Application of tobacco male sterility related gene NtCYP704B1 and method for creating sterile line

Abstract

This invention belongs to the field of plant biotechnology breeding, specifically relating to the application of the tobacco male sterility-related gene NtCYP704B1 and a method for creating sterile lines. The gene mutant involves simultaneous mutation of two paralogous genes, NtCYP704B1-T and NtCYP704B1-S, of the tobacco male sterility-related gene NtCYP704B1. The nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO. 5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO. 6; and the amino acid sequences encoded by the NtCYP704B1-T and NtCYP704B1-S mutant genes are shown in SEQ ID NO. 7 and SEQ ID NO. 8, respectively. This invention utilizes CRISPR / Cas9 gene editing technology to simultaneously and site-directedly mutate two paralogous genes of NtCYP704B1 in common tobacco, creating the NtCYP704B1-T / S mutant, which leads to complete male sterility. This invention also provides a method for creating male-sterile tobacco lines, which has significant application value in the breeding and hybridization of male-sterile tobacco lines.

Description

Technical Field

[0001] This invention belongs to the field of plant biotechnology breeding, specifically involving the application of the tobacco male sterility-related gene NtCYP704B1 and the method for creating sterile lines. Background Technology

[0002] Tobacco is one of the major economic crops, and the tobacco seed industry currently faces the following problems: First, limited by factors such as the lack of fundamental breakthroughs in basic research on tobacco male sterility, the protection of intellectual property rights for tobacco inbred lines is difficult, resulting in a long-standing phenomenon of follower and imitative breeding in the tobacco seed industry in recent years, and slow efficiency in the breeding of major new varieties. Second, the planting of tobacco inbred lines involves farmers saving their own seeds, resulting in a lack of standardization in the varieties planted, low purity and poor uniformity of purchased tobacco leaves, affecting the application of formulas by cigarette manufacturers and the stability of cigarette product quality. Third, the tobacco seed production industry is still in a labor-intensive stage that relies mainly on manual pollination, resulting in high costs, huge resource consumption, and difficulty in guaranteeing seed quality.

[0003] Compared with other model plants such as rice and maize, tobacco still lags behind in the utilization of heterosis, mainly due to the lack of superior male-sterile lines. Male-sterile lines are important materials for utilizing heterosis and hybrid seed production in crops, mainly including cytoplasmic male sterility (CMS) and nuclear male sterility (GMS). CMS is jointly controlled by mitochondrial and nuclear genes. Although it has been applied in tobacco breeding and hybrid seed production, currently only one usable sterile line cytoplasm exists, and it suffers from problems such as low resource utilization, monotonous sterile line cytoplasm, and susceptibility to disease. GMS is controlled solely by nuclear genes, which can overcome the defects of CMS, but it is difficult to mass-produce homozygous sterile lines through conventional breeding methods. In recent years, with the advancement of biotechnology, tobacco multi-control sterility technology and plant universal dominant sterility technology, created through the combination of genetic engineering and molecular design breeding, can effectively solve the problem of maintaining and propagating recessive nuclear male-sterile lines in tobacco. An important prerequisite for realizing the application of the above technologies is to obtain a large number of GMS genes with clearly defined functions that control male development in tobacco and corresponding male-sterile materials. Compared with the model plant Arabidopsis thaliana and the model crop rice, there are no reports of GMS gene cloning, identification, or creation of male-sterile materials in tobacco. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides the application of the tobacco male sterility-related gene NtCYP704B1 and a method for creating sterile lines. This invention utilizes CRISPR / Cas9 technology to edit the tobacco male sterility-related gene NtCYP704B1 and create male sterile materials, thus enriching the resources of tobacco sterile materials.

[0005] To achieve the above-mentioned technical objectives, the present invention provides the following technical solution:

[0006] The application of the tobacco male sterility-related gene NtCYP704B1 involves simultaneously mutating two paralogous genes of tobacco male sterility-related gene NtCYP704B1, NtCYP704B1-T and NtCYP704B1-S, to inhibit the expression of the NtCYP704B1 gene in tobacco and achieve male sterility in tobacco.

[0007] The nucleotide sequence of the NtCYP704B1-T gene is shown in SEQ ID NO.1.

[0008] The nucleotide sequence of the NtCYP704B1-S gene is shown in SEQ ID NO.2.

[0009] A gene mutant controlling male sterility in tobacco, wherein the gene mutant is a simultaneous mutation of two paralogous genes NtCYP704B1-T and NtCYP704B1, which are related to male sterility in tobacco.

[0010] The nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.6.

[0011] Furthermore, the amino acid sequences encoded by the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0012] Application of a gene mutant for male sterility in tobacco, and its application in the creation of male-sterile tobacco lines.

[0013] A method for creating a male-sterile tobacco line, the method comprising: simultaneously editing two paralogous genes NtCYP704B1-T and NtCYP704B1-S of the NtCYP704B1 gene using the CRISPR / Cas9 method to obtain a gene editing vector; and obtaining a NtCYP704B1-T / S double-mutant male-sterile line with both NtCYP704B1-T and NtCYP704B1-S genes edited via Agrobacterium-mediated transformation.

[0014] The nucleotide sequences of the NtCYP704B1-T mutant gene and the NtCYP704B1-S mutant gene after gene editing using the CRISPR / Cas9 method are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0015] Furthermore, when using the CRISPR / Cas9 method for gene editing, nucleotide sequences such as those shown in SEQ ID NO.9 and SEQ ID NO.10 are designed at the homologous regions of the first exon of the NtCYP704B1-T and NtCYP704B1-S genes to serve as CRISPR / Cas9 vector editing targets.

[0016] Furthermore, the constructed gene editing vector is PKSE401-GFP-NtCYP704B1, and the base vector of the gene editing vector is PKSE401-GFP.

[0017] Furthermore, upstream primer NtCYP704B1-TF and downstream primer NtCYP704B1-TR for detecting the NtCYP704B1-T gene target site were designed, and the sequences of the upstream primer NtCYP704B1-TF and the downstream primer NtCYP704B1-TR are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively.

[0018] Upstream primer NtCYP704B1-SF and downstream primer NtCYP704B1-SR were designed to detect the target site of the NtCYP704B1-S gene, as shown in SEQ ID NO.17 and SEQ ID NO.18, respectively.

[0019] Application of NtCYP704B1-T / S double-sterile line in hybridization breeding and seed production.

[0020] Furthermore, its application in hybridization breeding and seed production refers to using the NtCYP704B1-T / S double-sterile line as the female parent to cross with other male parents to obtain fertile hybrid F1, and then planting the hybrid F1 in production.

[0021] The beneficial effects of this invention are:

[0022] This invention is the first to achieve male sterility in tobacco by inhibiting the expression of the NtCYP704B1 gene. The regulation of male reproductive development in tobacco by the two paralogous genes of NtCYP704B1, NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664), and their encoded proteins, is not disclosed in existing technologies. This invention utilizes the CRISPR / Cas9 method to simultaneously mutate the tobacco genes NtCYP704B1-T and NtCYP704B1-S, discovering that simultaneous mutation of these two paralogous genes causes male sterility in tobacco.

[0023] This invention obtains a gene editing vector using the CRISPR / Cas9 gene editing method, and then obtains the NtCYP704B1-T / S double-mutant male sterile line with both NtCYP704B1-T and NtCYP704B1-S genes edited through Agrobacterium-mediated transformation, which can be applied to tobacco hybridization breeding and seed production. Attached Figure Description

[0024] Figure 1 This is the phenotype of the wild-type flower of the tobacco inbred line K326 in this invention;

[0025] Figure 2 The phenotype of wild-type male buds and stigmas of the tobacco inbred line K326 in this invention;

[0026] Figure 3 These are the experimental results of pollen viability of the wild-type tobacco inbred line K326 in this invention;

[0027] Figure 4 The phenotype of the flower of the NtCYP704B1-T / S double-parasitic sterile line in this embodiment of the invention;

[0028] Figure 5 The phenotypes of male buds and stigmas of the NtCYP704B1-T / S double-mutant sterile line in this embodiment of the invention;

[0029] Figure 6 The results of the pollen viability experiment of the NtCYP704B1-T / S double-mutant sterile line in this embodiment of the invention;

[0030] Figure 7 The anthers of the NtCYP704B1-T / S double-sterile line in this embodiment of the invention;

[0031] Figure 8 The inner wall of the anther of the NtCYP704B1-T / S double-sterile line in this embodiment of the invention;

[0032] Figure 9 The anthers of the wild-type tobacco inbred line K326 in this invention;

[0033] Figure 10 This refers to the inner wall of the anther of the wild-type tobacco inbred line K326 in this invention. Detailed Implementation

[0034] The following embodiments are used to illustrate the present invention, but do not limit the scope of the invention. Modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are all within the scope of the invention. Unless otherwise specified, the primers used in the embodiments were completed by Beijing Qingke Biotechnology Co., Ltd., and the sequencing was completed by Quintiles (Wuhan) Biotechnology Co., Ltd. Other biochemical reagents, unless otherwise specified, are conventional commercially available reagents, and the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0035] Example 1: Functional study of the tobacco Ntcyp704b1 gene and creation of a male-sterile tobacco line using CRISPR / Cas9:

[0036] In the tobacco database (National Center for Biotechnology Information (nih.gov)), two paralogous genes of tobacco NtCYP704B1 were found: NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664). In the tobacco inbred line K326, the nucleotide sequences of the NtCYP704B1-T and NtCYP704B1-S genes are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The NtCYP704B1-T (LOC107791425) gene is functionally annotated as cytochrome P450704B1-like, and its encoded protein contains 510 amino acids, with the sequence shown in SEQ ID NO. As shown in NO.3, the NtCYP704B1-S(LOC107809664) gene is functionally annotated as cytochrome P450704B1, and its encoded protein contains 519 amino acids, the sequence of which is shown in SEQ ID NO.4.

[0037] There is no publicly available research data on the actual function of the Ntcyp704b1 gene in tobacco. In order to clarify the function of the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes in tobacco, this invention uses the CRISPR / Cas9 gene editing method to mutate the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) gene sequences, thereby knocking out the function of this gene in tobacco.

[0038] This invention selects the tobacco inbred line K326 as the recipient material for gene editing. Construction of the CRISPR / Cas9 gene editing vector NtCYP704B1: The gene editing vector of this invention is PKSE401-GFP-Ntcyp704b1. The base vector of this vector is PKSE401-GFP, and the intermediate vector is pCBC mT1T2, providing gRNA. This invention designs target sites on primers, obtains MT-sgRNA via PCR, and then ligates it into the base vector via enzyme digestion. The specific construction process is as follows:

[0039] (1) The gene sequence of NtCYP704B1 (including two paralogous genes NtCYP704B1-T and NtCYP704B1-S) was input into http: / / targetDesign(scau.edu.cn) for target design. Nucleotide sequences were designed at the homologous regions of the first exon of the NtCYP704B1-T and NtCYP704B1-S genes, as shown in SEQ ID NO. 9 and SEQ ID NO. 10, to serve as CRISPR / Cas9 vector editing target sites. The sgRNA backbone sequence of this invention was directly amplified from the intermediate vector pCBC mT1T2.

[0040] (2) MT-sgRNA was obtained by designing target sites on primers and then amplifying by PCR. Primers Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, Ntcyp704b1-MT1-BsR, and the amplification intermediate vector pCBCmT1T2 were used. Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. -BsF / -BsR were the normal primer concentrations; -F0 / -R0 were diluted 20-fold. The fragments used to obtain sgRNA were all 626bp in length. The PCR system and conditions are as follows: Template DNA (intermediate vector pCBCmT1T2 ≥ 30 ng / μL) 2 μL; Primer BsF, F0 / BsR, R0: 1 μL each; Enzyme: 1 μL; dNTP: 1 μL; Buffer: 25 μL; Sterile ddH2O: 17 μL; The PCR temperature program is as follows: ① 95℃ for 5 minutes; ② 95℃ for 30 seconds; ③ 58℃ for 30 seconds; ④ 72℃ for 35 seconds; ⑤ Cycle 34 times from ② to ④; ⑥ 72℃ for 10 minutes; ⑦ 25℃ for 10 minutes. Finally, the PCR products are recovered.

[0041] The primer sequences Ntcyp704b1-MT1-BsF, Ntcyp704b1-MT1-F0, Ntcyp704b1-MT1-R0, and Ntcyp704b1-MT1-BsR required for vector construction are as follows:

[0042] Ntcyp704b1-MT1-BsF:5'-ATATATGGTCTCGATTGCATACATTGGCCTATTATTGTT-3'(SEQID NO.11)

[0043] Ntcyp704b1-MT1-F0:5'-TGCATACATTGGCCTATTATTGTTTTAGAGCTAGAAATA GC-3'(SEQ ID NO.12)

[0044] Ntcyp704b1-MT1-R0:5'-AACAAGTTGTAGACCACGTTGGCAATCTCTTAGTCGA CTCTAC-3'(SEQ ID NO.13)

[0045] Ntcyp704b1-MT1-BsR:5'-ATTATTGGTCTCGAAACAAGTTGTAGACCACGTTGG CAA-3'(SEQID NO.14)

[0046] (3) Using an enzyme digestion-ligation system. The PKSE401-GFP vector and the recovered sgRNA fragment with the target were digested with BsaI, and T4 ligase was added to ligate the vector and the sgRNA fragment. The 15 μL restriction enzyme ligation system is as follows: sgRNA fragment: 2 μL, PKSE401-GFP vector (≥60 ng / μL): 2 μL, 10x NEB Buffer: 1.5 μL, 10x T4 DNA Ligase Buffer: 1.5 μL, BsaI endonuclease (product number: #R3733): 1 μL, T4 ligase (product number: EL0011): 1 μL, sterile ddH2O: 6 μL; the expression vector PKSE401-GFP-NtCYP704B1 was constructed; this expression vector includes the target (MT1) of the target gene NtCYP704B1-T (LOC107791425) and the target (MT1) of NtCYP704B1-S (LOC107809664), the marker gene Cas9, and the resistance Kana. From the left to the right boundary of the T-DNA, the expression cassettes are: the expression cassette of the resistance Kana; the expression cassette of the nuclease-encoding gene Cas9; the 35S enhancer; the expression cassettes of NtCYP704B1-T and NtCYP704B1-S gene target 1 (MT1); the U6 promoter; the GFP fluorescent protein tag; and the 35S promoter.

[0047] Agrobacterium-mediated genetic transformation of tobacco:

[0048] (1) Preparation of sterile vaccines

[0049] Take an appropriate amount of K326 seeds in a 2.0 mL centrifuge tube, add 1.5 mL of room temperature distilled water and soak for 12-24 hours. Wash away any unripe seeds and impurities floating on the surface. Sterilize the seeds in a clean bench. First, add 1.5 mL of 75% medical alcohol, invert the centrifuge tube for 45 seconds, let it stand, and discard the alcohol with a pipette after the seeds have settled. Add 1.5 mL of sterile water, invert twice, let it stand, and discard the water with a pipette after the seeds have settled. Repeat this step twice. Then, add 1.5 mL of 84 disinfectant (NaClO), invert the centrifuge tube for 4 minutes, let it stand, and discard the 84 disinfectant with a pipette after the seeds have settled. Add 1.5 mL of sterile water, invert twice, let it stand, and discard the water with a pipette after the seeds have settled. Repeat this step 5 times. Finally, spread the sterilized seeds evenly on MS plates (medium: MS + 30 g / L sucrose + 7 g / L agar + pH 5.8), dry the surface of the MS plates, seal them, and place them in a 25°C light incubator for culture.

[0050] After the seeds germinate and begin to grow true leaves (about 2 weeks), individual tobacco plants are transferred to tissue culture boxes for further cultivation. Tobacco seedlings can be used for infection when they have 10 cotyledons (about 4 weeks) in the tissue culture boxes.

[0051] (2) Preparation of bacterial culture

[0052] Remove the transformed strain stored at -80℃ and inoculate it into 5 mL of LB medium containing three antibiotics (rifampin, gentamicin, and kanamycin). Incubate at 28℃ on a shaker (180 rpm) for 24 h. Take 1 mL of the bacterial culture and inoculate it into an Erlenmeyer flask containing 50 mL of LB medium containing three antibiotics. Incubate at 28℃ until the OD600 is approximately 0.6-0.8 (requires 4-6 h). Pour the culture into petri dishes for later use.

[0053] (3) Pre-culture

[0054] Select healthy leaves that are fully expanded in the middle of sterile tobacco seedlings. After removing the leaf margins, main veins and petioles, cut the leaves into 0.8cm × 0.8cm pieces. Place the leaves with the underside facing up on the pre-culture medium, which consists of the same components as the co-culture medium. Use 6-8 leaves per dish and pre-culture at 28℃ in the dark for 3 days.

[0055] (4) Agrobacterium infection.

[0056] Place the pre-cultured leaves into the prepared Agrobacterium solution and soak for 8-10 minutes. Gently shake the culture dish several times during this period to ensure that the bacterial solution and the material are in full contact. Remove the leaves and place them on sterile filter paper to absorb any excess bacterial solution.

[0057] (5) Co-cultivation.

[0058] Leaves were inoculated onto a co-culture medium, with the underside of the leaves facing upwards, and co-cultured at 28°C in the dark for 2 days.

[0059] (6) Screening and differentiation.

[0060] Leaves were transferred to a selection medium for the selection and differentiation of resistant buds, and the medium was changed every 15 days.

[0061] (7) Rooting culture.

[0062] When the leaves develop relatively obvious resistant buds on the selection medium, the resistant buds are cut off and transferred to the rooting medium for rooting culture of resistant seedlings. After rooting, the seedlings are transplanted into nutrient pots for hardening off, and after one month they are moved to a greenhouse. The offspring seeds are harvested after 3-4 months.

[0063] CRISPR / Cas9 mutation result detection in T0 generation plants: The following steps were taken to determine the CRISPR / Cas9 mutation result in T0 generation plants:

[0064] First, DNA was extracted from tobacco leaves using the CTAB method: Seedling leaves approximately 2 cm in length were cut and placed in a 2 mL centrifuge tube containing steel balls; the centrifuge tube containing the leaves was immersed in liquid nitrogen for 5 minutes, and then the leaf sample was crushed using a grinder; 700 μL of [unspecified substance] was added to the centrifuge tube. Add CTAB extraction buffer (containing 1% β-mercaptoethanol) and shake vigorously to mix. Preheat in a 65°C water bath for 20-30 min (inverting the tube 1-2 times during this period, paying attention to the corresponding sample numbers). After the centrifuge tube cools to room temperature, add 700 μL of chloroform:isoamyl alcohol (24:1) extraction solution, shake vigorously for 30 seconds, and let stand at room temperature for a while. Centrifuge at 12000 rpm for 5 min at 4°C, and transfer 500 μL of the supernatant to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol to the centrifuge tube containing the supernatant and shake gently to mix. Let stand at room temperature for about 10 min. Then place the centrifuge tube containing the sample in a 4°C centrifuge and centrifuge at 12000 rpm for 10 min. Gently aspirate the supernatant, discard the supernatant, and retain the precipitate. Add 800 μL of CTAB extraction buffer to the centrifuge tube. Wash the precipitate twice with 75% ethanol, centrifuge at 10,000 rpm for 5 min, and discard the supernatant. Allow the sample to air dry at room temperature for 2-4 hours to obtain DNA precipitate. Dissolve the precipitate in an appropriate amount of sterile water, and gently shake to fully dissolve the DNA. Store the DNA sample at -20℃.

[0065] PCR primers were designed based on the NtCYP704B1-T (LOC107791425) gene sequence to detect the target MT1. The designed primers include an upstream primer NtCYP704B1-TF and a downstream primer NtCYP704B1-TR for detecting the NtCYP704B1-T gene target site. The primer sequences are as follows:

[0066] NtCYP704B1-T upstream primer: CACAGCATGCAAAGACTGTTGA (SEQ ID NO.15)

[0067] NtCYP704B1-T downstream primer: TCCCCACCGAAAGAATAACAA (SEQ ID NO.16)

[0068] PCR primers were designed based on the NtCYP704B1-S (LOC107809664) gene sequence to detect the target MT1. The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR, designed to detect the NtCYP704B1-S gene target site, have the following sequences:

[0069] NtCYP704B1-S upstream primer: TGAGGTGTGTTGTGGAAGTCA (SEQ ID NO.17)

[0070] NtCYP704B1-S downstream primer: AGTTGTAGACCACGTTGGGAC (SEQ ID NO.18)

[0071] To detect gene mutations in transgenic positive single plants and their offspring in a high-throughput manner, high-throughput self-built library sequencing was performed. The experimental principle is to perform sequencing after two rounds of PCR: (1) The first round of PCR amplification was performed on the DNA fragment containing the target site using site-specific primers (SSP); the designed specific primers need to add common bridging sequences to their 5' ends: 5' addition of F primer: 5'-ggagtgagtacggtgtgc-3', 5' addition of R primer: 5'-gagttggatgctggatgg-3'; (2) The second round of amplification was performed using a set of universal barcoding primers; (3) The second round amplification products from different single plants were mixed in equal amounts, detected, and sent to the company for 150bp second-generation sequencing with paired ends; (4) The mutation sequence was decoded and analyzed by the online Hi-TOM website (http: / / www.hi-tom.net / hi-tom / ) to determine the mutation type of each single plant at each target site.

[0072] High-throughput detection was used to determine whether gene editing had occurred in the target region. Ultimately, it was found that the target region sequences of two genes changed in one T0 transformation event, confirming the generation of a gene mutant. This mutant involved simultaneous mutations in two paralogous genes, NtCYP704B1-T and NtCYP704B1, of the tobacco male sterility-related gene NtCYP704B1. The nucleotide sequence of the NtCYP704B1-T mutant gene is shown in SEQ ID NO.5; the nucleotide sequence of the NtCYP704B1-S mutant gene is shown in SEQ ID NO.6.

[0073] The gene mutant is a homozygous double mutant of Ntcyp704b1: NtCYP704B1-T / S-Cas9. The wild-type NtCYP704B1-T (WT-NtCYP704B1-T) has a full-length gene of 1533 bp, including 6 exons and 5 introns; the wild-type NtCYP704B1-S (WT-NtCYP704B1-S) has a full-length gene of 1560 bp, including 6 exons and 5 introns. The Ntcyp704b1 double mutant has a 4-base deletion (TATT) at position 99-102 bp in the first exon of NtCYP704B1-T; and an insertion of a 1-base (T) at position 100 bp in the first exon of NtCYP704B1-S.

[0074] Amino acid sequence alignment analysis of the two genes in the NtCYP704B1-T / S-Cas9 mutant revealed that, compared with the unedited WT, the NtCYP704B1-T gene in the mutant had an insertion mutation at target 1, and the NtCYP704B1-S gene had a deletion mutation at target 1. These mutations caused frameshift mutations in their amino acids, and subsequent amino acid changes terminated prematurely. Therefore, the protein functions of both NTCYP704B1 genes in this mutant were lost.

[0075] Genotyping of F1 generation plants: Because the stigma and anther development of tobacco T0 generation plants grown in greenhouses are often uncoordinated, and fertility is also affected when the edited gene is related to male development, in order to propagate T0 generation plants and pass on the obtained gene-edited type, this invention uses wild-type pollen from tobacco inbred line K326 to pollinate the T0 generation plants of NtCYP704B1-T / S-Cas9 obtained above, thereby obtaining F1 generation seeds, and the plants grown are F1 generation plants.

[0076] The F1 generation includes two segregation types: Cas9-positive plants (transgenic plants) and Cas9-negative plants (non-transgenic plants). To avoid continuous editing of the K326 wild-type allele introduced by hybridization by sgRNA and Cas9, which would lead to complex mutation types, it is necessary to select plants from the F1 generation that do not contain the Cas9 gene but contain the T0 generation mutation type through genotyping. These plants can be self-crossed to obtain non-transgenic F2 generation.

[0077] The genotyping steps for F1 generation plants are as follows:

[0078] After extracting leaf DNA using the CTAB method, PCR amplification was performed using the specific primers Cas9-F (SEQ ID NO.19) and Cas9-R (SEQ ID NO.20) for the Cas9 gene.

[0079] Cas9-F primer sequence: 5'-TGTCCCAGGATTAGAATGATTAGGC-3'

[0080] Cas9-R primer sequence: 5'-AGCCCTCTTCTTTCGATCCATCAAC-3';

[0081] After performing agarose gel electrophoresis on the PCR products, Cas9-positive and Cas9-negative plants were distinguished based on the results.

[0082] Further sequencing was performed on the targets of the NtCYP704B1-T(LOC107791425) and NtCYP704B1-S genes in Cas9-negative plants; the genetic information of the T0 generation mutation type was determined based on the sequencing results.

[0083] Example 2: Phenotypic analysis of the NtCYP704B1-T / S double-mutant sterile line

[0084] F1 generation plants without the Cas9 gene, as identified in Example 1 above, were self-pollinated to obtain F2 generation seeds. One target plant of an NtCYP704b1 double mutant (NtCYP704B1-T / S-Cas9) was sown, and phenotypic analysis was conducted at maturity. In the F2 lines, the ratio of fertile to sterile plants conformed to a 15:1 segregation, further indicating that the sterility trait of the NtCYP704B1-T / S double mutant sterile line is controlled by two recessive genes. Then, a detailed phenotypic comparison was performed between the stable non-transgenic NtCYP704B1-T / S sterile line obtained in the F2 generation and the wild type.

[0085] Observation of flower, anther, and pollen viability: In terms of vegetative growth and flower development, the plants of the NtCYP704B1-T / S double-sterile line (NtCYP704B1-T / S-Cas9) were essentially no different from the wild type; in terms of flower development, the wild type could bud normally, the anthers could dehisce and release pollen normally, and it could set fruit normally after self-pollination (see...). Figures 1-2 While the NtCYP704B1-T / S double-stripe male-sterile line can bud normally, the anthers and glumes do not split open, the anthers are significantly smaller, and they are shriveled, wrinkled, and not exposed (see [reference]). Figures 4-5 Further analysis of wild-type and mutant pollen with acetocarmine revealed that wild-type pollen developed normally (see...). Figure 3 The pollen grains turn black after staining, but the mutant does not form pollen grains (see [link]). Figure 6This indicates that the NtCYP704B1-T and NtCYP704B1-S genes jointly control male development in tobacco. The NtCYP704B1-T / S double-mutant sterile line created through gene editing is a pollen-free sterile line, exhibiting complete sterility.

[0086] Scanning electron microscopy (SEM) observation of anthers: To further analyze the cytological characteristics of the NtCYP704B1-T / S double mutant sterile line, scanning electron microscopy (SEM) analysis was performed on the inner and outer walls of the anthers of wild-type and homozygous double mutants. Wild-type and mutant anthers at maturity (S13) were harvested and immediately fixed in FAA (Coolaber, China) solution, with the volume of the fixative not less than 20 times the volume of the studied material. For mutant anthers, perforations in the anther wall were made using a dissecting needle to improve the penetration of the fixative, or repeated vacuuming was performed until the anthers sank to the bottom of the fixative. After fixation at room temperature for 2 hours, the material was stored at 4°C, or sequentially dehydrated in 50%, 60%, 70%, 80%, 90%, and 100% ethanol, maintaining each gradient for 15 minutes. The material could also be stored overnight in 70% ethanol. After dehydration, the samples were subjected to critical point drying with carbon dioxide and then gold-plated for observation.

[0087] Anthers of wild-type WT and NtCYP704B1-T / S double-sterile lines, such as Figure 7 and Figure 9 As shown, the wild type has full anthers ( Figure 9 The anthers of the NtCYP704B1-T / S double-sterile line were shriveled; the anthers of the wild type were covered with well-developed pollen grains (such as...). Figure 10 (as shown); while the inner wall of the anthers of the NtCYP704B1-T / S double-sterile line lacks mature pollen grains (as shown). Figure 8 (As shown).

[0088] Furthermore, it was found that the anther epidermis of the NtCYP704B1-T / S mutant was smooth and never formed a reticulate cuticle structure, while the wild type formed a dense reticulate cuticle structure. Similarly, the inner epidermis of the NtCYP704B1-T / S mutant anthers was also smooth, without the formation of dense granular Ubnes. The anther cuticle is an extracellular lipid layer covering the surface of the anther, protecting it from external abiotic stresses, internal tissue dehydration, and pathogen invasion. Ubnes, located on the inner wall of the anther, are considered to be the transport carriers of pollenin precursors from tapetal cells to microspores. The above results indicate that simultaneous mutations in the NtCYP704B1-T (LOC107791425) and NtCYP704B1-S (LOC107809664) genes can affect the formation of the anther cuticle and block the synthesis of pollenin precursors in the tapetum.

[0089] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, modifications or variations can still be made to the technical solutions described above, and these modifications and variations all fall within the protection scope of the present invention.

Claims

1. A gene associated with male infertility in tobacco. NtCYP704B1 The application, characterized in that, Genes related to male infertility in tobacco NtCYP704B1 Two paralogous genes NtCYP704B1-T and NtCYP704B1-S Simultaneous mutation, NtCYP704B1-T and NtCYP704B1-S Both genes exhibit a loss of protein function, which is used to achieve male sterility in tobacco. NtCYP704B1-T The nucleotide sequence of the gene is shown in SEQ ID NO.1; NtCYP704B1-S The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. A gene mutant controlling male sterility in tobacco, characterized in that, The gene mutant is a gene related to male infertility in tobacco. NtCYP704B1 Two paralogous genes NtCYP704B1-T and NtCYP704B1-S Perform simultaneous mutation; In the aforementioned gene mutants NtCYP704B1-T The nucleotide sequence of the mutated gene is shown in SEQ ID NO.5; NtCYP704B1-S The nucleotide sequence of the mutated gene is shown in SEQ ID NO.

6.

3. The gene mutant for male sterility in tobacco according to claim 2, characterized in that, NtCYP704B1-T Mutant genes and NtCYP704B1-S The amino acid sequences encoded by the mutant gene are shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

4. The application of a gene mutant for male sterility in tobacco according to claim 2 or 3, characterized in that, Application of the gene mutant in the creation of male-sterile tobacco lines.

5. A method for creating male-sterile tobacco lines, characterized in that, The method includes: using the CRISPR / Cas9 method to... NtCYP704B1 Two paralogous genes of the gene NtCYP704B1-T and NtCYP704B1-S Simultaneously, gene editing is performed to obtain a gene editing vector, which is then used to obtain [genes] via Agrobacterium-mediated [process]. NtCYP704B1-T Genes and NtCYP704B1-S All genes were edited NtCYP704B1-T / S Double-mutant sterile line; Among them, gene editing was performed using the CRISPR / Cas9 method. NtCYP704B1-T Mutant genes and NtCYP704B1-S The nucleotide sequences of the mutant gene are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

6. The method for creating a male-sterile tobacco line according to claim 5, characterized in that, When using the CRISPR / Cas9 method for gene editing, NtCYP704B1-T Genes and NtCYP704B1-S The nucleotide sequences designed at the first exon of the gene and the homologous region are CRISPR / Cas9 vector editing targets as shown in SEQ ID NO.9 and SEQ ID NO.

10.

7. The method for creating a male-sterile tobacco line according to claim 5, characterized in that, The constructed gene editing vector is PKSE401-GFP-NtCYP704B1 The basic vector of the gene editing vector is PKSE401-GFP .

8. The method for creating a male-sterile tobacco line according to claim 5, characterized in that, Designed for detection NtCYP704B1-T upstream primers for gene target sites NtCYP704B1-TF and downstream primers NtCYP704B1-TR The upstream primer NtCYP704B1-TF and the downstream primers NtCYP704B1-TR The sequences are shown in SEQ ID NO.15 and SEQ ID NO.16, respectively; Designed for detection NtCYP704B1-S upstream primers for gene target sites NtCYP704B1-SF and downstream primers NtCYP704B1-SR The upstream primer NtCYP704B1-SF and the downstream primer NtCYP704B1-SR As shown in SEQ ID NO.17 and SEQ ID NO.18 respectively.

9. The method according to any one of claims 5-8 to prepare the... NtCYP704B1-T / S Application of double-sterile lines in hybridization breeding and seed production.

10. The application according to claim 9, characterized in that, The application in hybridization breeding and seed production refers to the use of the aforementioned NtCYP704B1-T / S Double-sterile lines are used as the female parent to cross with other male parents to obtain fertile hybrid F1, which is then used for production and planting.

Images