Recombinant pichia pastoris strain as well as construction method and application thereof
By integrating specific gene expression cassettes and metabolic engineering optimization in Pichia pastoral strains, using methanol as the only carbon source significantly increased the yield of juniperene, solving the problems of insufficient supply of acetyl-CoA and insufficient supply of reducing power, and achieving efficient biosynthesis.
Patent Information
- Application Number
- CN202510467006.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-08-05
AI Technical Summary
The production of juniperene in the prior art is relatively low, especially in the shortage of acetyl-CoA supply and insufficient supply of reducing power, which limits its biosynthesis efficiency and economicality.
By integrating the ERG20WW-tNPPS1, BbXFPK-CKPTA, tHMGR, ERG20WW-t37SabS1/t37SabS1 (H525F) gene expression cassettes in Pichia pastoris strains and replenishing the HIS4 gene, using methanol as the only carbon source, metabolic engineering strategies were optimized to improve the production efficiency of juniperene.
Under the conditions of feeding and fermentation of shake flasks in batches, the yield reached 3239.03 mg/L, and under the conditions of feeding and fermentation of 3L bioreactors, the yield was further increased to 6383.64 mg/L, achieving efficient biosynthesis.
Smart Images

Figure CN120424971A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the application fields of microbial genetic engineering and metabolic engineering, and particularly relates to a method for constructing a recombinant Pichia yeast strain for producing monoterpene sabinene by utilizing methanol. Background Art
[0002] Sabinene is a naturally occurring bicyclic unsaturated monoterpene compound with a unique woody aroma and exhibits antifungal, anti-inflammatory, and antioxidant activities. In addition, due to its high density and high calorific value, sabinene is considered a potential advanced biofuel (Applied microbiology and biotechnology, 2018, 102: 1535-1544). In recent years, sabinene has also shown therapeutic value in the prevention and treatment of skeletal muscle atrophy-related diseases (International Journal of Molecular Sciences, 2019, 20(19): 4955). It can also be used as an efficient solvent for the potent anticancer compound Thiazolo[5,4-b]pyridine derivatives (Molecules, 2023, 28(19): 6924). Based on the above characteristics, sabinene, as a multifunctional compound, presents a wide range of market application prospects in the fields of medicine, energy, and chemical industry. It is estimated that by 2030, the market size of sabinene will reach US$3.8 billion.
[0003] Compared with traditional extraction methods, sabinene biosynthesis offers advantages such as high efficiency, sustainability, environmental friendliness, and significant economic benefits (Microbial cell factories, 2014, 13:1-10; Biotechnology for biofuels, 2020, 13:1-15), providing a viable alternative strategy for its production. Currently, a variety of microorganisms have been used for sabinene biosynthesis. In 2020, Jia et al. co-expressed a truncated form of sabinene synthase t34SabS1 and the mitochondrial-associated protein AIM25 in Saccharomyces cerevisiae as a host, producing 154.9 mg / L of sabinene in shake flask cultures using glucose as a carbon source (Biochemical Engineering Journal, 2020, 164:107768). However, sabinene yields remain relatively low compared to other monoterpenes. This may be due to a lack of global metabolic regulation strategies during sabinene biosynthesis, particularly inadequate supply of acetyl-CoA and reducing power.
[0004] In response to the problem of insufficient acetyl-CoA supply, in recent years, acetyl-CoA synthesis strategies such as the phosphoketolase-phosphotransacetylase (PK-PTA) pathway and the ATP-citrate lyase (ACL) catalytic pathway have been widely used to synthesize target products (Nature biotechnology, 2017, 35(2):173-177; Nature communications, 2016, 7(1):1-9; Proceedings of the National Academy of Sciences, 2022, 119(29):e2201711119). The PK-PTA pathway converts xylulose-5-phosphate (Xu5P) or fructose-6-phosphate (F6P) into acetyl-CoA through phosphoketolase (XFPK) and phosphotransacetylase (PTA), while ACL converts cytosolic citrate into acetyl-CoA.
[0005] In addition, although the strategy of enhancing biosynthesis by adjusting reducing power is effective, it requires the regulation of multiple genes or metabolic pathways, which can easily lead to energy imbalance (ACS Sustainable Chemistry & Engineering, 2024, 12(26): 9704-9715). Directly using high-reducing power substrates (such as ethanol, glycerol, and mannitol) to provide sufficient reducing equivalents for host metabolic conversion has been proven to significantly promote the biosynthesis of target products (Metabolic Engineering, 2021, 66: 51-59; Molecules, 2020, 25(8): 1881; Chemical Engineering Journal, 2024, 487: 150577). However, the economic efficiency of carbon sources such as ethanol, glycerol, and mannitol is significantly lower than that of traditional carbon sources such as glucose, limiting their application in large-scale industry (Journal of Agricultural and Food Chemistry, 2024, 72(17): 9984-9993).
[0006] Therefore, it is of great significance to develop a recombinant strain that produces the monoterpene sabinene with high yield and economy. Summary of the Invention
[0007] The present invention aims to provide a method for constructing a Pichia pastoris strain for producing the monoterpene sabinene using methanol as the sole carbon source and its application.
[0008] Another object of the present invention is to provide a method for constructing a Pichia pastoris strain that uses methanol as the sole carbon source to highly produce the monoterpene sabinene and its application.
[0009] The purpose of the present invention is achieved through the following technical solutions:
[0010] A method for constructing a recombinant Pichia pastoris strain comprises transferring a sabinene synthase gene SabS1 from sage (Salvia pomifera) into the Int-S1 site of a Pichia pastoris strain through genome integration technology to obtain a recombinant strain; the sequence of the sabinene synthase gene SabS1 is shown in SEQ ID NO: 1;
[0011] The recombinant strain integrates the farnesyl pyrophosphate synthase mutant ERG20 at the chromosome Int-S2 site. WW (ERG20 F98W / N129W ) and the expression cassette for tomato neryl diphosphate synthase tNPPS1, ERG20 WW and tNPPS1 are connected by a connecting peptide, wherein the connecting peptide is GSGSGSGSGS, wherein ERG20 WW The gene sequence is shown in SEQ ID NO: 3, which is derived from the endogenous ERG20 gene of Pichia pastoris and obtained by mutating amino acid F at position 98 to W and amino acid F at position 129 to W; the amino acid sequence of tNPPS1 is shown in SEQ ID NO: 2, which is derived from tomato (Solanum lycopersicum) and obtained by truncating amino acids 2-44 after codon optimization; the GSGSGSGSGS gene sequence is GGTTCTGGTTCTGGTTCTGGTTCTGGTTCT.
[0012] The recombinant strain integrates an expression cassette containing Bifidobacterium breve phosphoketolase BbXFPK and Clostridium kluyveri phosphotransacetylase CKPTA at the chromosome Int-S4 site, wherein the gene sequence encoding BbXFPK is shown in SEQ ID NO: 6, and the gene sequence encoding CKPTA is shown in SEQ ID NO: 7;
[0013] The recombinant strain integrates an expression cassette containing a truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR at the chromosome Int-S6 site, and the gene sequence encoding tHMGR is shown in SEQ ID NO: 8;
[0014] The recombinant strain integrates the farnesyl pyrophosphate synthase mutant ERG20 at the chromosome Int-S7 site. WW and the expression cassette of the truncated sabinene synthase mutant t37SabS1 / t37SabS1(H525F), encoding ERG20 WWThe gene sequence is shown in SEQ ID NO: 3. The gene sequence encoding t37SabS1 is shown in SEQ ID NO: 4. t37SabS1(H525F) is derived from t37SabS1 by mutating the 525th amino acid H to F. The t37SabS1(H525F) gene sequence is obtained by replacing CAT(H) with TTC(F) at bp 1573-1575 of SEQ ID NO: 4. The gene sequence encoding tNPPS1 is shown in SEQ ID NO: 5.
[0015] Preferably, the construction method further comprises complementing the HIS4 gene in the recombinant strain, and the gene sequence is shown in SEQ ID NO: 9.
[0016] Preferably, the Pichia pastoris strain is a wild-type Pichia pastoris GS115 in which a RAD52 gene expression cassette is integrated; the RAD52 gene expression cassette P GAP -RAD52-T AOX1 , integrated into the promoter site of the AOX1 gene through a plasmid, the GeneID of the RAD52 gene is: 8198537.
[0017] Preferably, the expression cassette for integrating SabS1 into the chromosome Int-S1 site is P GAP -SabS1-T AOX1 , where the promoter is P GAP , the terminator is T AOX1 .
[0018] Preferably, the expression cassette integrated into the chromosome Int-S2 site is P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 .
[0019] Preferably, the expression cassette integrated into the chromosome Int-S4 site is T FLD1 -BbXFPK-P HTX1 -CKPTA-T FDH1 , where the promoter is P HTX1 , the terminator is T FLD1 、T FDH1 .
[0020] Preferably, the expression cassette integrated into the chromosome Int-S6 site is P AOX1 -tHMGR-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 .
[0021] Preferably, the expression cassette integrated into the chromosome Int-S7 site is P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 or P AOX1 -ERG20 WW -5GS-t37SabS1(H525F)-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 .
[0022] The recombinant Pichia pastoris strain prepared by the method is used in fermentation production of monoterpene sabinene using methanol as a carbon source.
[0023] The host strain is recombinant Pichia pastoris SC01, and its construction process is as follows:
[0024] a. Using wild-type Pichia pastoris GS115 as the starting strain, the recombinant strain SCV02 was obtained by overexpressing the Pichia pastoris homologous recombinase gene RAD52 through plasmid integration technology;
[0025] b. The recombinant strain SCV02 was integrated into the genome to express the codon-optimized sabinene synthase gene SabS1 (nucleotide sequence shown in SEQ ID NO: 1) to obtain the recombinant strain SC01, which was endowed with sabinene production capacity.
[0026] The specific steps of plasmid integration technology are as follows: (1) Construct the expression vector pPICZA-P containing RAD52 nucleotide sequence GAP -RAD52-T AOX1 ; (2) introducing the expression vector into wild-type Pichia pastoris to obtain recombinant yeast strain SCV02.
[0027] Construction and introduction of expression vector pPICZA-P GAP -RAD52-T AOX1 , the specific steps are as follows:
[0028] (1) Amplify promoter P GAP , terminator T AOX1 and the RAD52 gene fragment, and P was obtained by overlap extension PCR. GAP -RAD52-T AOX1 The expression cassette fragment was ligated into the commercial expression vector pPICZA by seamless cloning;
[0029] (2) The recombinant vector pPICZA-P was verified by PCR and sequencing. GAP -RAD52-T AOX1electrotransformed into Pichia pastoris;
[0030] (3) Spread the bacterial solution on a Zeocin-resistant YPD plate and incubate at 30°C for 3 days;
[0031] (4) The transformed cells were streaked onto Zeocin-resistant YPD plates one by one and cultured at 30°C for 2 days.
[0032] (5) After PCR verification and sequencing verification, the correct transformants were preserved or used for the next experiment to obtain recombinant yeast SCV02.
[0033] The following expression vector construction and introduction methods are similar. The genome integration technology method is as follows:
[0034] (1) Constructing a donor DNA containing the SabS1 nucleotide sequence shown in SEQ ID NO: 1 and an expression vector containing gRNA (Int-S1)-Cas9;
[0035] (2) The donor DNA was integrated into the neutral site Int-S1 of the Pichia pastoris strain SCV02 using the CRISPR-Cas9 system and homologous recombination mechanism to obtain the recombinant yeast strain SC01.
[0036] The neutral site Int-S1 was named PNSI-1 in a previous report (Nucleic Acids Research, 2021, 49(13):7791-7805).
[0037] The specific steps for constructing the donor DNA are as follows:
[0038] (1) Amplify 1000bp upstream and downstream of Int-S1 and promoter P GAP , terminator T ADH2 and a fragment of the gene SabS1;
[0039] (2) Obtain Int-S1-UP-P by overlap extension PCR GAP -SabS1-T ADH2 -Int-S1-DOWN donor DNA fragment.
[0040] The terminator T ADH2 It is the Pichia pastoris alcohol dehydrogenase 2 terminator.
[0041] The gRNA (Int-S1)-Cas9 expression vector was constructed as follows:
[0042] (1) The vector was constructed based on the commercial gene knockout backbone plasmid BB3cK_pGAP_23*_pPFK300_Cas9;
[0043] (2) The assembly method of the vector was similar to that of a previously reported research paper (Recombinant protein production in yeast, 2019: 211-225; Synthetic and Systems Biotechnology, 2023, 8(3): 445-451), i.e., the promoter P of the BB3cK_pGAP_23*_pPFK300_Cas9 plasmid framework was GAP Sequence and terminator T RPS25A Between the sequences, add the "variable N6 sequence-hammerhead ribozyme-g20-gRNA scaffold-HDVribozyme" fragment;
[0044] (3) The first construction of the "variable N6 sequence-hammerhead ribozyme-g20-gRNA scaffold-HDVribozyme" fragment requires the overlap extension PCR method; wherein the variable N6 sequence is the reverse complementary sequence of the first 6 bases of the gRNA targeting the site Int-S1, and the g20 is a 20 bp gRNA targeting the site Int-S1;
[0045] (4) When constructing other gRNA-Cas9 expression vectors, the variable N6 sequence and g20 corresponding to the neutral site are directly replaced by reverse PCR and seamless cloning technology; the sequences and positions of the hammerhead ribozyme, gRNA scaffold, and HDVribozyme remain fixed.
[0046] The CRISPR-Cas9 system and homologous recombination mechanism are used to integrate the donor DNA into the neutral site of the Pichia pastoris strain, and the steps are as follows:
[0047] (1) The donor DNA fragment and gRNA (Int-S1)-Cas9 expression vector constructed above were co-transformed into Pichia pastoris SCV02 by electroporation, and the bacterial solution was spread on a geneticin (G418)-resistant YPD plate and cultured at 30°C for 3 days;
[0048] (2) The transformed cells were streaked onto G418-resistant YPD plates one by one and cultured at 30°C for 2 days;
[0049] (3) After PCR verification and sequencing verification, the correct transformants were preserved or used for the next experiment to obtain the recombinant yeast strain SC01.
[0050] The recombinant yeast strain SC01 needs to be cultured in YPD liquid for two generations, the plasmid gRNA (Int-S1)-Cas9 is removed, and the recombinant yeast strain SC01 that can be used for subsequent iterative gene editing is obtained by screening and streaking.
[0051] The strain is used to ferment and produce the monoterpene sabinene using methanol as the sole carbon source. The specific method of fermentation production is as follows:
[0052] (1) Activation of bacterial strains: Streak the glycerol stock stored at -80°C onto a YPD plate and incubate at 30°C for 3 days;
[0053] (2) Preparation of primary seed solution: Select a single colony and inoculate it into YPD liquid medium. Cultivate it with shaking at 30°C and 200 rpm for 24 h. This is the primary seed solution. The volume of the solution is 10 mL / 50 mL conical flask.
[0054] (3) Preparation of secondary seed solution: Inoculate the primary seed solution into YPD liquid medium at a 2% inoculum volume ratio and shake-culture at 30°C and 200 rpm for 24 h to prepare the secondary seed solution. The volume of the solution was 10 mL / 50 mL conical flask.
[0055] (4) Shake flask fed batch fermentation: take the secondary seed liquid and inoculate it into MM liquid medium at a 2% inoculation volume ratio. The initial OD 600 The fermentation was carried out at a pressure of 0.6-0.8°C, 200 rpm, and a volume of 30 mL / 100 mL Erlenmeyer flask. 1% MM liquid culture medium was added every 24 hours. At the start of fermentation, an extractant was added (the volume ratio of culture medium to extractant was 5:1). After 120 hours, samples were taken for biomass analysis and the sabinene content of the product was analyzed by gas chromatography (GC).
[0056] The specific components of the culture medium used are as follows: (1) YPD medium: 2% peptone, 2% glucose, 1% yeast extract; (2) minimal (MM) liquid medium: 0.25% (NH4)2SO4, 1.44% KH2PO4, 0.05% MgSO4·7H2O, 1% methanol, vitamin solution (0.0001% calcium pantothenate, 0.0001% niacin, 0.0025% inositol, 0.0001% thiamine hydrochloride, 0.0001% pyridoxine hydrochloride and 0.00002% p-aminobenzoic acid), and 0.4% sterile trace element solution PTM1 (0.6% CuSO4·5H2O, 0.008% NaI, 0.3% MnSO4·H2O, 0.02% Na2MoO4·2H2O, 0.002% H3BO3, 0.05% CoCl2, 2% ZnCl2, 6.5% FeSO4·7H2O and 0.02% biotin). Add an appropriate amount of histidine according to the strain defect type.
[0057] The initial pH of the MM liquid medium was adjusted to 5.5-5.8 with 5M NaOH solution. The MM liquid medium composition was further modified based on the minimal medium reported by Cai et al. (Proceedings of the National Academy of Sciences, 2022, 119(29):e2201711119). After the MM liquid medium was prepared, it was sterilized by filtration.
[0058] The extraction solvent used was isopropyl myristate.
[0059] A method for constructing a Pichia pastoris strain that can produce a high yield of the monoterpene sabinene using methanol as the sole carbon source, wherein the host strain SC01 is obtained using the aforementioned construction method, and metabolic engineering is performed using SC01, which has preliminary sabinene synthesis capability, as the starting strain. The construction method comprises:
[0060] (1) A farnesyl pyrophosphate synthase mutant and different truncated forms of sabinene synthase or neryl diphosphate synthase were fused and expressed at the neutral site Int-S2 of the strain genome to obtain recombinant strains SC02, SC03 and SC04; wherein the farnesyl pyrophosphate synthase mutant is derived from the variant gene ERG20 WW (ie ERG20 F98W / N129W ), the different truncated forms of sabinene synthase are encoded by gene t34SabS1 or t37SabS1, and the neryl diphosphate synthase is encoded by gene tNPPS1 (mature form of NPPS1).
[0061] The neutral site Int-S2 was named Int6 in a previous report (ACS Synthetic Biology, 2022, 11(2): 623-633).
[0062] The t34SabS1 gene was obtained from the paper (Biochemical Engineering Journal, 2020, 164: 107768) after codon optimization.
[0063] The fusion expression is ERG20 WW The gene is at the N-terminus, the t34SabS1 or t37SabS1 or tNPPS1 gene is located at the C-terminus, and the two are connected by a connecting peptide.
[0064] The promoter selected for the fusion expression is P AOX1 , the terminator is T AOX1 Specifically, the fragment P AOX1 -ERG20 WW -5GS-t34SabS1-T AOX1 or P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 or P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 Integration into the Int-S2 site of the host strain SC01. The integration process involved constructing a donor DNA containing the aforementioned fragment and 1000 bp upstream and downstream of Int-S1, as well as an expression vector containing gRNA (Int-S2)-Cas9. The donor DNA was then integrated into SC01 using the aforementioned genomic integration technique to obtain recombinant yeast strains SC02, SC03, and SC04.
[0065] The promoter P AOX1 is the Pichia pastoris alcohol oxidase 1 promoter;
[0066] The strains SC02, SC03 and SC04 were screened and obtained as preferred strains through the aforementioned fermentation production method.
[0067] In summary, the preferred strain is one that expresses ERG20 in fusion. WW and tNPPS1 genes, so that it has the ability to express the sabinene precursor NPP, while optimizing the ability to express the sabinene synthesis precursor GPP; the preferred strain is SC04, which is used as the starting strain for subsequent optimization.
[0068] (2) The dihydroxyacetone oxidase gene DAS2 from Pichia pastoris was overexpressed at the neutral site Int-S3 of the genome of the preferred strain SC04, the phosphoketolase gene BbXFPK from Bifidobacterium breve and the phosphotransacetylase gene CKPTA from Clostridium kluyveri were co-expressed at the neutral site Int-S4, and the ATP citrate lyase gene MmACL from Mus musculus was overexpressed at the neutral site Int-S5 to obtain recombinant strains SC05, SC06 and SC07.
[0069] The MmACL gene is derived from a paper (Proceedings of the National Academy of Sciences, 2022, 119(29): e2201711119).
[0070] The neutral sites Int-S3, Int-S4, and Int-S5 were named PNSII-4, PNSIV-9, and PNSI-2, respectively, in previous reports (Nucleic Acids Research, 2021, 49(13):7791-7805).
[0071] Further:
[0072] S1. Overexpression of gene DAS2
[0073] The promoter selected for expression is P DAS2 , the terminator is T GAP Specifically, the DNA fragment P DAS2 -DAS2-T GAP Integration into the Int-S3 locus of the host strain SC04. The integration process involves constructing a donor DNA containing the aforementioned DNA fragment and 1000 bp upstream and downstream of Int-S3, as well as an expression vector containing gRNA (Int-S3)-Cas9. The donor DNA is then integrated into SC04 using the aforementioned genomic integration technique to obtain the recombinant yeast strain SC05.
[0074] The promoter P DAS2 is the promoter of the Pichia pastoris dihydroxyacetone oxidase gene DAS2; the terminator T GAP It is the terminator of the Pichia pastoris glyceraldehyde-3-phosphate dehydrogenase gene GAP.
[0075] S2, co-expression of genes BbXFPK and CKPTA
[0076] The promoter selected for expression is a bidirectional promoter PHTX1 , the terminator is T FLD1 and T FDH1 Specifically, the DNA fragment T FLD1 -BbXFPK-P HTX1 -CKPTA-T FDH1 Integration into the Int-S4 locus of the host strain SC04. The integration process involves constructing a donor DNA containing the aforementioned DNA fragment and 1000 bp upstream and downstream of Int-S4, as well as an expression vector containing gRNA (Int-S4)-Cas9. The donor DNA is integrated into SC04 using the aforementioned genomic integration technique to obtain the recombinant yeast strain SC06.
[0077] The promoter P HTX1 is the promoter of Pichia pastoris histone HTA1 and HTB1 genes; the terminator T FLD1 is the terminator of Pichia pastoris formaldehyde dehydrogenase gene FLD1; the terminator T FDH1 It is the terminator of the Pichia pastoris formate dehydrogenase gene FDH1.
[0078] S3. Overexpression of the gene MmACL
[0079] The promoter selected for expression is P AOX1 , the terminator is T AOX1 Specifically, the DNA fragment P AOX1 -MmACL-T AOX1 Integration into the Int-S5 locus of the host strain SC04. The integration process involves constructing a donor DNA containing the aforementioned DNA fragment and 1000 bp upstream and downstream of Int-S5, as well as an expression vector containing gRNA (Int-S5)-Cas9. The donor DNA is integrated into SC04 using the aforementioned genomic integration technique to obtain the recombinant strain SC07.
[0080] The strains SC05, SC06 and SC07 were screened and obtained as preferred strains through the aforementioned fermentation production method.
[0081] In summary, the preferred strain is a strain that co-expresses the BbXFPK and CKPTA genes, so that it can obtain a high flux of the central carbon metabolite acetyl-CoA; the preferred strain is SC06, which is used as the starting strain for subsequent optimization.
[0082] (3) In the above-mentioned preferred strain SC06, the MVA pathway was optimized, involving the individual expression, fusion expression, or co-expression of genes ERG10, ERG13, ERG8, ERG12, ERG19, IDI1, HMGR, tHMGR, and tHMG1, with the target site being the genomic neutral site Int-S6, to screen for further preferred strains.
[0083] The tHMGR gene is derived from the Pichia pastoris HMGR gene and is obtained by truncating the N-terminal amino acids 2-505, and the nucleotide sequence is shown in SEQ ID NO: 8; the tHMG1 gene is derived from the Saccharomyces cerevisiae CEN.PK2-1C HMG1 gene (Sequence ID: M22002.1) and is obtained by truncating the N-terminal amino acids 2-530.
[0084] The single expression refers to the integration of genes IDI1, HMGR, tHMGR and tHMG1 into the genomic chromosome in the form of a single gene expression cassette; the fusion expression refers to the integration of genes ERG10 and ERG13, as well as genes ERG8 and ERG12 into the genomic chromosome in the form of a fusion gene expression cassette via a connecting peptide; the connecting peptide refers to 5GS; the co-expression refers to the integration of fused genes ERG8, ERG12 and ERG19 via a bidirectional promoter P HTX1 It is integrated into the genomic chromosome in the form of a co-expression gene expression cassette.
[0085] The neutral site Int-S6 was named Int10 in a previous report (ACS Synthetic Biology, 2022, 11(2): 623-633).
[0086] The specific operation is as follows: the constructed DNA fragment P AOX1 -ERG10-5GS-ERG13-T AOX1 、T FLD1 -ERG8-5GS-ERG12-P HT X1 -ERG19-T FDH1 、P AOX1 -IDI1-T AOX1 、P AOX1 -HMGR-T AOX1 、P AOX1 -tHMGR-T AOX1 and P AOX1 -tHMG1-T AOX1Integration into the Int-S6 locus of host strain SC06. The integration process involves constructing a donor DNA containing the aforementioned DNA fragment and 1000 bp upstream and downstream of Int-S6, as well as an expression vector containing gRNA (Int-S6)-Cas9. The donor DNA is then integrated into SC06 using the aforementioned genomic integration technique to obtain recombinant strains SC09 to SC14.
[0087] The strains SC09 to SC14 are selected as preferred strains through the aforementioned fermentation production method.
[0088] In summary, the preferred strain is a strain that overexpresses the tHMGR gene, which can relieve feedback inhibition and obtain significantly improved mevalonate flux; the preferred strain is SC13, which is used as the starting strain for subsequent optimization.
[0089] (4) A farnesyl pyrophosphate synthase mutant and a truncated sabinene synthase or its mutant were fused and expressed at the neutral site Int-S7 of the genome of the preferred strain SC13, and a farnesyl pyrophosphate synthase mutant and neryl diphosphate synthase were fused and expressed at Int-S8 to obtain recombinant strains SC16, SC17 and SC18, respectively; wherein the farnesyl pyrophosphate synthase mutant is expressed by the variant gene ERG20 WW (ie ERG20 F98W / N129W ), the truncated sabinene synthase is encoded by the gene t37SabS1, the truncated sabinene synthase mutant is encoded by the gene t37SabS1(H525F), and the neryl diphosphate synthase is encoded by the gene tNPPS1 (mature form of NPPS1).
[0090] The neutral sites Int-S7 and Int-S8 were named PNSII-5 and Int15 in previous reports (Nucleic Acids Research, 2021, 49(13):7791-7805; ACS Synthetic Biology, 2022, 11(2):623-633); the promoter selected for the fusion expression is P AOX1 , the terminator is T AOX1 .
[0091] The fusion expression is ERG20 WW The gene is at the N-terminal, the t37SabS1 or t37SabS1 (H525F) or tNPPS1 gene is at the C-terminal, and the two are connected by a connecting peptide; the connecting peptide is 5GS.
[0092] Specifically: the constructed DNA fragment P AOX1 -ERG20 WW -5GS-t37SabS1-TAOX1 or P AOX1 -ERG20 WW -5GS-t37SabS1(H525F)-T AOX1 Integrate into the Int-S7 site of host bacteria SC13, and construct the completed DNA fragment P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 Integration into the Int-S8 site of host yeast SC13. The integration process involves constructing a donor DNA containing the aforementioned DNA fragment and 1000 bp upstream and downstream of Int-S7 or Int-S8, as well as an expression vector containing gRNA (Int-S7)-Cas9 or gRNA (Int-S8)-Cas9. The donor DNA is then integrated into SC13 using the aforementioned genomic integration technique to obtain recombinant yeast strains SC16, SC17, and SC18.
[0093] In summary, the preferred strain is one that expresses ERG20 in fusion. WW The strain carrying the t37SabS1(H525F) gene has increased levels of the intracellular sabinene synthesis precursor GPP and sabinene synthase, and the sabinene synthase encoded by the variant t37SabS1(H525F) gene also has specificity for the intracellular precursor NPP; the preferred strain is SC17, which was used as the starting strain for subsequent optimization.
[0094] (5) Furthermore, the construction method also includes using the commercial expression vector pPIC9K to complement the HIS4 gene in the SC17 genome through the aforementioned plasmid integration technology to repair the histidine auxotrophic yeast strain SC17, thereby obtaining the prototrophic yeast strain SC21.
[0095] The present invention further provides a method for scaled-up production of sabinene in a 3 L bioreactor, wherein methanol is used as the sole carbon source, as follows:
[0096] (1) Activation of bacterial strains: Streak the glycerol stock stored at -80°C onto MD plates and incubate at 30°C for 3 days;
[0097] (2) Preparation of primary seed solution: Select a single colony and inoculate it into MD liquid medium. Shake and culture at 30°C and 200 rpm for 24 h to prepare the primary seed solution. The volume of the solution is 10 mL / 50 mL conical flask.
[0098] (3) Preparation of secondary seed solution: The primary seed solution was inoculated into MD liquid medium at a 5% inoculum volume ratio and cultured at 30°C and 200 rpm for 24 h to prepare the secondary seed solution. The volume of the solution was 50 mL / 250 mL conical flask.
[0099] (4) Bioreactor fed-batch fermentation: carried out in a 3 L bioreactor with an initial working volume of 1 L. The secondary seed liquid was inoculated into 950 mL of minimal (MM) liquid medium at a 5% inoculation volume ratio, and the initial OD 600 is 0.8 to 1.0. At the beginning of fermentation, 200 mL of extractant is added. During the fermentation process, the temperature is maintained at 30°C and the pH value is controlled between 5.5 and 5.6 by 30% (v / v) ammonia water. According to the dissolved oxygen (DO) level varying between 20% and 30%, the stirring speed is gradually increased from 250 rpm to 1000 rpm, and the ventilation volume is set to 0.3 to 1 L / min. The fermentation is divided into two stages: the first stage requires the depletion of 1% methanol in the initial MM liquid culture medium, which lasts for about 7-8 hours; in the second stage, after the methanol is depleted, feeding begins. The feeding solution includes methanol-PTM1 solution and MM-1 liquid culture medium, with feeding rates of 3-4 mL / h and 1.5-2 mL / h, respectively. The biomass is sampled at fixed points and the content of the product sabinene is analyzed by gas chromatography (GC).
[0100] The MD medium includes 2% glucose and 1.34% YNB without amino acids. The MM-1 liquid medium is derived from the MM liquid medium and does not contain methanol or PTM1. The extraction solvent used is isopropyl myristate.
[0101] Compared with the prior art, the present invention has the following beneficial effects:
[0102] (1) The present invention provides a method for constructing a Pichia pastoris strain that can produce high-yield monoterpene sabinene using methanol as the sole carbon source and its application. WW -tNPPS1, BbXFPK-CKPTA, tHMGR, ERG20 WW By expressing the -5GS-t37SabS1 / t37SabS1(H525F) gene expression cassette and complementing the HIS4 gene, the sabinene yield reached 3239.03 mg / L under fed-batch fermentation conditions in a 100-mL shake flask with a 30-mL liquid volume. In a 3-L bioreactor with fed-batch fermentation conditions, the sabinene yield was further increased to 6383.64 mg / L.
[0103] (2) The present invention has for the first time achieved the goal of efficiently biosynthesizing the monoterpene sabinene by Pichia pastoris using methanol as the sole carbon source, providing a feasible technical path for the construction of Pichia pastoris cell factories and methanol biorefining, while significantly improving the production efficiency of sabinene. BRIEF DESCRIPTION OF THE DRAWINGS
[0104] Figure 1 Schematic diagram of the metabolic engineering strategy used in this application to transform Pichia pastoris to synthesize sabinene from methanol;
[0105] Figure 2 is the mass spectrometry analysis result of the recombinant Pichia pastoris fermentation product; Figure 2 A is the mass spectrum of sabinene standard and SC04 fermentation product, Figure 2 B is the retention time diagram of SC04, GS115 fermentation products and sabinene standards;
[0106] Figure 3 To express ERG20 in MM liquid medium under fed-batch fermentation conditions. WW -t34SabS1、ERG20 WW -t37SabS1 and ERG20 WW -Effects of tNPPS1 gene on sabinene yield and biomass;
[0107] Figure 4 To investigate the effects of genomic overexpression of DAS2, BbXFPK-CKPTA, and MmACL on sabinene production and biomass under shake flask fed-batch fermentation conditions in MM liquid medium.
[0108] Figure 5 To investigate the effects of genomic overexpression of ERG10-ERG13, ERG8-ERG12-ERG19, IDI1, HMGR, tHMGR, and tHMG1 on sabinene production and biomass under shake flask fed-batch fermentation conditions in MM liquid medium.
[0109] Figure 6 To express ERG20 in MM liquid medium under fed-batch fermentation conditions. WW -t37SabS1、ERG20 WW -t37SabS1(H525F) and ERG20WW-tNPPS1 on sabinene yield and biomass;
[0110] Figure 7 The effect of HIS4 gene supplementation on sabinene yield and biomass under MM liquid medium shake flask fed-batch fermentation conditions was investigated. Figure 7 A is the effect on sabinene production, Figure 7 B is the effect on biomass;
[0111] Figure 8 The results show the fermentation performance of high-sabinene-producing strain SC21 under fed-batch fermentation conditions in a 3L bioreactor. DETAILED DESCRIPTION
[0112] Unless otherwise specified in the following examples, the experimental methods used are conventional methods, and the materials and reagents used can be purchased from biological or chemical companies.
[0113] The present invention provides a method for biosynthesizing sabinene based on Pichia pastoris, using methanol as an economical non-glycosyl carbon source with high reducing equivalent, and expressing ERG20 in recombinant Pichia pastoris with low sabinene production. WW By optimizing precursor metabolic flux with the tNPPS1 gene, integrating the PK-PTA pathway to enhance acetyl-CoA supply, and employing an MVA pathway optimization strategy to overexpress a truncated tHMGR gene, the team also constructed a high-yield strain using methanol as the sole carbon source, significantly improving sabinene biosynthesis efficiency.
[0114] The strains constructed in the following examples (except SC21) were fermented using methanol as the sole carbon source to obtain the monoterpene sabinene. The fermentation conditions were as follows:
[0115] Shake flask fermentation: Take the glycerol bacteria stored at -80℃, streak inoculate on YPD plate, incubate at 30℃ for 3 days, pick a single colony and transfer to 10mL YPD liquid medium, shake culture at 30℃ and 200rpm for 24h; then transfer to fresh 10mL YPD liquid medium at 2% inoculum, continue to expand under the same conditions for 24h to obtain fermentation seed liquid. 600 0.6-0.8% of the strain was inoculated into MM liquid medium and fermented in shake flasks (30 mL / 100 mL Erlenmeyer flask) at 30°C and 200 rpm. During fermentation, 1% MM liquid medium was added every 24 hours. Initially, isopropyl myristate was added as an extractant at a medium to extractant volume ratio of 5:1. After 120 hours of fermentation, samples were collected for biomass determination and sabinene product content was quantitatively analyzed by GC. Three replicates were performed for each strain.
[0116] The specific fermentation conditions of SC21 are as follows:
[0117] Shake flask fermentation: The glycerol culture was removed from a -80°C freezer and streaked onto a MD plate. The plate was incubated at 30°C for 3 days. A single colony was picked and transferred to 10 mL of MD liquid medium. The culture was shaken at 30°C and 200 rpm for 24 h. Subsequently, a 2% inoculum size was transferred to 10 mL of fresh MD liquid medium and the culture was continued under the same conditions for 24 h to obtain a fermentation seed solution. The following procedures were the same as those for shake flask fermentation.
[0118] Bioreactor fermentation: carried out in a 3L bioreactor with an initial liquid volume of 1L. The seed liquid preparation process is as follows: streak the glycerol bacteria stored at -80℃ onto the MD plate, culture at 30℃ for 3 days, pick a single colony and inoculate it into 10mL MD liquid medium, culture at 30℃ and 200rpm for 24h, then transfer it to 50mL MD medium at a 5% inoculation volume and expand it under the same conditions as the fermentation seed liquid. Take the seed liquid and inoculate it into 950mL MM medium, and the initial OD 600 The pH value was 0.8 to 1.0. 200 mL of extractant was added at the beginning of the fermentation. The temperature was maintained at 30°C throughout the fermentation. 30% (v / v) ammonia was used to maintain the pH at 5.5-5.6. The stirring rate (250-1000 rpm) and the aeration rate (0.3-1 L / min) were gradually increased according to the DO value (20%-30%). The two-stage fermentation parameters were as follows:
[0119] Methanol adaptation period: deplete 1% methanol in MM medium, which takes 7-8 hours. Feeding period: replenish methanol-PTM1 mixture (0.4% PTM1) and MM-1 medium at feeding rates of 3-4 mL / h and 1.5-2 mL / h, respectively, for a total feed volume of approximately 550 mL and 300 mL.
[0120] Samples were collected regularly for biomass analysis, and sabinene production was determined using GC. This experiment was repeated three times.
[0121] The metabolic pathway and metabolic modification strategy for Pichia pastoris to synthesize sabinene using methanol as a carbon source Figure 1 shown.
[0122] Example 1: Construction of recombinant strains SCV02 (RAD52 overexpression) and SC01 (SabS1 genome integration)
[0123] The starting strain was wild-type Pichia pastoris GS115.
[0124] (1) Construction of expression vector pPICZA-P GAP -RAD52-T AOX1 and recombinant strain SCV02:
[0125] The Pichia pastoris genome was used as a template and the primers pGAP-pPICZA-F (GATCCTTTTTTGTAGAAATGTCTTGG) and pGAP-SabS1-R (TGCAAAGAGTTCAATGGCATTGTGTTTTGATAGTTGTTCAATTGATTG) were used to obtain the promoter P. GAPThe RAD52 gene was obtained using primers RAD52-F (ATGTCTTTCGATGACGCTGAG) and RAD52-R (CTTAATTCGAAGCTGGAGAGTTTTC); the terminator T was obtained using the commercial expression vector pPICZA as a template using primers RAD52-HF (ACTCTCCAGCTTCGAATTAAGGGAATTCACGTGGCCCAG) and TAOX1-PAOX1-R (TCGTCTTTGGATGTTAGATCTCTCACTTAATCTTCTGTACTCTGAAGA) AOX1 ; Use overlap extension PCR to splice the above amplified products to obtain fragment P GAP -RAD52-T AOX1 .
[0126] The commercial expression vector pPICZA was used as a template and primers pPICZA-TAOX1-F (GATCTAACATCCAAAGACGAAAGG) and pPICZA-pGAP-R (CATTTCTACAAAAAAGGATCTGATCTCATGACCAAAATCCCTTAAC) were used to obtain the linearized vector pPICZA.
[0127] The above clip is from KOD One of Toyobo Co., Ltd. TM The PCR reaction system and amplification procedure were strictly carried out in accordance with the operating specifications of the reagent package insert.
[0128] The above fragments were purified and recovered using the DNA product purification kit produced by Nanjing Novozymes Biotechnology Co., Ltd., and the linearized vector pPICZA was recombined with the spliced fragments using seamless cloning technology to obtain the expression vector pPICZA-P GAP -RAD52-T AOX1 ; All operations described were performed strictly in accordance with the operating specifications of the kit's instructions.
[0129] The expression vector pPICZA-P GAP -RAD52-T AOX1 As a template, the vector was linearized with primers L-pPICZA-F (AAACGCTGTCTTGGAACCTAATATG) and L-pPICZA-R (AAACTGTCAGTTTTGGGCCA), and the linearized vector was purified and recovered. GAP -RAD52-T AOX1The gene was electroporated into Pichia pastoris competent cells, and a single transformant colony was picked. PCR verification was performed using primers C2-F (GGTCGGAGGTCGTGTCCA) and C-pP-52-R (CCAAGTTTGCCAATCTTCCG) to obtain the engineered Pichia pastoris strain SCV02 expressing the homologous recombinase gene RAD52 in the plasmid.
[0130] The specific electroporation steps are as follows: take 1 μg of linearized vector fragment and gently mix it with competent cells melted on ice, transfer it to a pre-cooled electroporation cup and ice bath for 5 minutes (Note: if using donor DNA, the amount is 3-5 μg; if it is a gRNA-Cas9 expression vector, the amount is 500 ng-1 μg); then set the electroporation instrument parameters to 1500 V, 5 ms for electroporation, and immediately add 1 mL of pre-cooled 1 M sorbitol solution to the electroporation cup after completion. After tapping to mix, transfer it to a 1.5 mL centrifuge tube and incubate at 30°C for 1.5-2 hours; after the incubation is completed, centrifuge at 5000 r / min for 1 minute to collect the bacteria, discard 500 μL of the supernatant and resuspend the bacteria, take 200 μL of the bacterial solution and evenly spread it on YPD plates containing the corresponding resistance (Zeocin 100 μg / mL or G418 500 μg / mL), and incubate at 30°C for 3 days until transformants are visible.
[0131] (2) Construction of engineered strain SC01
[0132] The starting strain was SCV02.
[0133] First, the SabS1 integration donor DNA was constructed. Using the Pichia pastoris genome as a template, the upstream homology arm Int-S1-H1 was obtained using primers Int-S1-H1-F (TATGGTTGCTTAA GATGATAGGAGAATCAAAC) and Int-S1-H1-R (GTCATATGACAAGTTGGGTAGGTTG), the downstream homology arm Int-S1-H2 was obtained using TADH2-Int-S1-H2-F (TAGCGACTCTGGCAGATAAGAAAGCAAGTTGGGACGCGGAC) and Int-S1-H2-R (ATCCAGTTGCTCCACCCC), and the terminator T was obtained using Sab-TADH2-F (TTGTTTCAACCTT ATGTTTAAGTCAGTGCCGAATAGTTTGTATACGTCTTATG) and TADH2-R (TCTTATCTGCCAGAGTCGC TAGATCTGGA). ADH2The promoter P was obtained using primers Int-S1-H1-pGAP-F (TACCCAACTTGTCATATGACGATCCTTT TTTGTAGAAATGTCTTG) and pGAP-SabS1-R (TGCAAAGAGTTCAATGGCATTGTGTTTTGATAGTTGTTC AATTGATTG) GAP ; Using vector pPICZA-Int-S1-H1-P GAP -SabS1-T ADH2 -Int-S1-H2 was used as a template and primers Sab S1-F (ATGCCATTGAACTCTTTGCAC) and pGAP-Sab-R (TTAAACATAAGGTTGAAACAACAAACCAC) were used to obtain the SabS1 gene.
[0134] Overlap extension PCR was used to splice the above amplified products to obtain the fragment Int-S1-H1-P GAP -SabS1-T ADH2 -Int-S1-H2.
[0135] Using vector pPICZA as a template, primers pPICZA-H2-F (AGGGGGGTGGAGCAACTGGATATGACTGTTCCTCAG TTCAAGTTGG) and pPICZA-H1-R (CTATCATCTTAAGCAACCATAGTCTAAGGCTAAAACTCAATGATGATG ATG) were used to obtain the linearized vector pPICZA.
[0136] Same as above description, the fragment Int-S1-H1-P GAP -SabS1-T ADH2 -Int-S1-H2 and linearized vector pPICZA were recombined and ligated to obtain the vector pPICZA-Int-S1-H1-P containing the donor DNA fragment. GAP -SabS1-T ADH2 -Int-S1-H2. When used, primers Int-S1-H1-F and Int-S1-H2-R are used for PCR amplification to obtain a large amount of donor DNA fragments (the usage amount is up to 5μg, so the DNA fragments need to be connected to the vector first to ensure that a large amount of single donor DNA can be amplified by PCR).
[0137] Subsequently, the expression vector gRNA (Int-S1)-Cas9 for gRNA and Cas9 protein was constructed. In the first step, the HH-sgRNA-HDV fragment was constructed as described in the research paper (Recombinant protein production in yeast, 2019: 211-225). The primers C_sgRNA_struc_rev (AGGCTGGGACCATGCCGGCCAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACG) and D_sgRNA_struc_rev (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT) were used to splice to obtain fragment 1; using fragment 1 as a template, the primers 2_sgRNA_fw-Int-S1 (AAACGAGTAAGCTCGTC gctatcgccaacatcca agt Fragment 2 was obtained by amplifying the primers A_sgRNA_struc_rev (CGCCATGCCGAAGCATGTTGCCCAGCCGGCGCCAGCGAGGAGGCTGGGACC ATGCCGGCC) and A_sgRNA_fw-Int-S1 (CAAAACACCATG gatagc C TGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTC gcta , the first underline represents the reverse complementary sequence of the first 6 bases of g20, and the second underline represents the first 4 bases of g20) and B_sgRNA_struc_rev (AAGCGCGAGTCCAAAGCTGTCCC ATTCGCCATGCCGAAGCATGTTGCCCAGCCG) were amplified to obtain the fragment HH-sgRNA (Int-S1)-HDV. In the second step, the knockout backbone plasmid BB3cK_pGAP_23*_pPFK300_Cas9 was used as a template and the vector was linearized with primers pCas-R (GGTGTTTTGATAGTTGTTCAATTG ATT) and pCas9-F (CGCGCTTTTAGTGTACATCTGATA). The fragment HH-sgRNA (Int-S1)-HDV and the linearized vector were ligated as described above to obtain the gRNA (Int-S1)-Cas9 expression vector. All gRNA-Cas9 expression vectors constructed in this application are resistant to G418.
[0138] The obtained donor DNA fragment Int-S1-H1-P GAP -SabS1-T ADH2 -Int-S1-H2 and gRNA (Int-S1)-Cas9 expression vectors were co-electroporated into SCV02 competent cells; after obtaining positive transformants through resistance screening, colony PCR verification was performed using primers I-SabS1-F (GTCATTGACCGAAGCAGTAG) and I-SabS1-R (CTTGCTGCCATTTCTCAAAC). After sequencing confirmation, the engineered strain SC01 with SabS1 integrated into the genome was obtained.
[0139] All engineered strains based on the CRISPR-Cas9 system must pass plasmid loss and active screening steps before subsequent iterative genome editing can be performed (not emphasized below). The specific steps are as follows:
[0140] (1) Plasmid elimination: The engineered bacteria obtained above were inoculated into 10 mL of YPD liquid medium and cultured at 30°C and 200 rpm for 24 h. Subsequently, a 2% inoculum was transferred to 10 mL of fresh YPD liquid medium and cultured under the same conditions for another 24 h.
[0141] (2) Single colony isolation: Take 10 μL of the above bacterial solution and mix it with 10 μL of sterile water, then streak it on a YPD plate. After incubation at 30°C for 2 days, a single colony was obtained. The above bacterial solution, which had been passaged twice, was gradiently diluted to 10 -5 ~10 -6 After concentration, the plates were spread on YPD plates and cultured under the same conditions to obtain single colony distribution;
[0142] (3) The obtained single colonies were streaked onto YPD plates and YPD plates containing G418 resistance in parallel. After incubation at 30°C for 3 days, transformants that grew normally on the non-resistant medium but did not grow on the G418 resistance medium were selected and verified by PCR and DNA sequencing. Finally, the correct strains were stored at -80°C as the starting strains for the next round of gene editing.
[0143] Example 2: Promoting Effect of Optimizing the Supply of Precursors GPP and NPP on Sabinene Bioproduction
[0144] The starting strain is the engineered strain SC01.
[0145] (1) Construction of donor DNA
[0146] In the first round of PCR amplification, the Pichia pastoris genome was used as a template, and primers Int-S2-up-F (GCCAATCCAATTATCTTTCTTG G) and Int-S2-up-R (TCAAAATTTAAGACTGGGTGCAG) were used to obtain the upstream homology arm Int-S2-up, primers Int-S2-down-F (CGTATACCCCCTCGTCGC) and Int-S2-down-R (AGGACGAAATTTGATCGTCTC) were used to obtain the downstream homology arm Int-S2-down, and primers TAOX1-F (TCAAGAGGATGTCAGAATGCC) and TAOX1-Int-S2-down-R (AAAGCGACGAGGGG GTATACGTCTCACTTAATCTTCTGTACTCTGAAGAG) were used to obtain the terminator T AOX1 , primers Int-S2-up-pAOX1-F (GCA CCCAGTCTTAAATTTTGAGATCTAACATCCAAAGACGAAAGG) and pAOX1-ERG20WW-R (AGCTGCTAC TTCTTTGGACATCGTTTCGAATAATTAGTTGTTTTTTG) were used to obtain promoter P AOX1 Fragment 1 was obtained using primers ERG20-F (ATGTCCA AAGAAGTAGCAGCTAAG) and F98W-R (CAGCGACCAGCCAGTAGGCTTGTAGCAATTCGAC), fragment 2 was obtained using primers F98W-F (AAGCCTACTGGCTGGTCGCTGATGATATGATG) and N129W-R (GAAAGAGTCCCAAA TGGCAATGTTTCCTACATTTTC), and fragment 3 was obtained using primers N129W-F (ATTGCCATTTGGGACTCTTTCATGCTAG AAGGTG) and ERG20-5XGS-R (AGATCCAGAACCGGATCCTGAACCAGATCCTTTGGTTCTCTTGTAGATC TTGTC); the vector pPICZA-Int-S1-H1-P was used to generate fragment 1. GAP -SabS1-T ADH2 -Int-S1-H2 was used as template and primer 5XGS-t34SabS1 was used
[0147] -F(GGATCTGGTTCAGGATCCGGTTCTGGATCTCAACAAGAAGAACCAAGACAAATC) and SabS1-TAOX1
[0148] The t34SabS1 gene was obtained using primers 5XGS-t37SabS1-F (GGATCTGGTTCAGGATCCGGTTCTGGATCTGAACCAAGACAAATCAGAAGATCTG) and SabS1-TAOX1-R to obtain the t37SabS1 gene. The tNPPS1 gene was codon-optimized and synthesized by Beijing Qingke Biotechnology Co., Ltd. The sequence is shown in SEQ ID NO: 5, and the amplification primers were 5XGS-tNPPS1-F (GGATCTGGTTCAGGATCCGGTTCTGGATCTT CTGCTAGAGGTCTGAACAAGATT) and tNPPS1-TAOX1-R (GGCATTCTGACATCCTCTTGACTAATAGGT ATGTCCACCGAATCTT).
[0149] In the second round of amplification, using fragments 1 and 2 as templates, primers ERG20-F and N129W-R were used to obtain fragment 4; using fragments 3 and 4 as templates, primers ERG20-F and ERG20-5XGS-R were used to obtain fragment ERG20. WW (ie ERG20 F98W / N129W ).
[0150] Overlap extension PCR was used to amplify the above products Int-S2-up, Int-S2-down, T AOX1 、P AOX1 ,t34SabS1,t37SabS1,tNPPS1,ERG20 WW Perform fragment splicing to obtain donor DNA fragments:
[0151] ①Int-S2-Up-PAOX1-ERG20WW-5GS-t34SabS1-TAOX1-Int-S2-Down
[0152] ②Int-S2-Up-PAOX1-ERG20WW-5GS-t37SabS1-TAOX1-Int-S2-Down
[0153] ③Int-S2-Up-PAOX1-ERG20WW-5GS-tNPPS1-TAOX1-Int-S2-Down
[0154] The commercial vector pUC19 was used as a template and primers pUC19-Int-S2-up-R (AAGAAAGATAATTGGATTGGCCTGGAAAGC GGGCAGTGA) and pUC19-Int-S2-down-F (GAGACGATCAAATTTCGTCCTTCGGGAAACCTGTCGTGC) were used to obtain the linearized vector pUC19.
[0155] The donor DNA was recombined and ligated with the linearized vector pUC19 as described above to obtain a vector containing the donor DNA fragment:
[0156] ①pUC19-Int-S2-Up-P AOX1 -ERG20 WW -5GS-t34SabS1-T AOX1 -Int-S2-Down
[0157] ②pUC19-Int-S2-Up-P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 -Int-S2-Down
[0158] ③pUC19-Int-S2-Up-P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 -Int-S2-Down
[0159] When used, primers Int-S2-up-F and Int-S2-down-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0160] (2) Construction of gRNA (Int-S2)-Cas9 expression vector
[0161] Using the gRNA (Int-S1)-Cas9 expression vector as a template, the vector was linearized with primers sgRNA-Int-S2-F (GTGAGGACGAAACGAGTAAGCT CGTCCAACTCGAATTATAGTGGCGGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S2-R (GCTTACTC GTTTCGTCCTCACGGACTCATCAGCAACTCCATGGTGTTTTGATAGTTGTT), and recombined and ligated by seamless cloning technology to obtain the gRNA (Int-S2)-Cas9 expression vector.
[0162] The donor DNA fragment and gRNA (Int-S2)-Cas9 expression vector were co-transformed into SC01 competent cells. After positive transformants were obtained through resistance screening, colony PCR was performed using primers I-Int-S2-F (CAACTCCAGTCATACAAACTGATT) and I-Int-S2-R (GCCGT GGTTACAGTATGTGTTC). After sequencing was correct, the recombinant strain SC02 (ERG20 WW -t34SabS1 expression cassette), SC03 (ERG20 WW -t37SabS1 expression cassette) and SC04 (ERG20 WW -tNPPS1 expression cassette). Using the above strains, shake flask fermentation with methanol as the sole carbon source, the sabinene production was 2.06 mg / L, 7.29 mg / L and 30.10 mg / L respectively (see Figure 3 The preferred strain is SC 04, which expresses ERG20 in fusion. WW The tNPPS1 gene had the greatest effect on improving sabinene production.
[0163] Example 3: Effects of Methanol Metabolism Pathway (DAS2 Gene Overexpression) and Acetyl-CoA Flux Regulation on Sabinene Synthesis
[0164] The starting strain was the engineered strain SC04.
[0165] (1) Construction of donor DNA containing DAS2 expression cassette
[0166] Using the Pichia pastoris genome as a template, primers Int-S3-up-F (GTGTTGCGGAGAACGAGAT) and Int-S3-up-pDAS2-R (AGGATTGCCCAAAACAGTAATTCGTGTGCGCGACAACAC) were used to obtain the upstream homology arm Int-S3-up, TGAP-Int-S3-down-F (AATTGGAATGGAAAATTGCAATAGTAAGGACCGGGTTCAG) and Int-S3-down-R (AATCTTTCCGCAC TCATTAGTTT) were used to obtain the downstream homology arm Int-S3-down, and primers pDAS2-F (ATTACTGTTTTGGGCAATCCTG) and pD AS2-R (TTTTGATGTTTGATAGTTTGATAAGAGTG) were used to obtain the promoter P. DAS2The DAS2 gene was obtained using primers pDAS2-DAS2-F (CAAAC TATCAAACATCAAAAATGGCTAGAATTCCAAAAGCAGTATCGACACAA) and DAS2-R (TTACAACTTGT CATGCTTTGGTTTTCCCTTCAAGTCGTG), and the terminator T was obtained using primers DAS2-TGAP-F (CCAAAGCATGACA AGTTGTAAATCGATTTGTATGTGAAATAGCTG) and TGAP-R (GCAATTTTCCATTCCAATTTG). GAP .
[0167] Overlap extension PCR was used to splice the above amplified products to obtain the donor DNA fragment Int-S3-Up-P DAS2 -DAS2-T GAP -Int-S3-Down, and ligated the fragment into pUC19 vector using the above method to obtain the donor DNA-containing vector pUC19-Int-S3-Up-P DAS2 -DAS2-T GAP -Int-S3-Down.
[0168] When used, primers Int-S3-up-F and Int-S3-down-R are used for PCR amplification to obtain a large number of donor DNA fragments.
[0169] (2) Construction of donor DNA containing BbXFPK-CKPTA expression cassette
[0170] Using the Pichia pastoris genome as a template, primers Int-S4-up-F (TACTAACTTATAGTGGATTGTGGTAGATAC) and Int-S4-up-TFLD1-R (ATTGATCGACGCTCTGTGAAAGCTCAAACAGGTTCATTCCAT) were used to obtain the upstream homology arm Int-S4-up, and TFDH1-Int-S4-down-F (TCCTTCAAACTTCTCACCTCCATTTCAGTTCTAGCGGGAACT) and Int-S4-down nR (TAAGAGCTCCACAATCGCCA) were used to obtain the downstream homology arm Int-S4-down. Primers BbXFPK-pHTX1-F (CCGATG ACTGGAGAGGTCATTTTGATTTGTTTAGGTAACTTGAACTG) and HTX1-CKPTA-R (ATGTTCTCCATTAG CTTCATTGTTGTAGTTTTAATATAGTTTGAGTATGAGAT) were used to obtain the bidirectional promoter P. HTX1 The terminator T was obtained using primers TFLD1-F (TTT CACAGAGCGTCGATCAATAC) and TFLD-BbXFPK-R (CTGCTGGTGATAACGAGTGAGTACGACGTATGA TGAATGAATGAG), CKPTA-TFDH1-F (AGGCTCAAGCTCAAGGTTAGTTGAAATGTATTTAATTTGATAT TAAGTAAAT) and TFDH1-R (GGAGGTGAGAAGTTTGAAGGAG). FLD1 and T FDH1 The BbXFPK and CKPTA genes were codon-optimized and synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd. The sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively. The amplification primers were BbXFPK-F (TCACTCGTTATCACCAGCAGTAG) and BbXFPK-R (ATGACCTCTCCAGTCATCGGAA), CKPTA-F (ATGAAGCTAATGGAGAACATCTTCG), and CKPTA-R (CTAACCTTGAGCTTGAGCCTGAA).
[0171] Overlap extension PCR was used to splice the above amplified products one by one to obtain the donor DNA fragment Int-S4-Up-T FLD1 -BbXFPK-P HTX1 -CKPTA-T FDH1-Int-S4-Down, and ligated this fragment to pUC19 to obtain the donor DNA-containing vector pUC19-Int-S4-Up-T FLD1 -BbXFPK-P HTX1 -CKPTA-T FDH1 -Int-S4-Down.
[0172] When used, primers Int-S4-up-F and Int-S4-down-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0173] (3) Construction of donor DNA containing MmACL expression cassette
[0174] Using the Pichia pastoris genome as a template, primers Int-S5-up-F (GAATTCTTTGACTATTTGGATAGCAA) and Int-S5-up-R (TCTACGTTTTAAGATCAATCAAATCAC) were used to obtain the upstream homology arm Int-S5-up, and Int-S5-down-F (AGTAACAAAA AATGAAAAAATTAAAGTTTG) and Int-S5-down-R (CCATATAAGTGATGTCTTAACAGTTACC) were used to obtain the downstream homology arm Int-S5-down. Primers Int-S5-up-pAOX1-F (GATTGATCTTAAAACGTAGAGATCTAACATCCAAAGA CGAA) and pAOX1-MmACL-R (AGATTGCTTTAGCAGACATCGTTTCGAATAATTAGTTGTTTTTTG) were used to obtain the promoter P. AOX1 The terminator T was obtained using primers MmACL-TAOX1-F (CCTGAACATATGTCTATGTAATCAAGAGGATGTCAGAATGC CATT) and TAOX1-Int-S5-down-R (ATTTTTTCATTTTTTGTTACTTCTCACTTAATCTTCTGTACTCTGAAGA G). AOX1 The MmACL gene was codon-optimized and synthesized by Wuhan Tianyi Huayu Gene Technology Co., Ltd., and the amplification primers were MmACL-F (ATGTCTGCTAAAGCAATCTCAGAAC) and MmACL-R (TTACATAGACATATGTTCAGGCAAAAC).
[0175] Overlap extension PCR was used to splice the above amplified products to obtain the donor DNA fragment Int-S5-Up-PAOX1 -MmACL-T AOX1 -Int-S5-Down, and connect this fragment to the pUC19 vector using the above method to obtain the vector pUC19-Int-S5-Up-P containing donor DNA AOX1 -MmACL-T AOX1 -Int-S5-Down.
[0176] When used, primers Int-S5-up-F and Int-S5-down-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0177] (4) Construction of gRNA-Cas9 expression vector. The same method as above was used to construct gRNA (Int-S2)-Cas9, except that the linearized primers were replaced with sgRNA-Int-S3-F (GTGAGGACGAAACGAGTAAGCTCGTCCCTAAATACTACCTAAACAGGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S3-R (GCTTACTCGTTTCGTCCTCACGGACTCATCAGCCTAAACATGGTGTTTTGATAGTTGTT), sgRNA-Int-S4-F (GTGAGGACGAAACGAGTAAGCTCGTCATTATCGTTTGGGATACGAGGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S The three pairs of primers were used to obtain gRNA (Int-S3)-Cas9, gRNA (Int-S4)-Cas9, and gRNA (Int-S5)-Cas9 expression vectors, respectively.
[0178] The obtained donor DNA fragment containing DAS2 expression cassette and gRNA (Int-S3)-Cas9 expression vector or the donor DNA fragment containing BbXFPK-CKPTA expression cassette and gRNA (Int-S4)-Cas9 expression vector or the donor containing MmACL expression cassette were respectively The DNA fragment and gRNA (Int-S5)-Cas9 expression vector were co-transformed into SC04 competent cells by electroporation. After obtaining positive transformants through resistance screening, colony PCR verification was performed using primers I-Int-S3-F (TTGGTCTTATCTCGAGGTGG) and I-Int-S3-R (CGTGCAATGTTATGGCTTTC) or I-Int-S4-F (GACACTGATTTTACTCTGCTTCC) and I-Int-S4-R (GCGGATTTAACTTAGAGGCTGC), or I-Int-S5-F (CCAATTTTGAAATTGGAGACC) and I-Int-S5-R (GCATGTAACGGTGAACCTGAG), respectively. After sequencing confirmation, the recombinant strains SC05 (DAS2 expression cassette), SC06 (BbXFPK-CKPTA expression cassette), and SC07 (MmACL expression cassette) were obtained. The fermentation of sabinene with methanol as the sole carbon source using the above strains yielded 18.30 mg / L, 101.13 mg / L and 47.42 mg / L, respectively (see Figure 4 The preferred strain is SC06, which co-expresses the BbXFPK gene and the CKPTA gene, resulting in the greatest increase in sabinene production.
[0179] Example 4: Effect of Overexpression of Key Genes in the MVA Pathway on Sabinene Biosynthesis
[0180] The starting strain was the engineered strain SC06.
[0181] (1) Construction of donor DNA
[0182] Using the Pichia pastoris genome as a template, primers Int-S6-up-F (GCCACAGTCACAATTCTTTACTC) and Int-S6-up-R (CAGCTGCTCAAGAAGGGACT) were used to obtain the upstream homology arm Int-S6-up, and Int-S6-down-F (AGTTCCTTTCTATAGAATGTCCATC) and Int-S6-down-R (AACCACAACAACAACAACAACTATT) were used to obtain the downstream homology arm Int-S6-down. Primers Int-S6-up-pAOX1-F (CAGTCCCTTCTTGAGCAGCTGGATCTAACATCCAAAGACGAAAGG) and pAOX1-R (CGTTTCGAATAATTAGTTGTTTTTTG) were used to obtain the promoter P. AOX1 , HTX1-F (TTTGATTTGTTTAGGTAACTTGAACTGGAT) and HTX1-R (TGTTGTAGTTTTAATATAGTTTGAGTATGAGA) obtained bidirectional promoter P HTX1 The terminator T was obtained using primers TAOX1-F (TCAAGAGGATGTCAGAATGCC) and TAOX1-Int-S6-down-R (TGGACATTCTATAGAAAGGAACTTCTCACTTAATCTTCTGTACTCTGAAG). AOX1 , Int-S6-up-TFLD1-F (CAGTCCCTTCTTGAGCAGCTGTTTCACAGAGCGTCGATCAATA) and TFLD1-R (GTACGACGTATGATGAATGAATGAG) to obtain the terminator T FLD1 TFDH1-F (TTGAAATGTATTTAATTTGATATTAAGTAAAT) and TFDH1-Int-S6-down-R (GACATTCTATAGAAAGGAACTGGAGGTGAGAAGTTTGAAGGAG) obtained terminator T FDH1The ERG10 gene was obtained using primers pAOX1-ERG10-F (AACAACTAATTATTCGAAACGATGAGTGAACCTGTTTACATTGTTAG) and ERG10-5XGS-R (AGATCCAGAACCGGATCCTGAACCAGATCCAATATGACTCTTTGAGGTAACAGCTT), and the ERG13 gene was obtained using primers 5XGS-ERG13-F (GGATCTGGTTCAGGATCCGGTTCTGGATCTTCTCGTCCAAGTAACATAGGTATCA) and ERG13-TAOX1-R (GGCAT TCTGACATCCTCTTGATTAGTTTTTAACCTGGTATTCACGT) to obtain the ERG13 gene, TFLD1-ERG8-F (TTCATTCATCATACGTCGTACCTATTCTGCAAATAAATAGCTCTGG) and ERG8- 5XGS-R (GGATCTGGTTCAGGATCCGGTTCTGGATCTAAAGCTTTCAGCGCTCCG) obtains the ERG8 gene, 5XGS-ERG12-F (AGATCCAGAACCGGATCCTGAACCAGATCCCCAAAACTTCC The ERG12 gene was obtained by using pAOX1-HTX1-R (CAAGTTACCTAAACAAATCAAAATGGATTTACCATTTGTGGTTTCCGC), the ERG19 gene was obtained by using pHTX1-ERG19-F (AACTATATTAAAACTACAACAATGTGTCTTCAAAGTATCGTCATT) and ERG19-TFDH1-R (ATCAAATTAAATACATTTCAATTAAGGAGCAACTAAAAACATGTC), and the ERG19 gene was obtained by using pAOX1-IDI1-F (AACAAC pAOX1-HMGR-F (AACAACTAATTATTCGAAACGATGACTACGTCCGCGTATCAC) and IDI1-TAOX1-R (GGCATTCTGACATCCTCTTGATTACAGCATACGATCAATAGTCTCAT) were used to obtain the IDI1 gene, and pAOX1-HMGR-F (AACAACTAATTATTCGAAACGATGCTTACTGGGTTGTCCAAGA) and HMGR-TAOX1-R (GGCATTCTGACATCCTCTTGATCAAGATTTAATGCAAATCTTAGATTG) were used to obtain the HMGR gene.The tHMGR gene was obtained using primers pAOX1-tHMGR-F (AACAACTAATTATTCGAAACGATGGCTGTCTCTACAATTGCAA) and HMGR-TAOX1-R. The tHMG1 gene was obtained using the Saccharomyces cerevisiae genome as a template using primers pAOX1-tHMG1-F (AACAACTAATTATTCGAAACGATGGACCAATTGGTGAAAACTG) and tHMG1-TAOX1-R (GGCATTCTGACATCCTCTTGATTAGGATTTAATGCAGGTGACG).
[0183] According to the desired donor DNA expression cassette, the above amplified products were spliced using overlap extension PCR to obtain the following donor DNA fragments:
[0184] ①Int-S6-Up-P AOX1 -ERG10-5GS-ERG13-T AOX1 -Int-S6-Down
[0185] ②Int-S6-Up-T FLD1 -ERG8-5GS-ERG12-P HTX1 -ERG19-T FDH1 -Int-S6-Down
[0186] ③Int-S6-Up-P AOX1 -IDI1-T AOX1 -Int-S6-Down
[0187] ④Int-S6-Up-P AOX1 -HMGR-T AOX1 -Int-S6-Down
[0188] ⑤Int-S6-Up-P AOX1 -tHMGR-T AOX1 -Int-S6-Down
[0189] ⑥Int-S6-Up-P AOX1 -tHMG1-T AOX1 -Int-S6-Down
[0190] The above fragments were connected to the pUC19 vector using the above method to obtain a vector containing donor DNA:
[0191] ①pUC19-Int-S6-Up-P AOX1 -ERG10-5GS-ERG13-T AOX1-Int-S6-Down
[0192] ②pUC19-Int-S6-Up-T FLD1 -ERG8-5GS-ERG12-P HTX1 -ERG19-T FDH1 -Int-S6-Down
[0193] ③pUC19-Int-S6-Up-P AOX1 -IDI1-T AOX1 -Int-S6-Down
[0194] ④pUC19-Int-S6-Up-P AOX1 -HMGR-T AOX1 -Int-S6-Down
[0195] ⑤pUC19-Int-S6-Up-P AOX1 -tHMGR-T AOX1 -Int-S6-Down
[0196] ⑥pUC19-Int-S6-Up-P AOX1 -tHMG1-T AOX1 -Int-S6-Down
[0197] When used, primers Int-S6-up-F and Int-S6-down-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0198] (2) Construction of gRNA (Int-S6)-Cas9 expression vector. The same method as above was used to construct the gRNA-Cas9 expression vector, but the linearized primer was replaced with sgRNA-Int-S6-F
[0199] (GTGAGGACGAAACGAGTAAGCTCGTCAATTACTTCGGGAATAATGGGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S6-R (GCTTACTCGTTTCGTCCTCACGGACTCATCAGAATTACCATGGTGTTTTGATAGTTGTT), to obtain the gRNA(Int-S6)-Cas9 expression vector.
[0200] The donor DNA fragments containing expression cassettes of different genes obtained above and the gRNA (Int-S6)-Cas9 expression vector were co-electroporated into SC06 competent cells; after obtaining positive transformants through resistance screening, primers I-Int-S6-F (CTTTCGTGGCTATCCATCG) and I-Int-S6-R (TCCCCTATCAGGCGCTAAA) were used for colony PCR verification. After sequencing confirmation, the recombinant strains SC09 (ERG10-ERG13 expression cassette), SC10 (ERG8-ERG12-ERG19 expression cassette), SC11 (IDI1 expression cassette), SC12 (HMGR expression cassette), SC13 (tHMGR expression cassette) and SC14 (tHMG1 expression cassette) were obtained. The above strains were used for shake flask fermentation with methanol as the sole carbon source, and the sabinene yields were 48.78 mg / L, 30.95 mg / L, 52.94 mg / L, 291.66 mg / L, 479.49 mg / L and 109.86 mg / L, respectively (see Figure 5 The preferred strain is SC13, which has the greatest increase in sabinene production due to overexpression of the tHMGR gene.
[0201] Example 5: Construction of a multi-copy sabinene synthase / NPP synthase integration system and its effect on sabinene synthesis
[0202] The starting strain was the engineered strain SC13.
[0203] (1) Construction of donor DNA containing ERG20 WW -t37SabS1 / t37SabS1(H525F) expression cassette
[0204] The genome of Pichia pastoris was used as a template, and the upstream homology arm Int-S7-H1 was obtained using primers Int-S7-H1-F (AGGCCAGACCTATAACCATCAT) and Int-S7-H1-R (GCATGGACCTGCTCTTATCTCATC), and the downstream homology arm Int-S7-H2 was obtained using primers Int-S7-H2-F (AAGTAGTCATCTAATTTAATCATAAAAAGG) and Int-S7-H2-R (TTGGTTAAAATTTGATATTGGTACTGG); the vector pUC19-Int-S2-Up-P containing donor DNA was used to generate the downstream homology arm Int-S7-H2. AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1-Int-S2-Down was used as a template and PCR amplification was performed with primers Int-S7-H1-pAOX1-F (GAGATAAGAGCAGGTCCATGCGATCTAACATCCAAAGACGAAAGG) and TAOX1-Int-S7-H2-R (GATTAAATTAGATGACTACTTTCTCACTTAATCTTCTGTACTCTGAAGAG) to obtain fragment P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 .
[0205] Subsequently, overlap extension PCR was used to splice the above amplified products to obtain the donor DNA fragment Int-S7-Up-P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 -Int-S7-Down, and ligated the fragment into pUC19 vector as described above to obtain the vector pUC19-Int-S7-Up-P containing donor DNA. AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 -Int-S7-Down.
[0206] The vector pUC19-Int-S7-Up-P AOX1 -ERG20 WW -5GS-t37SabS1-T AOX1 -Int-S7-Down was used as a template, and the vector was linearized with primers H525F-F (GGTGATGGATTCGGTGTTCAACACTCTGAAATCC) and H525F-R (TTGAACACCGAATCCATCACCGTCCAAGTAAATA), and the vector was recombined by seamless cloning technology to obtain the vector pUC19-Int-S7-Up-P containing donor DNA. AOX1 -ERG20 WW -5GS-t37SabS1(H525F)-T AOX1 -Int-S7-Down.
[0207] When used, primers Int-S7-H1-F and Int-S7-H2-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0208] (2) Construction of donor DNA containing ERG20 WW -tNPPS1 expression cassette
[0209] The genome of Pichia pastoris was used as a template, and the upstream homology arm Int-S8-up was obtained using primers Int-S8-up-F (CCAAGTTGAAAGACCACAATCC) and Int-S8-up-R (TTACTATCTACCACCTTCAAATCGTACAG), and the downstream homology arm Int-S8-down was obtained using primers Int-S8-down-F (AATCTTCCAGTATTGGAAAGGGAT) and Int-S8-down-R (CTTGATGATAAATGTCTAGGGATTTTC); The DNA vector pUC19-Int-S2-Up-PAOX1-ERG20WW-5GS-tNPPS1-TAOX1-Int-S2-Down was used as a template and primers Int-S8-up-pAOX1-F (TTTGAAGGTGGTAGATAGTAAGATCTAACATCCAAAGACGAAAGG) and primers TAOX1-Int-S8-down-R (CCTTTCCAATACTGGAAGATTTCTCACTTAATCTTCTGTACTCTGAAGAG) were used for amplification to obtain fragment P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 .
[0210] Overlap extension PCR was used to connect the above fragments one by one to obtain the donor DNA fragment Int-S8-Up-P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 -Int-S8-Down, and ligated the fragment into pUC19 vector as described above to obtain the donor DNA-containing vector pUC19-Int-S8-Up-P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 -Int-S8-Down.
[0211] When used, primers Int-S8-up-F and Int-S8-down-R are used for PCR amplification to obtain a large amount of donor DNA fragments.
[0212] (2) Construct gRNA (Int-S7)-Cas9 and gRNA (Int-S8)-Cas9 expression vectors. The same method as above was used to construct the gRNA-Cas9 expression vector, except that the linearized primers were replaced with sgRNA-Int-S7-F (GTGAGGACGAAACGAGTAAGCTCGTCAACTTTGAAACAAAAGAAGGGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S7-R (GCTTACTCGTTTCGTCCTCACGGACTCATCAGAACTTTCATGGTGTTTTGATAGTTGTT) or sgRNA-Int-S8-F (GTGAGGACGAAACGAGTAAGCTCGTCGACTCTCCACAAGTTAACCAGTTTTAGAGCTAGAAATAGCAAG) and sgRNA-Int-S8-R (GCTTACTCGTTTCGTCCTCACGGACTCATCAGGACTCTCATGGTGTTTTGATAGTTGTT) to obtain the expression vectors gRNA (Int-S7)-Cas9 and gRNA (Int-S8)-Cas9.
[0213] The expression cassette containing ERG20WW-t37SabS1 / t37SabS1(H525F) and the gRNA(Int-S7)-Cas9 expression vector, as well as the expression cassette containing ERG20WW-tNPPS1 and the gRNA(Int-S8)-Cas9 expression vector, were co-transformed into SC13 competent cells. After positive transformants were obtained through resistance screening, primers I-Int-S7-F (ACATACCCAAATCATAGATAGAGCAG) and I-Int-S7- R (GTCGAAGGATGACACTGGACTC) or I-Int-S8-F (CTGACGACGACCTCAATGACTA) and I-Int-S8-R (TTCGATAATCTGGCCCGC) were verified by colony PCR. After sequencing, the recombinant strains SC16 (ERG20WW-t37SabS1 expression cassette), SC17 (ERG20WW-t37SabS1 (H525F) expression cassette), and SC18 (ERG20WW-tNPPS1 expression cassette) were obtained. Fermentation with methanol as the sole carbon source using the above strains yielded sabinene of 1584.48 mg / L, 1597.34 mg / L, and 670.23 mg / L, respectively (see Figure 6 The preferred strain is SC17, which expresses the fusion gene ERG20 WW and t37SabS1(H525F) had the greatest effect on improving sabinene production.
[0214] Example 6: Effect of HIS4 auxotrophy on sabinene biosynthesis
[0215] The starting strain was the engineered strain SC17. Using the vector pPIC9K as a template, the primers L-pPIC9K-F (TCGACAATTGGTTTGACTAATTC) and L-pPIC9K-R (CAATGTTCGTCAAAATGGTGAC) were used to obtain the linearized vector pPIC9K, and the linearized vector was purified and recovered. 1 μg of the linearized vector pPIC9K was electrotransformed into SC17 competent cells and spread on MD plates. Single transformant colonies were picked and PCR verified using primers I-HIS4-F (ATGGTGATTTCTCACTTGATAACCT) and I-HIS4-R (GCCGGTTAGATCTATCGAATC) to obtain the engineered strain SC21 with the complemented HIS4 gene (sequence shown in SEQ ID NO: 9). This strain was used for shake flask fermentation and 3L bioreactor fermentation with methanol as the sole carbon source, and the highest sabinene yields of 3239.03 mg / L and 6383.64 mg / L were obtained, respectively (see Figure 7 and Figure 8 ).
Claims
1. A method for constructing a recombinant Pichia pastoris strain, characterized in that: The sabinene synthase gene SabS1 from sage (Salvia pomifera) was transferred into the Int-S1 site of the Pichia pastoris strain by genome integration technology to obtain a recombinant strain; the sequence of the sabinene synthase gene SabS1 is shown in SEQ ID NO: 1; The recombinant strain integrates the farnesyl pyrophosphate synthase mutant ERG20 at the chromosome Int-S2 site. WW and the expression cassette for tomato neryl diphosphate synthase tNPPS1, ERG20 WW and tNPPS1 are connected via a connecting peptide, wherein the connecting peptide is GSGSGSGSGS, and the amino acid sequence of tNPPS1 is shown in SEQ ID NO: 2; The recombinant strain integrates an expression cassette containing Bifidobacterium breve phosphoketolase BbXFPK and Clostridium kluyveri phosphotransacetylase CKPTA at the chromosome Int-S4 site, wherein the gene sequence encoding BbXFPK is shown in SEQ ID NO: 6, and the gene sequence encoding CKPTA is shown in SEQ ID NO: 7; The recombinant strain integrates an expression cassette containing a truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMGR at the chromosome Int-S6 site, wherein the amino acid sequence of tHMGR is shown in SEQ ID NO: 10; The recombinant strain integrates the farnesyl pyrophosphate synthase mutant ERG20 at the chromosome Int-S7 site. WW and an expression cassette for a truncated sabinene synthase mutant t37SabS1 / t37SabS1(H525F), wherein the gene sequence encoding t37SabS1 is shown in SEQ ID NO: 4; Among them ERG20 WW It is derived from the endogenous gene ERG20 of Pichia pastoris and is obtained by mutating the 98th amino acid F to W and the 129th amino acid F to W. The accession number of ERG20 is XP_002490436.
1.
2. The construction method according to claim 1, characterized in that Encoding ERG20 WW The gene sequence is shown in SEQ ID NO:
3.
3. The construction method according to claim 1, characterized in that The gene sequence encoding tNPPS1 is shown in SEQ ID NO:
5.
4. The construction method according to claim 1, characterized in that The gene sequence encoding tHMGR is shown in SEQ ID NO:
8.
5. The construction method according to claim 1, characterized in that The construction method further includes complementing the HIS4 gene in the recombinant strain, and the gene sequence is shown in SEQ ID NO:
9.
6. The construction method according to claim 1 or 2, characterized in that: The Pichia pastoris strain is a wild-type Pichia pastoris GS115 strain in which a RAD52 gene expression cassette is integrated; the RAD52 gene expression cassette P GAP -RAD52-T AOX1 , integrated into the promoter site of the AOX1 gene via a plasmid.
7. The construction method according to claim 3, characterized in that: The SabS1 expression cassette was integrated into the chromosome Int-S1 site as P GAP -SabS1-T AOX1 , where the promoter is P GAP , the terminator is T AOX1 ; The expression cassette integrated into the chromosome Int-S2 site is P AOX1 -ERG20 WW -5GS-tNPPS1-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 ; The expression cassette integrated into the chromosome Int-S4 site is T FLD1 -BbXFPK-P HTX1 -CKPTA-T FDH1 , where the promoter is P HTX1 , the terminator is T FLD1 、T FDH1 .
8. The construction method according to claim 6, characterized in that: The expression cassette integrated into the chromosome Int-S6 site is P AOX1 -tHMGR-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 ; The expression cassette integrated into the chromosome Int-S7 site is P AOX1 -ERG20 WW -5GS-t37SabS1 / t37SabS1(H525F)-T AOX1 , where the promoter is P AOX1 , the terminator is T AOX1 .
9. The recombinant Pichia pastoris strain obtained by the method according to any one of claims 1 to 8.
10. Use of the strain according to claim 9 in the production of the monoterpene sabinene by fermentation using methanol as a carbon source.