Application of histone demethylase gene Osjmj719 and encoded protein thereof in regulation and control of rice plant height

Abstract

The invention discloses an application of a histone demethylase gene Osjmj719 and an encoding protein thereof in regulating and controlling the plant height of rice. An overexpression vector of the Osjmj719 gene and a CRISPR / Cas9 knockout vector are constructed, rice is transformed, an overexpression Osjmj719 plant and an Osjmj719 knockout mutant plant are obtained, and the result shows that the plant height of the Osjmj719 knockout mutant is moderately reduced, and the plant height of the overexpression Osjmj719 strain is increased. Therefore, the Osjmj719 gene can be used for regulating and controlling the plant height of the rice, and a candidate gene resource is provided for improving and cultivating new germplasm of the rice by utilizing a molecular means.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more specifically, to the application of a histone demethylase gene Osjmj719 and its encoded protein in regulating the growth of rice plants. Background Art

[0002] Rice (Oryza sativa L.) is an important cereal widely cultivated in tropical Asia. It is not only the staple crop for more than half of the world's population, but also a model organism for genetic and genomic research in monocotyledonous plants. Rice yield depends not only on the number of panicles per unit area, grain weight, and number of grains per panicle, but is also affected by plant height and plant architecture. The semi-dwarf plant architecture of rice can reduce lodging and increase the harvest index, making it an important agronomic trait for achieving high yield. Plant height is one of the important agronomic traits of rice varieties, directly affecting the rice variety's high-yield potential and lodging resistance. Since the beginning of the "Green Revolution" in the 1960s, the plant height control gene SD1 has been widely used in rice semi-dwarf breeding, which has achieved great success in improving rice yield and lodging resistance.

[0003] Histone lysine methylation is an important epigenetic modification. The plant JumonjiC protein is conserved and specific, has been shown to reverse histone methylation, and is associated with plant growth, development, and pathogen resistance. JumonjiC (jmjC) catalyzes lysine demethylation through an oxidative reaction, requiring Fe(II) and α-ketoglutarate as cofactors. Rice Osjmj719 is a jmjC protein that specifically removes methylation at histone H3K9, thereby activating gene expression. Patent CN116837022A discloses the use of Osjmj719 in rice salt stress tolerance, and Patent CN116769824A discloses its use in seed aging resistance. In recent years, with the continuous advancement of science and technology, an increasing number of rice plant height-regulating genes have been discovered and mapped. However, the impact of Osjmj719 on rice plant height has remained largely unreported. Summary of the Invention

[0004] The purpose of the present invention is to overcome the above-mentioned defects and deficiencies in the prior art, and to apply the histone demethylase gene Osjmj719 and its encoded protein in regulating rice plant height, thereby providing candidate gene resources for improving rice plant height.

[0005] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0006] The present invention constructs an Osjmj719 overexpression vector and a CRISPR / Cas9 knockout vector, which are then transformed into rice. Osjmj719-overexpressing plants and Osjmj719 knockout mutants were obtained. The results showed that the Osjmj719 knockout mutants exhibited moderately reduced plant height, while the Osjmj719-overexpressing plants exhibited increased plant height. This suggests that the Osjmj719 gene can be used to regulate rice plant height, providing a candidate gene resource for molecularly improving and cultivating new rice germplasm.

[0007] Therefore, the present invention provides the following new uses of the histone demethylase gene Osjmj719 and its encoded protein:

[0008] The application of the histone demethylase gene Osjmj719 in regulating the growth of rice plants, wherein the nucleotide sequence of the histone demethylase gene Osjmj719 is selected from one of the following groups of sequences:

[0009] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0010] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0011] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0012] The invention discloses an application of histone demethylase Osjmj719 in regulating the growth of rice plants. The amino acid sequence of the histone demethylase Osjmj719 is shown in SEQ ID No. 2.

[0013] Specifically, the regulation is positive regulation, that is, overexpression of the Osjmj719 gene can increase the plant height of rice; knockdown / knockout / silencing of the Osjmj719 gene can reduce the plant height of rice.

[0014] Use of the histone demethylase gene Osjmj719 in cultivating rice varieties with reduced or increased plant height, wherein the nucleotide sequence of the histone demethylase gene Osjmj719 is selected from one of the following groups of sequences:

[0015] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0016] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0017] (c) a nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b);

[0018] The invention relates to the use of histone demethylase Osjmj719 in cultivating rice varieties with reduced or increased plant height. The amino acid sequence of the histone demethylase Osjmj719 is shown in SEQ ID No. 2.

[0019] The present invention also provides a method for cultivating a rice variety with reduced plant height, wherein the function of the Osjmj719 gene in rice is lost or weakened, or the expression level is reduced, and a rice variety with reduced plant height is obtained by screening; the nucleotide sequence of the Osjmj719 gene is selected from one of the following groups of sequences:

[0020] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0021] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0022] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0023] Furthermore, a CRISPR / Cas9 knockout vector of the Osjmj719 gene was constructed and transformed into rice to screen for rice varieties with reduced plant height.

[0024] The present invention also provides a method for cultivating rice varieties with increased plant height, wherein the rice varieties with increased plant height are screened and obtained by increasing the expression level of the Osjmj719 gene in rice; the nucleotide sequence of the Osjmj719 gene is selected from one of the following groups of sequences:

[0025] (a) the nucleotide sequence shown in SEQ ID No. 1;

[0026] (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2;

[0027] (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

[0028] Furthermore, by constructing an overexpression vector of the Osjmj719 gene and transforming it into rice, rice varieties with increased plant height were screened.

[0029] Preferably, the overexpression vector of the Osjmj719 gene is pCAMIBA1302-Osjmj719.

[0030] Preferably, the transformation is carried out by Agrobacterium-mediated transformation or gene gun-mediated transformation.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention provides the use of the histone demethylase gene Osjmj719 and its encoded protein in regulating rice plant height. By constructing an overexpression vector and a CRISPR / Cas9 knockout vector for the Osjmj719 gene and transforming them into rice, the present invention obtained plants overexpressing Osjmj719 and Osjmj719 knockout mutants. The results showed that the Osjmj719 knockout mutants had a moderately reduced plant height, while the Osjmj719 overexpressing strains had an increased plant height. This suggests that the Osjmj719 gene can be used to regulate rice plant height, providing a candidate gene resource for the molecular improvement and cultivation of new rice germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Identification of Osjmj719 transgenic plants. a) Detection results for Osjmj719 mutant material; b) Relative expression levels of overexpressing material lines. Actin was used as an internal reference, and the error is based on three biological replicates.

[0034] Figure 2 Agronomic traits of transgenic Osjmj719 plants were characterized. a) Heading phenotypes of WT, OE, and Osjmj719 mutants (Bar: 10 cm); b) Ear shape of WT, OE, and Osjmj719 mutants (Bar: 10 cm); c) Plant height, number of effective tillers, ear length, number of grains per ear, number of primary and secondary branches, 1000-grain weight, and seed setting rate of WT and OE; d) Plant height, number of effective tillers, ear length, number of grains per ear, number of primary and secondary branches, 1000-grain weight, and seed setting rate of WT and Osjmj719 mutants. Significant differences (*) P < 0.05; extremely significant differences (**) P < 0.01 by t-test. DETAILED DESCRIPTION

[0035] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0036] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.

[0037] Example 1 Obtaining transgenic rice overexpressing the histone demethylase gene Osjmj719

[0038] To construct an Osjmj719 overexpression vector, the Osjmj719 cDNA fragment (NCBI GenBank accession number: XM_015767632.2) was amplified and then inserted into the pCAMIBA1302 vector. The constructed vector was transformed into Agrobacterium tumefaciens strain EHA105 and then into embryonic callus from mature seeds of rice variety "Zhonghua 11." The specific steps involved were as follows:

[0039] 1. Rice RNA extraction: Rice RNA was extracted using the conventional Trizol method in the art.

[0040] 2. Reverse transcription reaction (cDNA synthesis)

[0041] Reverse transcription reaction was performed using Takara's reverse transcription kit. The reaction system and reaction conditions were referred to the kit instructions.

[0042] 3. PCR amplification of target gene

[0043] Based on the CDS and conserved sequence of the Osjmj719 gene, gene cloning primers were designed using Primer 5.0. The gene was ligated into a T vector using the following primers:

[0044] F: 5'-GCCGCAATTTGATTTGATTTCCTCCTT-3';

[0045] R: 5'-GCCATCTGACTGACTCCACAATACAAT-3'

[0046] PCR reaction system:

[0047]

[0048] PCR reaction program: 98°C for 10 s, 55°C for 15 s, and 72°C for 10 s for a total of 32 cycles.

[0049] After the reaction, the PCR amplification products were detected by 1% agarose gel electrophoresis, the PCR products were recovered and purified, and ligated to the pMD-19Tsimple vector (TakaRa). The ligation products were transformed into Escherichia coli DH5α competent cells, and positive clones were screened for bacterial liquid PCR identification. The plasmids of the positive clones were extracted for sequencing.

[0050] 4. Construction of gene overexpression vector

[0051] According to the CDS of Osjmj719 gene, the target fragment was cloned into the pCAMIBA1302 expression vector by homologous recombination, wherein the primers used were as follows: Osjmj719-1302-N: CTTGACCATGGTAGATCTGATGCCGCCCAAGAGGAAGCG, Osjmj719-1302-C: GTTCTTCTCCTTTACTAGTACTAACACTTGGGGCAGACG.

[0052] PCR reaction system: 2× PCR Buffer for KODFX 25 μL, 2 mM dNTPs 10 μL (0.4 mM), Primer F (10 μmol / L) 1.5 μL, Primer R (10 μmol / L) 1.5 μL, DNA template 1 μL (200 ng), KODFX (1 U / μL) 1 μL, ddH2O supplemented to 50 μL;

[0053] PCR reaction program: denaturation at 94°C for 2 min; 98°C for 10 s, and 68°C for 1 min for a total of 30 cycles.

[0054] After the PCR reaction, 1% agarose gel electrophoresis was performed, followed by gel extraction and purification. Gel extraction and purification were performed according to the kit instructions provided by Sangon Biotech (Shanghai) Co., Ltd. The gel-extracted product was ligated with the 1302 vector. The reaction system consisted of 3.5 μL of gel-extracted product, 1.5 μL of digested vector, and 5 μL of Master Assembly Mix. The PCR reaction procedure was as follows: denaturation at 50°C for 40 min; incubation at 4°C for 10 min.

[0055] The recombinant plasmid Osjmj719-OE was obtained by transforming competent E. coli DH5a cells, screening for positive clones, and performing plasmid extraction. The Osjmj719-OE plasmid was transformed into Agrobacterium tumefaciens EHA105, single colonies were picked on a medium containing kanamycin and rifampicin, and positive clones were identified by PCR.

[0056] 5. EHA105-mediated rice transformation:

[0057] Wild-type Zhonghua 11 callus was transformed with Agrobacterium, and transgenic plants were obtained through pre-culture, infection, co-culture, screening of resistant callus tissue, differentiation, rooting, hardening and transplanting.

[0058] (1) Select plump, mature seeds, remove the shells, shake them in 2.5% NaClO solution at 180 rpm for 45 min, rinse with sterile water 3-5 times, air-dry, and plate on induction medium. Culture in the dark at 26°C for 4 weeks, subculture every 15 days.

[0059] (2) Agrobacterium containing the overexpression vector Osjmj719-OE was streaked onto LB medium and cultured in the dark at 28°C for 3 days.

[0060] (3) Pick a single colony and inoculate it into 5 ml of LB liquid medium containing antibiotics, and culture it at 28°C with shaking overnight.

[0061] (4) Centrifuge the fresh Agrobacterium culture solution, collect it (to a moderate concentration), and place it in AAM liquid culture medium. Incubate it in the dark at 26°C for 2 to 5 hours.

[0062] (5) Select dense callus particles (3-5 mm in diameter) for transformation. Immerse the callus particles in the prepared AAM suspension for 5 min. Discard the Agrobacterium suspension and remove excess suspension from the callus using sterile filter paper. Transfer the callus to a solid co-culture medium covered with a layer of sterile filter paper and culture in the dark at 28°C for 3 days.

[0063] (6) After co-cultivation, the calli were washed three times with sterile water, rinsed once with AAM culture medium, and air-dried. The calli were then transferred to a screening medium containing antibiotics and screened for one month.

[0064] (7) After screening, the resistant callus is transferred to a differentiation medium containing antibiotics and cultured at 26°C under light conditions until green shoots are differentiated. The seedlings are transferred to a rooting medium (containing antibiotics) for culture. Remove the seedlings from the rooting medium, wash off the remaining medium, and harden the seedlings in clean water. When white new roots grow, transplant them to a greenhouse or field.

[0065] The positive plants screened were transplanted to the soil for growth, and the seeds were collected when they matured to obtain the T0 generation plants, which were screened with hygromycin (HPT) and analyzed by quantitative RT-PCR. First, the total RNA of the overexpressing transgenic lines was extracted, with 3 biological replicates for each line and 3 technical replicates for each biological replicate. Rice Aactin was used as the internal reference gene, and the RT-PCR primer sequences were qOsjmj719N: 5'-GCTGGTACCCGCATCTAACA-3', qOsjmj719C: 5'-ACCATCGGCAAACTCCTTGT-3'; Actin-QF: TGAAGATCAAGGTGGTGGCAC, Actin-QR: TGCTGGACCCGACTCATCATA. The reaction system and conditions of quantitative PCR were in accordance with the reaction system and reaction conditions of qRT-PCR according to TaKaRa Company, No.: RR820Q. Premix Ex Taq TMII (Tli RNaseH Plus) kit instructions were used for qRT-PCR using a LightCycler 480 (Roche, Germany) quantitative PCR instrument. The reaction conditions were as follows: 95°C, 30s; 45 cycles (95°C, 5s; 68°C, 30s). After the qRT-PCR reaction, 2 -ΔΔCt Methods The obtained data were analyzed by relative quantitative analysis. The expression level of Osjmj719 gene in the overexpressed transgenic positive plants was detected at the mRNA level. The results were as follows Figure 1 As shown in Figure b, compared to wild-type ZH11 (WT) plants, eight strains of Osjmj719-positive plants showed significantly elevated expression levels. OE-11 showed the strongest overexpression effect, with an approximately 350-fold increase in expression. Three strains, OE1, OE2, and OE49, were then selected for subsequent experiments. The expression levels of the Osjmj719 gene in these three strains were significantly upregulated compared to the wild-type, providing ideal research material for subsequent experiments.

[0066] After harvesting T1 seeds from strains overexpressing the Osjmj719 gene, to ensure homozygosity of the seeds from the selected T1 generation for planting, the T2 generation of strains OE-1, OE-2, and OE-49 were screened using MS medium with hygromycin resistance. After seeding, the seeds were cultured in an incubator. As the seeds germinated, rooted, and grew, some seeds in the culture medium germinated, rooted, and grew normally; others germinated but did not root or grow normally; and still others failed to germinate, root, or grow, with the embryos turning black, resulting in a 3:1 segregation. When all seeds in the same flask cultured in MS medium germinated, rooted, and grew normally, the overexpression strain was considered homozygous. This method ultimately identified homozygous strains of OE-1, OE-2, and OE-49 for phenotypic observation and other biological experiments.

[0067] Example 2 Obtaining transgenic rice with knockout of histone demethylase gene Osjmj719

[0068] 1. Construction of CRISPR / Cas9 rice knockout vector

[0069] The target site was designed using the CRISPR target site online design website E-CRISPR (http: / / www.e-crisp.org / E-CRISP / ) to construct a single target knockout vector. The corresponding primers are:

[0070] Os719-U6aF: CAGAGAACCGCAAGAAAGCGC;

[0071] Os719-U6aR: AACGCGCTTTCTTGCGGTTCT.

[0072] The specific process of vector construction is as follows:

[0073] (1) Preparation of double-stranded adapters: 1 μL each of the forward and reverse primers of the target site adapter and 8 μL of ddH2O were mixed evenly, incubated at 90°C for 30 seconds, and then cooled to room temperature to complete annealing.

[0074] (2) Ligation of gRNA vector. The reaction system was as follows (10 μL): 10×T4 Ligase Buffer 1.0 μL, pYLgRNA-U6a 0.5 μL, adapter primer 0.5 μL, BsaⅠ restriction endonuclease 0.5 μL, T4 DNA ligase 0.5 μL, ddH2O 6.0 μL.

[0075] PCR reaction program: 37°C for 5 min, 20°C for 5 min, 5 cycles.

[0076] (3) gRNA expression cassette amplification:

[0077] Take 1 μL of ligation product as template and use KOD-Plus high-fidelity enzyme to construct a 15 μL system for amplification: 10×KOD-Plus buffer 1.5 μL, dNTPs 0.6 μL, MgSO4 0.6 μL, KOD-Plus

[0078] 0.3 μL, 9 μL ddH2O, and finally 1 μL template were added. Two PCR reactions were performed for each expression cassette using the same primer combination (reaction 1: U-F + Os719-U6aR, reaction 2: Os719-U6aF + gRNA-R). The PCR reaction program was 95°C for 2 min, followed by 25 cycles of 95°C for 10 s, 60°C for 15 s, and 68°C for 20 s.

[0079] The PCR products from reactions 1 and 2 were diluted 10-fold, and 1 μL of each was mixed as template for the second round of PCR amplification. The PCR system consisted of 3 μL of 10× KOD-Plus buffer, 1.2 μL of dNTPs, 1.2 μL of MgSO₄, 0.6 μL of KOD-Plus, 20 μL of ddH₂O, 1 μL of template, and 1.5 μL each of Cas-B2' and Cas-BL. The PCR program was 95°C for 2 min, followed by 20 cycles of 95°C for 10 s, 58°C for 15 s, and 68°C for 20 s. After completion of the PCR reaction, the products were subjected to agarose gel electrophoresis, and the appropriate size bands were excised and recovered.

[0080] (4) Ligation of pYLCRISPR / Cas9-MH vector: 0.5 μL gRNA vector ligation amplification recovery product, 1.5 μL 10×T4 Ligase Buffer, 1 μL BsaⅠ, 2 μL p YLCRISPR / Cas9-MH plasmid, 10 μL ddH2O, enzyme digestion at 37°C for 10 min, add 0.75 μL ATP and 0.5 μL T4 DNA ligase, mix well and place in PCR instrument, 37°C for 5 min, 10°C for 5 min, 20°C for 5 min, for a total of 10 cycles:

[0081] (4) Transformation of E. coli and plasmid sequencing: The above ligation product was transformed into DH5α competent cells, spread on LB solid medium with kanamycin, and cultured at 37°C overnight. Single colonies were picked from the plate and amplified in PCR using pYLCRISPR / Cas9-MH vector detection primers SP1 and SP2. After the target band appeared on electrophoresis, it was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing verification to obtain a positive strain. The plasmid was extracted to prepare for the next step.

[0082] 2. Agrobacterium-mediated transformation of rice CRISPR / Cas 9 knockout vector.

[0083] 3. Detection of transgenic positive rice lines and screening of mutant plants

[0084] Using Agrobacterium-mediated rice transgenic technology, callus tissue from Zhonghua 11 was transformed and four independent transformed lines were obtained by hygromycin selection. Total DNA from rice leaves was extracted using the CTAB method, and primers hpt-t / F and hpt-t / R were detected using 2× Taq Master Mix and hygromycin:

[0085] hpt-t / F:GATGTTGGCGACCTCGTATTGG;

[0086] hpt-t / R: CGTGCTTTCAGCTTCGATGTAGGAG.

[0087] PCR amplification was performed according to the following system: DNA template 0.5 μL, 2× Taq Master Mix 10 μL, SP1 0.5 μL, SP2 0.5 μL, ddH2O 8.5 μL.

[0088] PCR program settings: 95°C for 3 min; 95°C for 15 s, 56°C for 20 s, 72°C for 1 min, 72°C for 5 min, 30 cycles; 16°C Hold.

[0089] After PCR, the amplified products were subjected to 1% agarose gel electrophoresis to observe whether a band of approximately 600 bp was produced in each plant. If the target band was produced, it indicated that the knockout vector had integrated into the chromosome of the plant corresponding to the template DNA. T0 transgenic plants were tested using hygromycin-specific primers.

[0090] 4. Identification of mutant plant types

[0091] Mutant detection primers 719-F: CAGTTATTGGGTGCGGTTGC; 719-R: TCCACTGTCCTTCCTTTGGC were designed using Primer Premier 5 upstream and downstream of the target site. DNA was extracted from positive plants, and PCR reactions were performed using 2× Gold Mix (green) and primers 719-F and 719-R according to the following system:

[0092] After vector construction, enzyme ligation and E. coli competent transformation, plaque PCR identification was performed, and the results were as follows: Figure 1 As shown in a, of the 13 transgenic knockout-positive rice lines from the T1 generation, Osjmj719-19 and Osjmj719-30 were homozygous mutants with a 3-base deletion. Individual lines lacking the hygromycin marker gene were screened in the T2 generation, yielding homozygous mutant lines Osjmj719-14, Osjmj719-21, Osjmj719-28, and Osjmj719-35, each harboring a 1-base insertion.

[0093] Finally, when the T3 generation of Osjmj719 gene CPISPR / Cas9 gene-edited strains were planted, homozygous mutant strains were identified and numbered: Osjmj719-14, Osjmj719-19, Osjmj719-21, and Osjmj719-30, respectively. These lines provided raw materials for subsequent experiments.

[0094] Example 3 Investigation of the characteristics of transgenic plants of Osjmj719

[0095] The agronomic traits of wild-type rice ZH11 and Osjmj719 related transgenic lines at maturity were investigated, mainly including plant height, panicle length, number of effective tillers, number of primary stalks, number of secondary stalks, number of filled grains per panicle, number of empty husks per panicle, and seed setting rate, and statistical analysis was performed.

[0096] Plant height (cm): The height from the base of the main stem to the top of the ear. Measure at least 15 plants and take the average value.

[0097] Ear length (cm): The length from the main stem to the ear tip. Measure at least 15 plants and take the average value.

[0098] Number of effective tillers: Manually count the number of effective tillers per plant, count at least 15 plants, and take the average value.

[0099] Number of primary branches: the number of effective ears produced directly on the main stem.

[0100] Secondary branches: the number of branches formed on the primary branches.

[0101] Number of grains per ear: the number of mature seeds actually formed on each ear.

[0102] Number of empty husks per ear: the number of seeds on each ear that failed to develop into mature seeds.

[0103] Fruit set rate: the ratio of the number of filled grains per ear to the total number of grains per ear.

[0104] Thousand-grain weight: the total weight of one thousand grains of rice.

[0105] The results are as follows Figure 2 As shown in Figure 2, the plant height of Osjmj719 overexpressing plants at the heading stage was higher than that of the wild type, while the plant height of Osjmj719 mutant plants was lower ( Figure 2 a), all reached significant differences ( Figure 2 c and d); The ear length of Osjmj719 mutant plants was increased compared with the wild type ( Figure 2 b), reached significant difference ( Figure 2 d), while the spike length of Osjmj719-overexpressing plants showed no significant change compared with the wild type ( Figure 2 c).

[0106] The number of grains per panicle, the number of secondary branches, and the seed setting rate of Osjmj719-overexpressing plants showed a downward trend compared with the wild type, with significant differences in OE-1 and OE-2. The number of primary branches and 1000-grain weight of the overexpressing lines showed an upward trend compared with the wild type, with significant differences in the number of primary branches of OE-1 and OE-49 compared with the wild type, and a highly significant difference in the 1000-grain weight of OE-2 compared with the wild type. There was no significant change in the number of effective tillers of the overexpressing lines compared with the wild type ( Figure 2 c).

[0107] The number of primary and secondary branches of the Osjmj719 mutant plants showed an upward trend compared with the wild type, and Osjmj719-19 showed extremely significant differences in both. The thousand-grain weight and seed setting rate showed a downward trend compared with the wild type, and the thousand-grain weight of Osjmj719-21 showed an extremely significant difference compared with the wild type, and the seed setting rate of Osjmj719-19 showed an extremely significant difference compared with the wild type. There was no significant change in the number of grains per ear of the mutant lines compared with the wild type ( Figure 2 d).

[0108] These statistical data show that overexpression and mutation of Osjmj719 have significant effects on plant height, number of primary branches, number of secondary branches, 1000-grain weight and fruit set rate. In particular, the three strains after Osjmj719 mutation were affected in terms of plant height and ear length, with plant height becoming shorter and ear length increasing.

Claims

1. The application of the histone demethylase gene Osjmj719 in regulating the growth of rice plants, characterized in that: The nucleotide sequence of the histone demethylase gene Osjmj719 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

2. The application of histone demethylase Osjmj719 in regulating the growth of rice plants, characterized in that: The amino acid sequence of the histone demethylase Osjmj719 is shown in SEQ ID No.

2.

3. The use of the histone demethylase gene Osjmj719 in cultivating rice varieties with reduced or increased plant height, characterized in that: The nucleotide sequence of the histone demethylase gene Osjmj719 is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

4. The use of histone demethylase Osjmj719 in cultivating rice varieties with reduced or increased plant height, characterized in that: The amino acid sequence of the histone demethylase Osjmj719 is shown in SEQ ID No.

2.

5. A method for cultivating a rice variety with reduced plant height, characterized in that: The function of the Osjmj719 gene in rice is lost or weakened, or the expression level is reduced, and a rice variety with reduced plant height is screened; the nucleotide sequence of the Osjmj719 gene is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

6. The method according to claim 5, characterized in that A CRISPR / Cas9 knockout vector for the Osjmj719 gene was constructed and transformed into rice, and rice varieties with reduced plant height were screened.

7. A method for cultivating rice varieties with increased plant height, characterized in that: The expression level of the Osjmj719 gene in rice is increased, and a rice variety with increased plant height is screened and obtained; the nucleotide sequence of the Osjmj719 gene is selected from one of the following groups of sequences: (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a nucleotide sequence encoding a protein having an amino acid sequence as shown in SEQ ID No. 2; (c) A nucleotide sequence complementary to the nucleotide sequence described in any one of (a) to (b).

8. The method according to claim 7, characterized in that: An overexpression vector of the Osjmj719 gene was constructed and transformed into rice to screen for rice varieties with increased plant height.

9. The method according to claim 8, characterized in that The overexpression vector of the Osjmj719 gene is pCAMIBA1302-Osjmj719.

10. The method according to claim 6 or 8, characterized in that: The transformation is carried out by Agrobacterium-mediated transformation or gene gun-mediated transformation.

Images