTT*G*G*G*A*A*A*G(SEQ ID NO.3)

[0074] CDK2-ASO4:C*T*C*A*G*T*C*TCACTT*G*G*A*G*A*G*G(SEQ ID NO.4)

[0075] (* represents phosphorothioate backbone modification)

[0076] Negative controls were obtained from the literature.

[0077] ASO-ctrl:C*C*T*C*T*T*A*C*C*TCAGTTA*C*A*A*T*T*T*A*T*A(SEQ ID NO.5)

[0078] use The ovarian cancer cell line HEYA8 was transiently transfected with 150 nM ASO using transfection reagent (Polyplus).

[0079] Transient transfection steps:

[0080] 1. Cell plating: Plate cells in good condition and in logarithmic phase. Digest with trypsin, resuspend in culture medium, and count cells. Depending on cell size and transfection objectives, plate at varying cell densities. Culture overnight and prepare for transfection.

[0081] 2. Prepare the transfection complex: Using a six-well plate and a final concentration of 150 nM as an example, mix 3 μL of 100 μM ASO stock solution with 200 μL jetPRIME Buffer and add to a 1.5 mL EP tube. Vortex for 10 seconds, add 5 μL jetPRIME, vortex again for 10 seconds, centrifuge, and incubate at room temperature for 10 minutes.

[0082] 3. Add the above transfection mixture to a 6-well plate that has been seeded with cells at an appropriate density. Add 200 μL of the above mixture to 2 mL of culture medium per well, mix gently, and place in a cell culture incubator.

[0083] ASO was labeled with FAM and The S3 live cell imaging system detected the fluorescence signal of ASO. Figure 2 In (B) and (C), the fluorescent signal carried by the ASO was detected in cells 6 hours after transfection, reaching its peak at 48 hours, and was still visible until the observation endpoint (100 hours). Observation of ovarian cancer cells transfected with ASO-FAM under a fluorescence microscope revealed that the vast majority of the ASO that entered the cells was localized in the cell nucleus.

[0084] 48 hours after ASO transfection, cells were harvested and total RNA was extracted using a Fuji total RNA extraction kit. Reverse transcription was performed using HiScript IIQ Select RT SuperMix for qPCR (Norvozymes, Nanjing, China) at 37°C for 15 minutes and 85°C for 5 seconds. The reverse transcription products were subjected to downstream semi-quantitative polymerase chain reaction (PCR) and real-time quantitative PCR (qPCR). Semi-quantitative primers were as follows:

[0085] CDK2-semi-PCR-F:CTTCTGCAGGGTTCCCAGG(SEQ ID NO.6)

[0086] CDK2-semi-PCR-R-IR:ATCCGGCTCAGTTTGGGAAG(SEQ ID NO.7)

[0087] CDK2-semi-PCR-R-FL:CACCCTCAGTCTCAGTGTCC (SEQ ID NO.8)

[0088] The inverted cDNA was amplified by PCR, and the product was electrophoresed on a 1.5% agarose gel at 110V for 30 minutes, imaged, and photographed. Grayscale analysis of the image after agarose electrophoresis was performed using ImageJ:

[0089] Percent splicing insertion index (PSI) = grayscale of the intron-retained band / (grayscale of the intron-retained band + grayscale of the intron-normally spliced band)

[0090] qPCR primers:

[0091] hCDK2-F:CCAGGAGTTACTTCTATGCCTGA (SEQ ID NO.9)

[0092] hCDK2-R:TTCATCCAGGGGAGGTACAAC (SEQ ID NO.10)

[0093] CDK2-IR-F:TCTGTACCCGGGACTCCTAA(SEQ ID NO.11)

[0094] CDK2-IR-R:AAAGAAGTCCCTCCCTGCTC (SEQ ID NO.12)

[0095] CDK2-SF:GAGAGGGCACGTACGGAG(SEQ ID NO.13)

[0096] CDK2-SR:CCTCAGTCTCAGTGTCCAGG(SEQ ID NO.14)

[0097] GAPDH-F:CAGAACATCATCCCTGCCTCTAC (SEQ ID NO.15)

[0098] GAPDH-R:TTGAAGTCAGAGGAGACCACCTG(SEQ ID NO.16)

[0099] qPCR was performed using SYBR Green mix (Vazyme) and Applied Biosystems QuantStudio 3. GAPDH was used as an endogenous control. -ΔΔCT The method was used for relative quantification of qPCR data.

[0100] 72 hours after ASO transfection, cells were harvested and protein was extracted. CDK2 protein expression was detected by western blot. The method is as follows:

[0101] 1. Sample preparation: Prepare 30 μg of protein sample that has been fully lysed and centrifuged with total cell protein lysis buffer, add 5× SDS loading buffer, heat at 95°C for 10 minutes to denature, and cool on ice (store at -80°C).

[0102] 2. Polyacrylamide gel (SDS-PAGE) electrophoresis: Load 2.5 μL of protein marker sample, and limit the loading volume per well to 25 μL. Run the stacking gel at 60-80 V. Once all samples have entered the separating gel, adjust the voltage to 120-160 V.

[0103] 3. Transfer (wet transfer): Cut a PVDF membrane of similar shape and size to the gel. After methanol activation, soak and equilibrate in transfer buffer for 10-15 minutes. Using the sandwich method, place the PVDF membrane on the SDS-PAGE gel, attaching sponges to the top and bottom. Remove as many bubbles as possible between the gel and membrane, ensuring they are securely positioned. Place the secured plate into the transfer chamber. Place the transfer chamber in an ice-water bath and transfer at 200 mA for 60-90 minutes.

[0104] 4. Blocking: Block the plate with TBST solution containing 5% skim milk for 1 hour on a shaker.

[0105] 5. Add primary antibody: Fold the sealing film into a boat of appropriate size, add a certain proportion of diluted primary antibody, and turn the PVDF membrane with protein sample upside down onto the primary antibody.

[0106] 6. Add secondary antibody: Wash the membrane three times in TBST (1% Tween 20) for 10 minutes each wash. Dilute the secondary antibody 1:5000 in blocking buffer and incubate on a shaker at room temperature for 1 hour. Wash three times in TBST for 10 minutes each wash.

[0107] 7. Chemiluminescence: Prepare freshly prepared colorimetric solution A and solution B at a ratio of 1:1, add appropriate colorimetric solution and drop evenly onto the membrane, and use ECL chemiluminescence system for imaging.

[0108] The results of qPCR ( Figure 2 (D) and (E)) demonstrated that ASO1 could promote the retention of CDK2 intron 1 and downregulate the expression of CDK2 RNA level (downregulation rate reached 44.09±1.28%). Semi-quantitative PCR assay showed that ASO1 increased the splicing insertion percentage index (PSI) of CDK2 intron 1 from 0.15 to 0.26 ( Figure 2 Middle (F)). Western blot results showed that ASO1 could significantly downregulate the protein level of CDK2 at a concentration of 50nM ( Figure 2 (G) and (H)).

[0109] Example 3 Antisense oligonucleotide ASO1 inhibits ovarian cancer cell proliferation

[0110] The MTT assay was used to determine the half-inhibitory concentration (IC50) of ASO1. This example used the MTT colorimetric system to evaluate the antiproliferative activity of ASO1 in various ovarian cancer cell lines (HEYA8, OVCAR3, etc.), human skin fibroblasts (HSF), and human fallopian tube epithelial cell lines (FTE187). The experimental procedure is as follows:

[0111] 1. Cell Culture and Inoculation

[0112] The cells in the logarithmic growth phase were digested with 0.25% trypsin and centrifuged at 1500 rpm for 5 minutes to collect the cell suspension. The viable cells were counted by trypan blue staining and the cell density was adjusted to 1×10 4 -5×10 4 cells / mL.

[0113] A triplicate well design was used, and 100 μL of cell suspension (1×10 3 –5×10 3 Cells / well) were plated, and PBS buffer was added to the peripheral wells to form a moisture barrier. Drug treatment was performed after the cells were cultured for 24 hours.

[0114] 2. Drug gradient treatment

[0115] A concentration gradient of ASO1 was set (0-400 nM, 2-fold incremental dilution), and 100 μL of drug-containing culture medium was added to each well.

[0116] 3.MTT color development and detection

[0117] 10 μL of MTT solution (5 mg / mL, dissolved in PBS) was added to each well, and the cells were incubated at 37° C. for 4 hours, and the culture medium was removed.

[0118] 100 μL of DMSO was added to each well to dissolve the formazan crystals, and the absorbance at 570 nm was measured using a microplate reader. The dose-response curve was fitted using a four-parameter logistic equation (GraphPad Prism 8.0).

[0119] The results showed that the IC50 values of ovarian cancer cell lines HEYA8 and OVCAR3 were 54.97nM and 53.06nM, respectively. Figure 3 (A)), while the IC50 of normal tissue derived cell lines HSF and FTE187 were 138.7nM and 84.08nM ( Figure 3 (B)), which were significantly higher than those in tumor cells, suggesting that ASO1 targeting CDK2 has tumor-selective anti-proliferation activity.

[0120] To further demonstrate the inhibitory effect of ASO1 on the proliferation of ovarian cancer cells, the following series of experiments were conducted.

[0121] (1) Plate colony formation experiment

[0122] Single cell suspension (1-2×10 3 Cells (cells / well) were seeded in 6-well plates and cultured for 10-14 days before fixation with methanol and staining with 0.1% crystal violet. The number of colonies formed was counted using ImageJ software.

[0123] The results show that ( Figure 3In (C) and (D), after ASO1 treatment, the number of ovarian cancer cell clones was significantly reduced in a dose-dependent manner.

[0124] (2) EdU experiment

[0125] EdU cell proliferation assay was performed using the Cell-Light EdU Apollo567 In Vitro Kit (RiboBio, Guangzhou, China). Cells were plated at 3-4 × 10 4 Cells were seeded at a density of 100 cells / mL onto glass coverslips in a 24-well plate and incubated with EdU-containing medium for 20-30 minutes. The cells were then fixed and stained with Apollo 567 fluorescent dye and Hoechst 33342. The percentage of EdU-positive nuclei was counted under a fluorescence microscope.

[0126] The results of the EdU experiment showed that ( Figure 3 In (E) and (F), after ASO1 treatment, the proportion of EdU-positive signals, representing cells in a proliferative state, was significantly decreased.

[0127] (3) Dynamic monitoring of living cells

[0128] use Continuous monitoring was performed using the S3 live cell imaging system (imaging every 2 hours for 80 hours), and the cell proliferation curve was quantified using the Confluence algorithm.

[0129] The results showed that ASO1 significantly inhibited cell proliferation and the inhibitory effect was time-dose dependent ( Figure 3 (G)).

[0130] Example 4 Antisense oligonucleotide ASO1 blocks the cell cycle of ovarian cancer cells and induces apoptosis of ovarian cancer cells CDK2 is a key cyclin-dependent kinase that regulates the G1 / S phase transition, and its functional inhibition may affect the cell cycle process. To verify the effect of antisense oligonucleotide ASO1 targeting CDK2 on the cell cycle of ovarian cancer cells, ovarian cancer cells were treated with ASO-ctrl and ASO1 for 48 hours, respectively, and then DNA was stained using Cell Cycle Staining Kit (Lianke Bio, Hangzhou, China) and cycle analysis was performed using CytoFLEX S flow cytometer (Beckman Coulter Life Sciences, Indiana, USA). The results showed that compared with the control group, the proportion of cells in the G0 / G1 phase increased in the ASO1-treated group, and the proportion of cells in the S phase and G2 phase decreased ( Figure 4 This result is consistent with the core regulatory role of CDK2 in the G1 / S checkpoint, suggesting that ASO1 effectively arrests the cell cycle in the G1 phase by inhibiting CDK2 expression.

[0131] Morphological observation revealed that cells in the ASO1-treated group exhibited typical apoptotic features, including cell size reduction and the formation of apoptotic bodies. For further quantitative analysis, cell apoptosis was detected using the Annexin V-PE / 7-AAD double staining method (Apoptosis Detection Kit, Novozymes, Nanjing, China) combined with flow cytometry. The results showed that compared with the control group, ASO1 treatment significantly increased the proportion of apoptotic cells ( Figure 4 (C)).

[0132] Western blot results revealed that ASO1 significantly activated the apoptosis pathway ( Figure 4 (B) and (D)). Compared to the control group, Cleaved-Caspase3 protein expression was upregulated in the ASO1-treated group. Downregulation of Bcl2 (HEYA8) and upregulation of Bax (OVCAR3) were also observed in some cell lines. These changes at the molecular level further confirm that ASO1 induces apoptosis through the mitochondrial pathway.

[0133] Example 5 ASO1 induces DNA damage in ovarian cancer cells

[0134] Based on the comet assay results ( Figure 5 In (A) and (B), the ASO1-treated group showed a significantly increased comet tail length (tail moment) compared with the control group, suggesting that ASO1 induced DNA damage in ovarian cancer cells.

[0135] Further western blot was used to detect damage repair related markers ( Figure 5 Middle (C) ), the results indicate that after ASO1 treatment, the expression of DNA double-strand break marker γH2AX was significantly increased, and the expression of homologous recombination repair-related protein RAD51 was downregulated in the HEYA8 cell line.

[0136] Subsequently, the γ-ray irradiation model (2Gy, repair time 6h) combined with immunofluorescence staining analysis revealed that ( Figure 5 In (D) and (E), ASO1 treatment significantly increased the number of γH2AX foci compared with the control group, and the number of RAD51 foci decreased when cells were treated with high concentrations of ASO1, suggesting that ASO1 not only induces DNA double-strand breaks in ovarian cancer cells but also inhibits homologous recombination repair under high concentration conditions.

[0137] Example 6: Combination of ASO1 targeting CDK2 and the PARP inhibitor Olaparib has a synergistic effect in inducing apoptosis in ovarian cancer cells

[0138] This example, based on the principle of synthetic lethality, innovatively explores the combined treatment of ASO1 and a PARP inhibitor. Previous studies have confirmed that a single dose of ASO1 can induce DNA double-strand breaks in ovarian cancer cells. Based on this, this example proposes the first combined treatment of ASO1 and olaparib.

[0139] The results of MTT assay for cell viability showed that ( Figure 6 In (A), the combination of ASO1 and Olaparib can enhance the inhibition of ovarian cancer cell growth. Flow cytometry analysis showed that ( Figure 6 In (B) and (C), after 24 hours of treatment with ASO1 (75nM) alone, the apoptosis rate of ovarian cancer cells was about 32%, and after 24 hours of treatment with Olaparib (100μM) alone, the apoptosis rate of ovarian cancer cells was about 5%. After 24 hours of treatment with ASO1 (75nM) combined with Olaparib (100μM), the apoptosis rate of ovarian cancer cells was about 65%, which was much higher than that of any single drug treatment group and much higher than the sum of the apoptosis rates of ovarian cancer cells in the single drug treatment groups. This further indicates that the combination of ASO1 and Olaparib has a synergistic effect in inducing apoptosis of ovarian cancer cells. Western blot results show ( Figure 6 Middle (D) , compared with the single-dose group, the expression of DNA double-strand break marker γH2AX, cell apoptosis markers Cleaved-Caspase3 and Cleaved-PARP1 in the combination group were significantly increased.

[0140] Example 7 In vivo experiments verified that ASO1 inhibited the growth of ovarian cancer.

[0141] To systematically evaluate the anti-tumor effect of ASO1 in vivo, this example conducted an experimental verification by intratumoral injection of ASO drugs in a subcutaneous tumor animal model. Six-week-old C57BL / 6J female mice (n=10) were selected and 3x10 6 Tumor volume (V = 0.5 × long diameter × short diameter) was measured weekly using a vernier caliper. 2 ), when the subcutaneous tumor volume reaches 100 mm 3 Mice were randomly divided into two groups. The experimental group received intratumoral injections of the sequence-adjusted ASO1-M targeting mouse Cdk2 (5 nmol / time, dissolved in 50 μL of saline, twice weekly). ASO1-M is based on ASO1, with one base adjusted based on the sequence of mouse Cdk2; the sequence is as follows: C*C*A*C*T*CACGTG*T*C*G*A*G ((SEQ ID NO. 17)). The control group received an equal dose of the negative control ASO-ctrl.

[0142] Treatment lasted for 2 weeks, with bioluminescent imaging performed 48 hours after the last dose. Mice were anesthetized and intraperitoneally injected with D-luciferin sodium salt (15 mg / mL, dissolved in DPBS, 150 μg / g body weight). Ten minutes later, the fluorescence signal was acquired using an IVIS Spectrum system (PerkinElmer). Following intravital imaging, the mice were sacrificed, and tumor tissue was dissected and weighed. Subsequently, the tumor tissue was fixed overnight in 10% formalin, embedded in paraffin, and sectioned for Ki67 immunohistochemical staining.

[0143] The results showed that the tumor growth rate in the ASO1-M treated group was significantly slower than that in the control group ( Figure 7 (A), (B) and (C)), and the tumor volume was reduced by 74.62±23.84% ( Figure 7 Middle (E)), tumor mass decreased by 68.33±24.97% ( Figure 7 Immunohistochemistry results confirmed that ASO1-M treatment decreased the expression of the proliferation marker Ki67, suggesting that ASO1 can exert its anti-tumor effect in vivo by inhibiting tumor cell proliferation.

[0144] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. An antisense oligonucleotide, characterized in that The antisense oligonucleotide: (I) having the nucleotide sequence shown in SEQ ID NO.1; or (II) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotide sequences of the nucleotide sequence shown in (I), and having the same or similar function as the nucleotide sequence shown in (I); or (III) A nucleotide sequence having at least 80% nucleotide identity with the nucleotide sequence shown in (I) or (II).

2. The antisense oligonucleotide according to claim 1, wherein The antisense oligonucleotide has a nucleotide sequence with 85%, 90%, 95%, 96%, 97%, 98% or 99% or more nucleotide identity to the nucleotide sequence shown in (I) or (II).

3. The antisense oligonucleotide according to claim 1, wherein The antisense oligonucleotides may also have chemical modifications.

4. The antisense oligonucleotide according to claim 3, wherein The chemical modification is phosphorothioate backbone modification.

5. Use of a therapeutically effective amount of an antisense oligonucleotide or a composition thereof in the preparation of a medicament for treating ovarian cancer; The antisense oligonucleotide is the antisense oligonucleotide according to any one of claims 1 to 4.

6. The use according to claim 5, characterized in that The composition comprises at least one additional active agent which is a biologic.

7. The use according to claim 6, characterized in that The biological agent is a PARP inhibitor.

8. The use according to claim 6, characterized in that The active agent is Olaparib.

9. A pharmaceutical composition for treating ovarian cancer, characterized in that: The pharmaceutical composition comprises the antisense oligonucleotide according to any one of claims 1 to 4.

10. The pharmaceutical composition according to claim 9, wherein The pharmaceutical composition also includes Olaparib.

Images