In vivo targeting applications of lipid nanoparticles

Abstract

The invention relates to in vivo targeting application of lipid nanoparticles. Specifically, the invention relates to the technical field of medical treatment, in particular to application of cationic lipid shown in a formula III in preparation of a nanoparticle composition targeting reproductive organs, cells of the reproductive organs and / or tissues of the reproductive organs. According to the invention, lipid nanoparticle-mRNA compound targeted delivery therapy is carried out on a patient with spermatogenesis disorder (azoospermia) caused by MSH5 / MAPS gene variation so as to promote male spermatogenesis function recovery. # imgabs0 #

Description

Technical Field

[0001] The present invention relates to the field of medical technology, and in particular to in vivo targeted application of lipid nanoparticles. Background Art

[0002] Currently, the fertility of the childbearing-age population worldwide is showing an overall downward trend. The WHO Special Programme for Human Reproduction reports that the global infertility rate is at least 15%, and there are approximately 60-80 million infertile couples worldwide. Infertility, along with tumors and cardiovascular diseases, has become one of the three major diseases affecting human health today.

[0003] Current treatment options for male infertility primarily include medication and surgery. Medication primarily includes antioxidants, estrogen receptor inhibitors, aromatase inhibitors, carnitine, and related Chinese patent medicines. However, there is a lack of effective medication or surgical treatment for non-obstructive azoospermia, particularly for male infertility with clear pathogenic variants in key spermatogenesis genes leading to spermatogenesis impairment.

[0004] Since the concept of gene therapy was first proposed in the 1960s and 1970s, gene therapy technology has advanced significantly, making it possible to completely cure a wide range of diseases caused by genetic factors. CRISPR / Cas9 technology, as one of the gene therapy approaches for inherited diseases, has been successfully used in clinical studies for a variety of monogenic diseases, including hematologic malignancies, non-small cell lung cancer, and hereditary blindness. However, its clinical application in humans is limited to somatic cells, and due to off-target effects and unproven safety, human gametes and embryos have been off-limits to gene editing. Therefore, developing new approaches suitable for the clinical treatment of meiotic disorders caused by various genetic mutations presents a major challenge for reproductive medicine physicians. Currently, mRNA delivery is the most promising therapeutic approach for clinical application. Although mRNA carries genetic information, it relies on endocytosis to enter the cytoplasm for direct translation. Therefore, the genetic information it carries is difficult to integrate into the genome, making it significantly safer than gene editing technologies. COVID-19 vaccines using mRNA delivery technology have been widely used by billions of people worldwide, and their safety and efficacy have been proven. Furthermore, mRNA delivery has been successfully used in research to treat a variety of monogenic genetic diseases, including cystic fibrosis, Duchenne muscular dystrophy, glucose-6-phosphatase deficiency, spinal muscular atrophy, and hereditary retinal dystrophy. Several mRNA-delivered drugs have entered clinical trials. mRNA itself carries a negative charge, making it difficult to directly penetrate the cell membrane and enter the cytoplasm. To facilitate the entry of exogenous mRNA into the cytoplasm while protecting it from degradation, mRNA is often delivered using a vector packaged with the mRNA. Currently, commonly used delivery vectors include AAV and lipid nanoparticles (LNPs). Compared to AAV vectors, LNP components are non-viral in origin and offer significant advantages in ease of preparation, repeat dosing safety, and carrier capacity. Therefore, using LNPs to deliver mRNA is a promising new approach for resolving meiotic disorders. Consequently, developing new approaches suitable for the clinical treatment of meiotic disorders caused by genetic mutations is a major challenge facing reproductive medicine practitioners. Currently, mRNA delivery is the most promising therapeutic approach for clinical application. Summary of the Invention

[0005] This patent intends to develop a lipid nanoparticle-mRNA complex for patients with spermatogenesis disorders (azoospermia) caused by genetic mutations, especially MSH5 / MAPS gene mutations, and targeted delivery therapy through microsurgical technology, in order to promote the recovery of male spermatogenesis function.

[0006] The present invention aims to provide a new solution for the treatment of male spermatogenesis disorders with a lipid nanoparticle complex, mainly targeting male patients with spermatogenesis disorders caused by pathogenic mutations in MSH5 / MAPS.

[0007] In a first aspect, the present invention provides use of a cationic lipid represented by Formula III in preparing a nanoparticle composition targeting reproductive organs, cells of reproductive organs and / or tissues of reproductive organs.

[0008]

[0009] In one or more embodiments, the reproductive organ is a testicle, a vas deferens, or an accessory gland, preferably, the accessory gland includes a seminal vesicle and / or a prostate.

[0010] In one or more embodiments, the cell is a germ cell.

[0011] In one or more embodiments, the germ cell is a spermatogonia or spermatocyte.

[0012] In one or more embodiments, the nanoparticle composition further comprises a phospholipid, optionally further comprising cholesterol and / or a PEGylated lipid. In one or more embodiments, the PEGylated lipid is a PEGylated phospholipid.

[0013] In one or more embodiments, the tissue is one or more of epithelial tissue, connective tissue, muscle tissue, glandular tissue and germinal stem cell tissue, such as spermatogenic epithelial tissue, interstitial tissue, epididymal epithelial tissue, vas deferens smooth muscle tissue, seminal vesicle glandular epithelium, bulbourethral gland mucosal glandular tissue; including but not limited to: seminiferous tubule epithelium, epididymal epithelium, glandular epithelium, testicular interstitial tissue, vas deferens connective tissue, vas deferens smooth muscle, urethral sphincter, seminal vesicle, prostate, bulbourethral gland, spermatogonia.

[0014] In one or more embodiments, the nanoparticle compositions are used to deliver therapeutic and / or prophylactic agents to reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs.

[0015] In one or more embodiments, the method for preparing a nanoparticle composition comprises the step of mixing a lipid component and a therapeutic and / or prophylactic agent to prepare the nanoparticle composition, wherein the lipid component comprises a cationic lipid of Formula III and a phospholipid. Preferably, the lipid component further comprises cholesterol and / or a PEGylated lipid.

[0016] In one or more embodiments, the method includes microfluidics, precipitation, emulsification, solvent evaporation, ultrasonic treatment, and the like.

[0017] In one or more embodiments, the method is a microfluidic method. In one or more embodiments, the method for preparing the nanoparticle composition comprises the steps of mixing the lipid component and the therapeutic and / or prophylactic agent and microfluidizing.

[0018] In one or more embodiments, the therapeutic and / or prophylactic agent comprises a polynucleotide.

[0019] In one or more embodiments, the polynucleotide comprises the coding sequence of a gene.

[0020] In one or more embodiments, the polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression. In one or more embodiments, the nucleic acid is selected from the group consisting of: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). In one or more embodiments, the nucleic acid construct is mRNA.

[0021] A second aspect of the present invention provides the use of a cationic lipid represented by formula III in the preparation of a medicament for treating a disease that benefits from delivering a therapeutically active substance to reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs.

[0022] In one or more embodiments, the disease is a germ cell disease.

[0023] In one or more embodiments, the disease is spermatogenesis disorder or azoospermia.

[0024] In one or more embodiments, the disease is spermatogenesis disorder caused by meiotic disorder.

[0025] In one or more embodiments, the disease is spermatogenesis disorder caused by mutations in the MSH5 and / or MAPS genes.

[0026] In one or more embodiments, the use comprises delivering the therapeutically active substance using a nanoparticle composition comprising a cationic lipid of Formula III.

[0027] In one or more embodiments, the therapeutically active substance comprises a polynucleotide.

[0028] In one or more embodiments, the polynucleotide comprises the coding sequence of a gene.

[0029] In one or more embodiments, the polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression. In one or more embodiments, the nucleic acid is selected from the group consisting of: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). In one or more embodiments, the nucleic acid construct is mRNA.

[0030] The third aspect of the present invention provides a nanoparticle composition, which comprises (1) a lipid component, and (2) a therapeutic agent and / or a preventive agent, wherein the lipid component comprises a cationic lipid and a phospholipid represented by Formula III, and the therapeutic agent and / or the preventive agent is a polynucleotide comprising a coding sequence of MSH5 and / or MAPS.

[0031] In one or more embodiments, the nanoparticle composition optionally further comprises cholesterol and / or a PEGylated lipid. In one or more embodiments, the PEGylated lipid is a PEGylated phospholipid.

[0032] In one or more embodiments, the polynucleotide is RNA or DNA.

[0033] In one or more embodiments, the polynucleotide is a coding sequence for MSH5 and / or MAPS.

[0034] In one or more embodiments, the polynucleotide is Msh5 mRNA and / or Maps mRNA, the sequence of the Msh5 mRNA is shown in SEQ ID NO: 1, and the sequence of the Maps mRNA is shown in SEQ ID NO: 5.

[0035] In one or more embodiments, the polynucleotide is an RNA comprising, in the 5'-3' direction: a 5' cap structure, a 5' UTR, a coding sequence of MSH5 and / or MAPS, a 3' UTR, and Poly (A).

[0036] In one or more embodiments, the backbone of the polynucleotide is pUC plasmid, pA17-eGFP plasmid, pET plasmid (pET28a(+), pET32a(+)), pGEX plasmid, pMAL plasmid, preferably, the backbone of the polynucleotide is pUC plasmid.

[0037] In a fourth aspect, the present invention provides a method for preparing a nanoparticle composition as described in any embodiment herein, comprising the step of mixing a cationic lipid and a phospholipid represented by formula III with a therapeutic agent and / or a preventive agent to prepare the nanoparticle composition.

[0038] In one or more embodiments, the nanoparticle composition optionally further comprises cholesterol and / or a PEGylated lipid. In one or more embodiments, the PEGylated lipid is a PEGylated phospholipid.

[0039] In a fifth aspect, the present invention provides a pharmaceutical composition comprising the nanoparticle composition according to any embodiment herein and a pharmaceutically acceptable excipient.

[0040] In a sixth aspect, the present invention provides a method for delivering a therapeutic agent and / or a preventive agent to reproductive organs, cells of reproductive organs and / or tissues of reproductive organs, the method comprising delivering the therapeutic agent and / or preventive agent using a nanoparticle composition containing a cationic lipid represented by formula III.

[0041] In one or more embodiments, the therapeutic and / or prophylactic agent comprises a polynucleotide.

[0042] In one or more embodiments, the polynucleotide comprises the coding sequence of a gene.

[0043] In one or more embodiments, the polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression. In one or more embodiments, the nucleic acid is selected from the group consisting of: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1). In one or more embodiments, the nucleic acid construct is mRNA.

[0044] A seventh aspect of the present invention provides a non-therapeutic method for producing a polypeptide in a germ cell, the method comprising contacting the cell with a nanoparticle composition comprising: (1) a lipid component comprising a cationic lipid and a phospholipid as shown in Formula III, and (2) a polynucleotide encoding the polypeptide, whereby the polynucleotide can be translated in the germ cell to produce the polypeptide.

[0045] In one or more embodiments, the nanoparticle composition optionally further comprises cholesterol and / or a PEGylated lipid. In one or more embodiments, the PEGylated lipid is a PEGylated phospholipid.

[0046] In one or more embodiments, the polynucleotide is RNA or DNA.

[0047] In one or more embodiments, the polynucleotide is a coding sequence for MSH5 and / or MAPS.

[0048] In one or more embodiments, the polynucleotide is Msh5 mRNA and / or Maps mRNA, the sequence of the Msh5 mRNA is shown in SEQ ID NO: 1, and the sequence of the Maps mRNA is shown in SEQ ID NO: 5.

[0049] In one or more embodiments, the polynucleotide is an RNA comprising, in the 5'-3' direction: a 5' cap structure, a 5' UTR, a coding sequence of MSH5 and / or MAPS, a 3' UTR, and Poly (A).

[0050] In one or more embodiments, the backbone of the polynucleotide is pUC plasmid, pA17-eGFP plasmid, pET plasmid (pET28a(+), pET32a(+)), pGEX plasmid, pMAL plasmid, preferably, the backbone of the polynucleotide is pUC plasmid. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Schematic diagram for high-throughput screening of spermatocyte-targeted LNPs.

[0052] Figure 2 Characterization diagram of LNPs synthesized from 30 cationic lipids.

[0053] Figure 3 Fluorescence images of human and mouse cell lines transfected with Pool1-3-EGFP mRNA in vitro.

[0054] Figure 4 This is a tissue fluorescence image of the testicular efferent ductules of mice injected with Pool1-3-EGFP mRNA retrogradely.

[0055] Figure 5 Immunofluorescence images of spermatogenic cells in the testicular efferent ductules of Pool1-3-EGFP mRNA mice after retrograde injection.

[0056] Figure 6 This is a tissue fluorescence image of the testicular efferent ductules of Pool1 LNP01-10-EGFP mRNA mice after retrograde injection.

[0057] Figure 7 This is a fluorescence image of human 293T cell line transfected with Pool1 LNP 03-EGFP mRNA in vitro.

[0058] Figure 8 This is an immunofluorescence image of EGFP expression in spermatogenic cells in the testicular efferent ductules of wild-type mice injected retrogradely with Pool1 LNP 03.

[0059] Figure 9 No EGFP expression was observed in spermatogenic cells when Pool1 LNP01-10 was retrogradely injected into the efferent ducts of the testes of wild-type mice except 03.

[0060] Figure 10 To construct Msh5 and Maps+EGFP mRNA-LNP03 pattern maps respectively.

[0061] Figure 11 Msh5 mRNA+EGFP mRNA-LNP03 Msh5 D486Y / D486Y Tissue fluorescence images of the mouse testis at different time points after retrograde injection of the efferent ductus.

[0062] Figure 12 In (a) and (b, c), Msh5 mRNA+EGFP mRNA-LNP03 Msh5 D486Y / D486Y H&E staining and immunofluorescence images of testicular tissue at different time points after retrograde injection of the efferent ductus of the mouse testis.

[0063] Figure 13 In the figure, (a) and (b) are immunofluorescence images of testicular tissue at different time points after retrograde injection of Maps mRNA+EGFP mRNA-LNP03 Maps knockout mice into the testicular efferent ductus.

[0064] Figure 14 This is the map of the Msh5-pUC19-T7 plasmid.

[0065] Figure 15 This is the Maps-pUC19-T7 plasmid map. DETAILED DESCRIPTION

[0066] To facilitate understanding of the features and effects of the present invention by those skilled in the art, the following provides a general description and definition of the terms and expressions used in the specification and claims. Unless otherwise indicated, all technical and scientific terms used herein have the ordinary meanings as understood by those skilled in the art regarding the present invention. In the event of conflict, the definitions in this specification shall prevail.

[0067] The theories or mechanisms described and disclosed herein, whether correct or incorrect, should not limit the scope of the present invention in any way, that is, the present invention can be implemented without being limited by any specific theory or mechanism.

[0068] Herein, “comprising,” “including,” “containing” and similar terms encompass the meanings of “consisting essentially of” and “consisting of,” for example, when “A comprises B and C” is disclosed herein, “A consists essentially of B and C” and “A consists of B and C” should be deemed to have been disclosed herein.

[0069] Throughout this document, all features, such as values, amounts, amounts, and concentrations, specified in numerical ranges or percentage ranges are provided for simplicity and convenience only. Accordingly, the description of numerical ranges or percentage ranges should be considered to encompass and specifically disclose all possible subranges and individual values within those ranges (including integers and fractions).

[0070] In this document, unless otherwise specified, percentage refers to mass percentage and ratio refers to mass ratio.

[0071] Herein, the sum of the percentages of the various components of the composition is 100%.

[0072] Herein, a compound heterozygous mutation refers to an individual carrying two different mutant alleles of the same gene on a pair of homologous chromosomes (ie, both alleles are mutated, but the mutation sites or types are different).

[0073] Herein, a homozygous pathogenic mutation refers to an individual carrying two identical pathogenic mutation alleles of the same gene on a pair of homologous chromosomes (i.e., both alleles have the same mutation).

[0074] As used herein, the terms "about" and "approximately" when applied to one or more values of interest refer to values that are similar to a specified reference value. In certain embodiments, the terms "about" or "approximately" refer to values that are 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction (greater than or less than) the reference value, unless otherwise specified or obvious from the context (unless the number exceeds 100% of the possible value). For example, when used in the context of the amount of a given compound in a lipid component of a nanoparticle composition, "about" can mean + / - 10% of the stated value. For example, a nanoparticle composition comprising a lipid component having approximately 40% of a given compound can contain 30-50% of the compound.

[0075] As used herein, the term "compound" is intended to include all isomers and isotopes of the structure shown. "Isotopes" refer to atoms having the same atomic number but different mass numbers due to different numbers of neutrons in the nucleus, for example, isotopes of hydrogen include tritium and deuterium. In addition, the compounds, salts, or complexes of the present disclosure can be prepared by combining with solvents or water molecules to form solvates and hydrates by conventional methods.

[0076] As used herein, the term "contacting" means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means physically connecting the mammalian cell and the nanoparticle. Methods for contacting cells with external entities in vivo and in vitro are well known in the art of biology. For example, a nanoparticle composition can be contacted with a mammalian cell via different routes of administration and can involve different amounts of the nanoparticle composition. In addition, the nanoparticle composition can contact more than one type of mammalian cell.

[0077] In this context, alleles are different forms of the same gene (caused by slight differences in the DNA sequence) located at the same position on a pair of homologous chromosomes (one inherited from the father and one from the mother). For example, the gene that controls human blood type has three alleles: A, B, and O. These alleles are located at the same position on chromosome 9 and determine different blood types (A, B, AB, and O).

[0078] Herein, when describing embodiments or examples, it should be understood that they are not intended to limit the present invention to these embodiments or examples. On the contrary, all alternatives, modifications and equivalents of the methods and materials described herein are encompassed within the scope defined by the claims.

[0079] In this document, for the sake of brevity, not all possible combinations of the various technical features in each embodiment or example are described. Therefore, as long as there are no contradictions in the combination of these technical features, the various technical features in each embodiment or example can be combined in any way, and all possible combinations should be considered to be within the scope of this specification.

[0080] The treatment of non-obstructive azoospermia (NOA) caused by meiotic disorders has always been a "difficulty" and "pain point" in the field of reproductive medicine. The Msh5 gene (the human homologous gene is Msh5) belongs to the MutS homologous protein family. It participates in DNA mismatch repair and homologous chromosome association during meiosis and is crucial for germ cell development (such as meiosis of spermatocytes). This gene defect can lead to meiotic abnormalities and cause phenotypes such as infertility. Relying on the reproductive sample library, the present invention discovered Msh5 compound heterozygous mutation families P7824 and P7602, and homozygous pathogenic mutation family P8944, all of which showed NOA clinically. Pathology suggested that the patient's spermatogenesis was blocked in meiosis, confirming that the MSH5 pathogenic mutation caused the patient's spermatogenesis disorder. The present invention further constructed Msh5 based on the human pathogenic mutation site. D486Y / D486Y The point mutation mice have a phenotype of meiotic arrest, which is consistent with the patient's phenotype, providing an animal model for subsequent treatment research. This is how the present invention was completed.

[0081] Nanoparticle composition and preparation method thereof

[0082] The present invention provides a nanoparticle composition, which comprises (1) a lipid component and (2) a therapeutic agent and / or a preventive agent, wherein the lipid component comprises a cationic lipid and a phospholipid represented by formula III, and the therapeutic agent and / or the preventive agent is a polynucleotide comprising a coding sequence of MSH5 and / or MAPS.

[0083] As used herein, a "lipid component" is a component of a nanoparticle composition that includes one or more lipids. For example, the lipid component may include one or more cationic / ionizable, pegylated, structured or other lipids, such as phospholipids.

[0084] As used herein, "germ cell specific" means that the expression in germ cells is significantly higher than that in other tissues.

[0085] In the nanoparticle composition herein, the lipid component includes cationic lipids, cholesterol, auxiliary phospholipids and PEGylated phospholipids.

[0086] In the nanoparticle composition herein, the cationic lipid structure is prepared with reference to PCT / CN2023 / 085894, which is incorporated herein by reference in its entirety. In an exemplary embodiment, the cationic lipid structure is as shown in Formula III.

[0087] The nanoparticle composition optionally further comprises cholesterol and / or PEGylated lipids.

[0088] The lipid component of nanoparticle composition can comprise the lipid of one or more PEG or PEG modification.This type of material can alternatively be called PEGylated lipid.PEG lipid is the lipid modified with polyethylene glycol.PEG lipid can be selected from the dialkylamine, diacylglycerol, dialkyl glycerol and its mixture that the phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified that PEG-modifies.For example PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC or PEG-DSPE lipid.

[0089] The lipid component of the nanoparticle composition can include one or more phospholipids, such as one or more unsaturated lipids. The phospholipids can be assembled into one or more lipid bilayers. Typically, the phospholipids can include a phospholipid portion and one or more fatty acid portions. The phospholipids that can be used for the compositions and methods described herein can be selected from DSPC, DOPE, DLPC, DMPC, DOPC, DPPC, DUPC, POPC, OChemsPC, DOPG, and sphingomyelin. In some embodiments, the nanoparticle composition comprises DSPC.

[0090] In some embodiments, the lipid component of the nanoparticle compositions described herein includes a cationic lipid represented by Formula III, DMG-PEG2000, DSPC, and cholesterol.

[0091] Nanoparticle compositions can include one or more therapeutic and / or prophylactic agents. The present invention provides methods for delivering therapeutic and / or prophylactic agents to mammalian cells or organs, producing polypeptides of interest in mammalian cells, and treating diseases or conditions in mammals in need thereof, comprising administering to the mammal and / or contacting the mammalian cells with a nanoparticle composition comprising a therapeutic and / or prophylactic agent.

[0092] A therapeutic and / or prophylactic agent can be a substance that, once delivered to a cell or organ, brings about a desired change in the cell, organ, or other body tissue or system. Such substances can be used to treat one or more diseases or conditions. In some embodiments, the therapeutic and / or prophylactic agent is a small molecule drug that can be used to treat a specific disease or condition.

[0093] In some embodiments, the therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide", in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide chain. Exemplary polynucleotides used in accordance with the present disclosure include, but are not limited to, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), their hybrids, self-replicating RNA, circular RNA, RNAi inducers, one or more of RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like.

[0094] In some embodiments, the therapeutic and / or preventive agent is RNA. The RNA that can be used in the compositions and methods described herein can be selected from, but is not limited to, short chains, antagonists, antisense chains, ribozymes, small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer-substrate RNA, small hairpin RNA (shRNA), transfer RNA (tRNA), messenger RNA (mRNA), self-replicating RNA (saRNA), circular RNA (circRNA), and mixtures thereof. In certain embodiments, the polynucleotide is RNA or DNA. In certain embodiments, the RNA is mRNA. In certain embodiments, the coding sequence of Msh5 is as shown in SEQ ID NO: 1, and in certain embodiments, the coding sequence of Maps is as shown in SEQ ID NO: 5.

[0095] In certain embodiments, the therapeutic and / or preventive agent is mRNA. The mRNA can encode any polypeptide of interest, including any naturally occurring or non-naturally occurring or otherwise modified polypeptide. The polypeptide encoded by the mRNA can be of any size and can have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA can have a therapeutic effect when expressed in a cell.

[0096] Nucleic acids and polynucleotides for use in the present disclosure generally include a first region (e.g., a coding region) encoding a polypeptide of interest that is connected to nucleosides, a first flanking region (e.g., a 5-UTR) located at the 5'-end of the first region, a second flanking region (e.g., a 3-UTR) located at the 3'-end of the first region, at least one 5'-cap region, and a 3'-stabilizing region. In some embodiments, the nucleic acid or polynucleotide also includes a poly-A region or a Kozak sequence (e.g., in a 5'-UTR). In some cases, the polynucleotide may include one or more intronic nucleotide sequences that can be excised from the polynucleotide. In some embodiments, the polynucleotide or nucleic acid (e.g., mRNA) may include a 5' cap structure, a chain-terminating nucleotide, a stem-loop, a polyadenylic acid sequence, and / or a polyadenylation signal. Any one region of the nucleic acid may include one or more alternative components (e.g., alternative nucleosides).

[0097] In certain embodiments, the polynucleotide is an RNA comprising, or consisting of, in the 5'-3' direction: a 5' cap structure, a 5' UTR, a coding sequence of Msh5 and / or Maps, a 3' UTR, and Poly (A).

[0098] In certain embodiments, the polynucleotide is an RNA, which comprises, in the 5'-3' direction, a 5' cap structure, a 5'UTR, a coding sequence for Msh5, a 3'UTR, and Poly(A), or consists thereof. Preferably, the coding sequence for the 5'UTR is as shown in SEQ ID NO: 2, preferably, the coding sequence for Msh5 is as shown in SEQ ID NO: 1, preferably, the coding sequence for the 3'UTR is as shown in SEQ ID NO: 3, and preferably, the coding sequence for Poly(A) is as shown in SEQ ID NO: 4.

[0099] In certain embodiments, the polynucleotide is an RNA, which comprises, in the 5'-3' direction, a 5' cap structure, a 5'UTR, a coding sequence for Maps, a 3'UTR, and Poly(A), or consists thereof. Preferably, the coding sequence for the 5'UTR is as shown in SEQ ID NO:6, preferably, the coding sequence for Maps is as shown in SEQ ID NO:5, preferably, the coding sequence for the 3'UTR is as shown in SEQ ID NO:7, and preferably, the coding sequence for Poly(A) is as shown in SEQ ID NO:8.

[0100] The cap structure is a cap structure known to those skilled in the art, such as Cap0 (methylation of the first nucleobase, for example, m7GpppN), Cap1 (additional methylation of the ribose of the adjacent nucleotide of m7GpppN, for example, m7G(5')ppp(5')(2'OMeA)pG), Cap2 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), Cap3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), Cap4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (anti-reverse cap analog), modified ARCA (for example, phosphorothioate-modified ARCA), inosine, N1-methyl-guanosine, 2'-azaguanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine and 2-azido-guanosine.

[0101] Chemical RNA synthesis or RNA in vitro transcription (co-transcriptional capping) can be used to form a 5'cap structure (such as Cap0 or Cap1). A capping enzyme (such as bovine viral capping enzyme and / or cap-dependent 2'-O methyltransferase) can also be used to form a 5'-cap structure (such as Cap0 or Cap1) through enzymatic capping. In some embodiments, an immobilized capping enzyme is used to add the 5'cap structure (Cap0 or Cap1). In an exemplary embodiment, co-transcriptional capping is used herein.

[0102] The 5'cap structure in the RNA molecule is located upstream of the 5'UTR. In some embodiments, the 5'cap structure in the RNA molecule is located at the 5' end of the 5'UTR.

[0103] The UTR (untranslated region) in an mRNA is usually obtained directly from the DNA sequence of a gene by transcription. Herein, the 5'UTR in an mRNA can be transcribed from the 5'UTR of the DNA sequence. The 3'UTR in an mRNA can be transcribed from the 3'UTR of the DNA sequence.

[0104] The length of the poly (A) can be conventional, and the length of the poly (A) is usually at least about 50, 100, 150, 200, 300, 400, 500 nucleotides. The poly (A) can be selected from A120, A30L70, HGHpolyA, SV40polyA, BGHpolyA, rbGlobpolyA or SV40latepolyA.

[0105] Typically, suitable polynucleotides contain a replication origin that is functional in at least one organism, a promoter sequence, convenient restriction enzyme sites, and one or more selectable markers. For example, in certain embodiments, the present invention utilizes pUC plasmids, pA17-eGFP vectors, pET plasmids (pET28a(+), pET32a(+)), pGEX plasmids, and pMAL plasmids, wherein the polynucleotides contain a replication origin, a promoter, an RNA as described herein (including mRNA, such as Msh5 encoding sequence as shown in SEQ ID NO: 1, Maps encoding sequence as shown in SEQ ID NO: 5), and optionally a selectable marker.

[0106] In some cases, the length of the polynucleotide is at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 80, at least 90, at least 100, at least 120, at least 150, at least 180, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000 or at least 5000 nucleotides. In an exemplary embodiment, the length of the polynucleotide can be 1000-5000bp, 1000-1500bp, 2500-3000bp or 2500-5000bp.

[0107] Nucleic acids and polynucleotides may include one or more naturally occurring components, including any of the typical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In one embodiment, all or substantially all of the nucleotides comprise (a) a 5'-UTR, (b) a coding sequence for MSH5 and / or Maps, (c) a 3'-UTR, (d) a poly(A) tail, and any combination of a, b, c, or d above.

[0108] Polynucleotides and nucleic acids can include one or more modified (e.g., altered or substituted) nucleobases, nucleosides, nucleotides, or combinations thereof. Nucleic acids and polynucleotides for use in nanoparticle compositions can include any useful modification or alteration, such as to nucleobases, sugars, or internucleoside linkages (e.g., to link phosphate / phosphodiester bonds / phosphodiester backbones).

[0109] In some cases, the nucleic acid does not substantially induce an innate immune response in a cell into which the polynucleotide (eg, mRNA) is introduced.

[0110] Herein, the polynucleotides and nucleic acids can encode polypeptides having germ cell specificity. Germ cells generally include male germ cells and female germ cells. Female germ cells include oogonia, primary oocytes, secondary oocytes, and mature ovums. Male germ cells include spermatogonia, spermatocytes, spermatids, and mature sperm. In an exemplary embodiment, the germ cells can be male germ cells, including spermatogonia and spermatocytes derived from meiotic differentiation thereof.

[0111] In an exemplary embodiment, the therapeutic agent and / or preventive agent is Msh5 mRNA and / or Maps mRNA, the sequence of the Msh5 mRNA is shown in SEQ ID NO: 1, and the sequence of the Maps mRNA is shown in SEQ ID NO: 5.

[0112] The present invention also provides a method for preparing a nanoparticle composition as described in any embodiment herein, the method comprising: (1) providing a cationic lipid and a phospholipid as shown in Formula III to prepare a lipid component; (2) providing a therapeutic agent and / or prophylactic agent as described in any embodiment herein; (3) mixing the lipid component and the therapeutic agent and / or prophylactic agent; and optionally (3) purifying and / or concentrating; obtaining the nanoparticle composition.

[0113] Purification methods commonly used in the art include, for example, buffer exchange, ultrafiltration concentration, and the like. The lipid component and therapeutic and / or preventive agent's buffer solution can be exchanged with TBS buffer by dialysis to remove impurities, small molecules, and other components that may be present in the original buffer solution, thereby achieving a certain degree of purification. For example, impurities such as unreacted reagents may be present in the original buffer solution, which can be removed by dialysis. The dialyzed solution can be added to an ultrafiltration tube for centrifugation to concentrate the lipid component and therapeutic and / or preventive agent, while further removing small molecule impurities. Sucrose solution can also be added to the mixture system of the nanoparticle composition to change properties such as the density of the solution.

[0114] The lipid component of the nanoparticle composition may include lipids such as those according to the compound shown in Formula III, phospholipids (e.g., unsaturated lipids, such as DOPE or DSPC), optional PEG lipids, and optional cholesterol. Each lipid component can be provided in a specific fraction. In certain embodiments, the lipid component of the nanoparticle composition includes about 30 mol % to about 60 mol % of the compound shown in Formula III, about 0 mol % to about 30 mol % phospholipids, about 0 mol % to about 50 mol % cholesterol, and about 0 mol % to about 10 mol % PEG lipids. The ratio of each component in the nanoparticle composition herein can be adjusted according to actual needs, and can be 30%-60% for cationic lipids, 10%-50% for cholesterol, 10-30% for auxiliary phospholipids, and 0-5% for PEGylated phospholipids.

[0115] Alternatively, the lipid component can be measured in molar parts, for example, the lipid component of the nanoparticle composition includes about 30 molar parts to about 60 molar parts of the compound of Formula III, about 0 molar parts to 30 molar parts of phospholipids, about 0 molar parts to about 50 molar parts of cholesterol, and about 0 molar parts to about 10 molar parts of PEG lipids.

[0116] The amount of the therapeutic and / or prophylactic agent in the nanoparticle composition can depend on the size, composition, desired target and / or application, or other properties of the nanoparticle composition and the properties of the therapeutic and / or prophylactic agent. For example, the amount of RNA that can be used in the nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of the therapeutic and / or prophylactic agent and other ingredients (e.g., lipids) in the nanoparticle composition can also vary.

[0117] The nanoparticle composition can have an average size between 10 nm and 150 nm, for example, as measured by methods well known in the art. For example, the average size can be from about 40 nm to about 150 nm, for example, about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the nanoparticle composition may be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm, from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In certain embodiments, the average size of the nanoparticle composition may be from about 100 nm to about 150 nm. In specific embodiments, the average size may be about 130 nm.

[0118] The nanoparticle composition can be relatively uniform. The polydispersity index can be used to indicate the uniformity of the nanoparticle composition, such as the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. The nanoparticle composition can have a polydispersity index of about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the nanoparticle composition can be about 0.05 to about 0.10.

[0119] The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of the therapeutic and / or prophylactic agent that is encapsulated or otherwise bound to the nanoparticle composition after preparation relative to the initial amount provided. Encapsulation efficiency can be measured, for example, by comparing the therapeutic and / or prophylactic amount in a solution containing the nanoparticle composition before and after the nanoparticle composition is broken up with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in the solution. For the nanoparticle compositions described herein, the encapsulation efficiency of the therapeutic and / or prophylactic agent can be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.

[0120] The nanoparticle compositions may optionally include one or more coatings. For example, the nanoparticle compositions may be formulated in capsules, films, or tablets having a coating. The capsules, films, or tablets of the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0121] The nanoparticle compositions of the present invention can be prepared into a variety of forms suitable for various routes of administration, such as liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable dosage forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules), dosage forms for topical (including buccal and sublingual), transdermal and / or transdermal administration (e.g., creams, ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches), dosage forms for vaginal administration (e.g., vaginal suppositories, tampons, creams, gels, pastes, foams, and sprays), dosage forms for implant administration (e.g., solids, semisolids, gels), suspensions, powders, and other dosage forms.

[0122] Pharmaceutical composition

[0123] The nanoparticle composition can be formulated in whole or in part as a pharmaceutical composition. A pharmaceutical composition can include one or more nanoparticle compositions. Therefore, the present invention also provides a pharmaceutical composition comprising the nanoparticle composition and a pharmaceutically acceptable excipient.

[0124] For example, a pharmaceutical composition can include one or more nanoparticle compositions comprising one or more different therapeutic and / or prophylactic agents. The pharmaceutical composition can also include one or more pharmaceutically acceptable excipients, such as those described herein. General guidance for formulating and manufacturing pharmaceutical compositions and medicaments can be found in Remington's The Science and Practice of Pharmacy, 21st edition. Conventional excipients and auxiliary ingredients can be used in any pharmaceutical composition, except where any conventional excipient or auxiliary ingredient may be incompatible with one or more components of the nanoparticle composition. The amount of excipient in the pharmaceutical composition can be determined by one skilled in the art as needed.

[0125] The relative amounts of the one or more nanoparticle compositions, one or more pharmaceutically acceptable excipients, and / or any additional ingredients in a pharmaceutical composition according to the present disclosure will vary depending on the characteristics, size, and / or condition of the subject being treated of the nanoparticles, and further depend on the route of administration of the composition. For example, a pharmaceutical composition may comprise 0.1% to 100% (wt / wt) of the one or more nanoparticle compositions.

[0126] In some embodiments, nanoparticle compositions and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or transport (such as stored at 4°C or lower, such as a temperature between about -150°C) and about 0°C or between about -80°C and about -20°C (such as about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C).

[0127] For example, the nanoparticle compositions and / or pharmaceutical compositions disclosed herein can be stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, for example, at 4°C or lower (e.g., between about 4°C and -20°C). In one embodiment, the formulation is stable for at least 4 weeks at 4°C. In certain embodiments, the pharmaceutical compositions disclosed herein comprise a nanoparticle composition disclosed herein and a pharmaceutically acceptable excipient selected from one or more of Tris, acetate (e.g., sodium acetate), citrate (e.g., sodium citrate), saline, PBS, and sucrose. In certain embodiments, the pharmaceutical compositions of the present disclosure have a pH of between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0, or between 7.5 and 8 or between 7 and 7.8).

[0128] In the context of the present disclosure, "stability" and "stable" refer to the resistance of the nanoparticle compositions and / or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size changes, aggregation, altered packaging, etc.) under given conditions of manufacture, preparation, transport, storage, and / or use, for example, when stresses such as shear forces, freeze / thaw stress, etc. are applied.

[0129] Nanoparticle compositions and / or pharmaceutical compositions comprising one or more nanoparticle compositions can be administered to any patient or subject, including those that could benefit from the therapeutic effect provided by the delivery of a therapeutic and / or prophylactic agent to one or more specific drug cells, tissues, organs, or systems, or groups thereof. In preferred embodiments, the nanoparticle compositions and pharmaceutical compositions of the present invention can be administered to subjects whose genetic variation results in spermatogenesis impairment.

[0130] While "composition" primarily refers to compositions suitable for administration to humans, one skilled in the art will understand that such compositions are generally suitable for administration to any other mammal.

[0131] Modifications of compositions suitable for administration to humans in order to render them suitable for administration to various animals are well known, and such modifications can be designed and / or performed by an ordinarily skilled veterinary pharmacologist using only ordinary, if any, experimentation. Contemplated subjects for administration of the compositions include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, dogs, sheep, cats, dogs, mice, and / or rats.

[0132] Pharmaceutical compositions comprising one or more nanoparticle compositions can be prepared by any method known in the art of pharmacology or later developed. Generally, such preparation methods involve combining the active ingredient with an excipient and / or one or more other auxiliary ingredients, and then, if desired or necessary, dividing, shaping, and / or packaging the product into the desired single or multiple dosage units.

[0133] Pharmaceutical compositions according to the present disclosure can be prepared, packaged, and / or sold in bulk, as a single unit dose, and / or as multiple single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition containing a predetermined amount of an active ingredient (e.g., a nanoparticle composition). The amount of the active ingredient is generally equal to the dose of the active ingredient to be administered to a subject and / or a convenient fraction of that dose, such as one-half or one-third of that dose.

[0134] Pharmaceutical compositions can be prepared into various forms suitable for various routes and methods of administration. For example, pharmaceutical compositions can be prepared into liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs), injectable dosage forms, and other dosage forms.

[0135] Injectable formulations, such as sterile injectable aqueous or oily suspensions, can be formulated using suitable dispersants, wetting agents, and / or suspending agents according to known techniques. Sterile injectable formulations can be sterile injectable solutions, suspensions, and / or emulsions in non-toxic parenterally acceptable diluents and / or solvents. Acceptable carriers and solvents that can be used include water, Ringer's solution, and isotonic sodium chloride solution. Sterile oils can be used as solvents or suspending media. For this purpose, any bland fixed oil can be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid can be used to prepare injectables. Injectable formulations can be sterilized, for example, by filtering through a bacteria-retaining filter and / or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use. In an exemplary embodiment, the pharmaceutical compositions herein are administered by injection. Injection can be administered to local reproductive organs, such as the testicles (including the seminiferous tubules), the vas deferens, or accessory glands, preferably, the accessory glands include the seminal vesicles and / or the prostate.

[0136] Suitable devices for delivering the intradermal pharmaceutical compositions described herein include any type of liquid or solid injection device, such as conventional syringes, fine-gauge syringes, short-needle syringes, liquid jet syringes, compressed gas-accelerated powder injectors, ballistic powder delivery devices, and the like.

[0137] Methods and uses

[0138] The present invention provides a method for delivering a therapeutic and / or prophylactic agent to reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs, comprising using a nanoparticle composition containing a cationic lipid represented by Formula III to deliver the therapeutic and / or prophylactic agent, particularly a method for delivering the therapeutic and / or prophylactic agent to the reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs of a mammal, wherein a polypeptide of interest is produced, and a method for treating a disease or condition in the mammal. The method for delivering a therapeutic and / or prophylactic agent to the reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs of a mammal involves administering a nanoparticle composition containing the therapeutic and / or prophylactic agent to a subject, wherein administration involves contacting the reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs with the composition, thereby delivering the therapeutic and / or prophylactic agent to the reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs. The methods herein include the steps of administering (e.g., injecting) to a subject a nanoparticle composition comprising: (1) a lipid component comprising a cationic lipid of Formula III, optionally cholesterol, an auxiliary phospholipid, and optionally a PEGylated phospholipid, and (2) a therapeutic and / or prophylactic agent, wherein the administering comprises contacting a reproductive organ, a cell of a reproductive organ, and / or a tissue of a reproductive organ with the nanoparticle composition, thereby delivering the therapeutic and / or prophylactic agent to the reproductive organ, a cell of a reproductive organ, and / or a tissue of a reproductive organ, wherein the therapeutic and / or prophylactic agent is a polynucleotide or a nucleic acid.

[0139] As used herein, "local" refers to cells, tissues, or organs within a certain range of the site of application. In the prior art, special dosage forms are typically required to retain the drug at the site of application, such as creams, ointments, sprays, and powder aerosols, and are often used on body surfaces or mucosal surfaces. The inventors have discovered that drugs prepared using the compounds of Formula III described herein (e.g., the nanoparticle compositions or pharmaceutical compositions described herein) can achieve localized effects upon topical administration within reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs. In some embodiments, the nanoparticle compositions of the present invention are suitable for preparing locally applied, locally acting drugs (LALAPs). As used herein, "locally acting drugs," "locally acting pharmaceutical compositions," "locally administered locally acting drugs," or "locally administered locally acting" refer to drugs that are applied locally and act at the site of application. If such drugs exhibit systemic effects (e.g., germ cell specificity, reproductive organ targeting), these effects are considered unintended. "Local" can include only cells (e.g., germ cells), only organs (e.g., reproductive organs), or only tissues (e.g., epithelial tissue, connective tissue, muscle tissue, glandular tissue, and reproductive stem cell tissue). In some embodiments herein, local refers to only the cells, tissues or organs of the administration site. In some embodiments, when topically administered to an organ (e.g., a reproductive organ), the drug is only delivered to the organ at the administration site; when topically administered to a tissue (e.g., an epithelial tissue, connective tissue, muscle tissue, glandular tissue, and reproductive stem cell tissue), the drug is only delivered to the tissue (e.g., epithelial tissue, connective tissue, muscle tissue, glandular tissue, and reproductive stem cell tissue) at the administration site; when topically administered to a cell, the drug is only delivered to cells within the organ or tissue (e.g., the organ where the cell is located) at the administration site.

[0140] In some embodiments, local can mean that the nanoparticle composition described herein is primarily maintained within an organ (e.g., a reproductive organ) for at least 14-21 days after administration of the nanoparticle composition described herein. In some embodiments, local can mean that the nanoparticle composition is primarily maintained within a tissue (e.g., one or more of epithelial tissue, connective tissue, muscle tissue, glandular tissue, and germinal stem cell tissue) for at least 14-21 days after administration of the nanoparticle composition described herein; in particular, it is not delivered to other tissues or organs after administration.

[0141] The present invention also provides a non-therapeutic method for producing a polypeptide in a reproductive cell, the method comprising the step of contacting the cell with a nanoparticle composition comprising: (1) a lipid component comprising a cationic lipid represented by Formula III, optionally cholesterol, an auxiliary phospholipid, and optionally a PEGylated lipid (e.g., a PEGylated phospholipid), and (2) a polynucleotide encoding the polypeptide, whereby the polynucleotide can be translated in the reproductive cell to produce the polypeptide.

[0142] In general, the step of contacting mammalian cells with a nanoparticle composition comprising an mRNA encoding a polypeptide of interest can be performed in vivo, in vitro, in culture, or in vitro. The amount of the nanoparticle composition contacted with the cells and / or the amount of the mRNA therein can depend on the type of cells or tissues contacted, the mode of administration, the physiochemical characteristics (e.g., size, charge, and chemical composition) of the nanoparticle composition and the mRNA, and other factors. Efficiency indicators may include polypeptide translation (represented by polypeptide expression), mRNA degradation levels, and immune response indicators.

[0143] The step of contacting the nanoparticle composition comprising the mRNA with the cell can involve or cause transfection. The phospholipids contained in the lipid component of the nanoparticle composition can promote transfection and / or increase transfection efficiency, for example, by interacting and / or fusing with the cell membrane or intracellular membrane. Transfection can allow the mRNA to be translated within the cell.

[0144] In some embodiments, the nanoparticle compositions described herein can be used for treatment. For example, the mRNA contained in the nanoparticle composition can encode a therapeutic polypeptide (e.g., in a translatable region) and produce a therapeutic polypeptide after contacting and / or entering (e.g., transfecting) a cell. In other embodiments, the mRNA contained in the nanoparticle composition can encode a polypeptide that improves or increases the immunity of a subject.

[0145] In certain embodiments, the mRNA contained in the nanoparticle composition can encode a recombinant polypeptide that can replace one or more polypeptides that are substantially absent in the cell in contact with the nanoparticle composition. Alternatively, the recombinant polypeptide produced by translation of the mRNA can antagonize the activity of an endogenous protein in the cell, on the cell surface, or secreted by the cell. In another alternative, the recombinant polypeptide produced by translation of the mRNA can indirectly or directly antagonize the activity of a biological part in the cell, on the cell surface, or secreted from the cell. The biological part of the antagonism can include, but is not limited to, lipids (e.g., cholesterol), lipoproteins (e.g., low-density lipoproteins), nucleic acids, carbohydrates, and small molecule toxins.

[0146] Treatments for the disease

[0147] The present invention provides a new solution for the treatment of spermatogenic disorders, which targets patients with spermatogenic disorders (azoospermia) caused by MSH5 / MAPS gene mutations by targeted delivery of lipid nanoparticle-mRNA complexes, in order to promote the recovery of male spermatogenic function.

[0148] The nanoparticle compositions herein can be used to treat or prevent spermatogenesis disorders or azoospermia caused by genetic variations. In particular, the compositions can be used to treat diseases or conditions caused by MSH5 / MAPS deficiency or abnormality. For example, a nanoparticle composition containing mRNA encoding a missing or abnormal polypeptide can be administered or delivered to cells. Subsequent translation of the mRNA can produce the polypeptide, thereby reducing or eliminating problems caused by the missing or abnormal activity of the polypeptide.

[0149] The present disclosure provides methods involving the administration of nanoparticle compositions comprising one or more therapeutic and / or prophylactic agents, as well as pharmaceutical compositions comprising the same. The terms therapeutic and prophylactic are used interchangeably herein. The therapeutic composition or its imaging, diagnostic or prophylactic composition can be administered to a subject in any reasonable amount and by any route of administration to effectively prevent, treat, diagnose or image a disease, disorder and / or condition. The specific amount administered to the subject can vary depending on the species, age and general condition of the subject, the specific ingredients, and the mode of administration. The compositions according to the present disclosure can be formulated in dosage unit form for ease of administration and uniformity of dosage. However, it should be understood that the specific dosage of the compositions of the present disclosure will be determined by the attending physician within the scope of reasonable medical judgment.

[0150] Nanoparticle compositions comprising one or more therapeutic and / or prophylactic agents can be administered by any route. In some embodiments, compositions, including prophylactic compositions, diagnostic compositions, or imaging compositions, comprising one or more nanoparticle compositions described herein, are administered by one or more of a variety of routes. Topical administration is preferred, including administration into tissues or organs, such as into the testis (particularly into the lumen of the seminiferous tubules of the testis). The appropriate route of administration will depend on a variety of factors, including the nature of the nanoparticle composition, the therapeutic and / or prophylactic agent, the patient's condition, and the like.

[0151] In certain embodiments, the compositions according to the present disclosure may be administered at a level sufficient to deliver a dose of 40 mg / kg (per testicle weight) of about 0.0001 mg / kg to about 40 mg / kg, about 0.001 mg / kg to about 40 mg / kg, about 0.005 mg / kg to about 40 mg / kg, about 0.01 mg / kg to about 40 mg / kg, about 0.05 mg / kg to about 40 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 1 mg / kg to about 40 mg / kg, about 2 mg / kg to about 40 mg / kg, about 5 mg / kg to about 40 mg / kg, about 10 mg / kg to about 40 mg / kg, about 15 mg / kg to about 40 mg / kg, about 20 mg / kg to about 40 mg / kg, about 25 mg / kg to about 40 mg / kg, about 30 mg / kg to about 40 mg / kg, about 35 mg / kg to about 40 mg / kg of therapeutic and / or prophylactic agent (e.g., mRNA).

[0152] Dosage can be applied once or repeatedly with the same or different amounts every day, to obtain the desired level of mRNA expression and / or treatment, diagnosis, prevention or imaging effect.Desired dosage can be delivered, for example, three times a day, twice a day, once a day, every other day, every three days, every week, every two weeks, every three weeks or every four weeks.In certain embodiments, multiple administrations (for example, twice, three times, four times, five times, six times, seven times, eight times, nine times, ten times, eleven times, twelve times, thirteen times, fourteen times or more administrations) can be used to deliver the desired dosage.

[0153] Nanoparticle compositions comprising one or more therapeutic and / or prophylactic agents can be used in combination with one or more other therapeutic, prophylactic, diagnostic, or imaging agents. Each agent will be administered at a dose and / or schedule determined for that agent. The therapeutic, prophylactic, diagnostic, or imaging agents used in combination can be administered together in a single composition or separately in different compositions.

[0154] Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the disclosure described herein.The scope of the present disclosure is not intended to be limited to the above description, but is instead set forth in the appended claims.

[0155] In the claims, articles such as "a," "an," and "the" may mean one or more than one unless indicated otherwise or clear from the context.

[0156] The term "comprising" is intended to be open ended and permits, but does not require, the inclusion of additional elements or steps. When the term "comprising" is used herein, the terms "consisting essentially of" and "consisting of" are also encompassed and disclosed. Furthermore, it should be understood that the order of steps or the order in which certain actions are performed is not important, as long as the invention remains operable. Two or more steps or actions may be performed simultaneously.

[0157] The compounds of the present disclosure can be prepared in a variety of ways using commercially available starting materials, compounds known in the literature, or from readily prepared intermediates by employing standard synthetic methods and procedures known or to those skilled in the art. The synthesis of the compounds of the present disclosure will be readily apparent to those skilled in the art based on the teachings herein. Standard synthetic methods and procedures for preparing organic molecules and for functional group transformations and manipulations can be obtained from the relevant scientific literature or standard textbooks in the field, such as Smith, MB, March, J., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5 th ed., John Wiley & Sons: New York, 2001. The synthetic methods described in the examples herein are intended to illustrate, but not limit, the general procedures for preparing the compounds of the present disclosure. One of ordinary skill in the art will note that during the reaction sequence and synthetic schemes described herein, the order of certain steps may be altered, such as the introduction and removal of protecting groups. In the reaction schemes described herein, a variety of stereoisomers may be produced. One of ordinary skill in the art will recognize that the reaction can be optimized to preferentially produce one isomer, or that new schemes can be designed to produce a single isomer. If a mixture is produced, the isomers can be separated using techniques such as preparative thin layer chromatography, preparative HPLC, preparative chiral HPLC, or preparative SFC.

[0158] The present invention has the following beneficial effects:

[0159] The present invention screened out spermatocyte-targeted Pool1-LNP03 through high-throughput in vitro and in vivo screening, and confirmed that it can achieve EGFP expression in mouse testicular spermatocytes.

[0160] The present invention will be further described below by way of specific examples. It should be understood that these examples are merely illustrative and are not intended to limit the scope of the present invention. The methods and reagents used in the examples are, unless otherwise stated, conventional methods and reagents in the art.

[0161] Rete testis injection under microscope

[0162] Use a needle puller to pull a microinjection capillary glass needle. Use tweezers to gently pinch off the front end of the glass needle. The inner diameter of the tip is about 50-80μm. Avoid making the needle tip too long. Use a capillary pipette to suck up the mRNA-LNP and TrypanBlue mixture and load it into the capillary glass needle. Mice are injected intraperitoneally with 100μL / 10g body weight of Avertin. Gently pinching the mouse's toes without any reaction confirms that the mouse is anesthetized to an appropriate depth. Disinfect the mouse abdomen with 75% alcohol. Make a 1cm longitudinal incision above the penis with ophthalmic scissors. Continue to cut the muscle layer. The incision is about 1cm. Carefully lift one side of the fat pad to expose the testicle and epididymis below, and place it on top of a waterproof gasket. Under a stereoscope, use microtip forceps to separate the fascia of the testicle and epididymal head. Free the testicular efferent ductules along the epididymal head in the reverse direction. They are often located near the testicular hilum. Sometimes the efferent ductules are buried under the fat. Use microtip forceps and microplatform forceps to remove the fat tissue attached to the efferent ductules. tissue; connect the tail end of a capillary glass needle containing a mixture of mRNA-LNP and TrypanBlue to a rubber hose connected to an external 2.5mL syringe; adjust the magnification and, under a stereoscope, puncture the efferent ductules with the capillary glass needle, continuing to advance the needle until the needle tip reaches the rete testis; an assistant slowly pushes the syringe to confirm under the microscope that the mixture has entered the seminiferous tubules of the testis; the injection volume for each testis is 10-15μL; withdraw the capillary glass needle and reposition the testis along with the fat pad on that side; use the same injection method for the contralateral testis; use absorbable sutures to suture the muscularis and skin in sequence, disinfect with 75% alcohol, and place in a 37°C incubator until the mouse wakes up.

[0163] Mouse testis collection and stereoscopic fluorescence observation

[0164] The mice were killed by cervical dislocation, and the abdomen was disinfected with alcohol. The abdominal skin was lifted with tweezers and cut open with scissors to avoid damaging the internal tissue of the abdominal cavity. The abdominal fat pad was lifted, and the vas deferens, epididymal tail, epididymal body, epididymal head and testicle were carefully separated. The vas deferens was cut and the epididymis and testicle were separated. After washing twice in PBS, the moisture was gently absorbed with absorbent paper. The Mingmei tissue fluorescence microscope was turned on, the laser intensity was adjusted to 25%, the exposure time was 3 seconds, the field of view and focus were adjusted, and the testicles of the control group and the experimental group were photographed respectively.

[0165] Immunofluorescence

[0166] Testicular tissue was routinely paraffin-embedded and sectioned at 5 μm. Deparaffinization was performed using a gradient of xylene, absolute ethanol, 90% ethanol, and 70% ethanol. The sections were retrieval using sodium citrate antigen retrieval solution at 115°C for 15 minutes, blocked with 5% BSA at room temperature for 1 hour, and incubated overnight at 4°C with primary antibodies against the spermatocyte marker SYCP3 and the spermatid marker AKAP3. Following overnight incubation, the sections were washed three times with PBS-T buffer. Fluorescent secondary antibodies corresponding to the primary antibody species, as well as the sperm acrosome marker PNA and the nuclear marker Hoechst 33342, were added and incubated in the dark for 1 hour at room temperature. The sections were washed three times with PBS-T buffer, mounted, and photographed using a confocal fluorescence microscope after drying.

[0167] Eosin-hematoxylin staining

[0168] Testicular tissue was routinely paraffin-embedded, and 5 μm paraffin sections were dewaxed in a gradient of xylene, anhydrous ethanol, 90% ethanol, and 70% ethanol. The sections dewaxed in the previous step were immersed in hematoxylin staining solution for 2 minutes; the sections were placed in differentiation solution for 10 seconds and rinsed with running water for 5 minutes; the sections were immersed in eosin staining solution for 30 seconds, and the excess staining solution was discarded; the sections were immersed in 75% ethanol, 85% ethanol, 95% ethanol, and anhydrous ethanol I for 3 seconds respectively, and then immersed in anhydrous ethanol II, xylene I, and xylene II for 1 minute respectively. After drying, the sections were sealed with neutral gum.

[0169] Example 1: Preparation

[0170] The LNP is prepared using its own patented cationic lipids (the structure of cationic lipids can be found in patent PCT / CN2023 / 085894), and its specific composition is cationic lipids, cholesterol, auxiliary phospholipids and PEGylated phospholipids, among which cationic lipids account for 50%, cholesterol accounts for 38.5%, auxiliary phospholipids account for 10%, and PEGylated phospholipids account for 1.5%.

[0171] 1. Preparation of LNP-03: 8-((4-(dimethylamino)butyryl)oxy)pentadecan-1,5-diyl(2E,2'E)-bis(3-hexylnon-2-enoic acid)

[0172]

[0173] 8-((4-(dimethylamino)butanoyl)oxy)pentadecan-1,5-diyl(2E,2'E)-bis(3-hexylnon-2-enoic acid)

[0174] To a solution of 3-hexylnon-2-enoic acid (169 mg, 0.70 mmol, 3.0 eq) in DCM (10 mL) at 0°C under nitrogen was added oxalyl chloride (81 mg, 0.64 mmol, 3.3 eq) and DMF (0.1 mL). The mixture was stirred at room temperature for 10 min. A plate-drying plate indicated the reaction was complete. The reaction solution was spun dry, and DCM (10 mL) was added. Then, under nitrogen, 1,15-dihydroxypentadecan-8-yl-4-(dimethylamino)butanoate (80 mg, 0.21 mmol, 1.0 eq) and pyridine (169 mg, 2.14 mmol, 10 eq) were added. The mixture was stirred at room temperature for 10 min. A plate-drying plate indicated the reaction was complete. 10 mL of 2N HCl was added to the mixture, and the mixture was extracted with DCM (10 mL x 3). The organic layer was washed with aqueous NaCl (10 mL*3), dried over Na2SO4, filtered, concentrated, and purified by preparative TLC to afford CPL-530 (40 mg, 22% yield) as a colorless oil. LCMS: LC / MS (ESI) m / z: 818.6 (m+H)+.

[0175] 1H NMR(400MHz, CDCl3)δ5.53(s,2H),4.78(t,1H),4.07-3.97(t,4H),2.67-2.65(m,2H),2.28-2.49(m, 9H),2.34-2.31(t,2H),2.07-2.03(t,2H),1.95-1.91(m,5H),1.57-1.21(m,59H),0.82-0.79(m,12H)

[0176] The structure of LNP01 cationic lipid is shown in Formula I below:

[0177]

[0178] The LNP02 cationic lipid structure is shown in Formula II below:

[0179]

[0180] The LNP04 cationic lipid structure is shown in Formula IV below:

[0181]

[0182] The LNP05 cationic lipid structure is shown in Formula V below:

[0183]

[0184] The LNP06 cationic lipid structure is shown in Formula VI below:

[0185]

[0186] The LNP07 cationic lipid structure is shown in Formula VII below:

[0187]

[0188] The LNP08 cationic lipid structure is shown in Formula VIII below:

[0189]

[0190] The LNP09 cationic lipid structure is shown in Formula IX below:

[0191]

[0192] The cationic lipid structure of LNP10 is shown in Formula X below:

[0193]

[0194] 2. Preparation of Msh5 or Maps mRNA by in vitro transcription

[0195] The Msh5-pUC19-T7 and Maps-pUC19-T7 plasmids were linearized using the BspQI restriction endonuclease at 50°C. The linearized plasmid template was recovered by the sodium acetate method, the linearized plasmid concentration was determined by Nanodrop, and complete plasmid linearization was verified by nucleic acid electrophoresis. Msh5 or Maps mRNA was prepared by co-transcriptional capping using T7 RNA polymerase, buffer, N1-me-pUTP, ATP, GTP, CTP, the linearized Msh5-pUC19-T7 or Maps-pUC19-T7 plasmid template, inorganic pyrophosphatase, RNase inhibitor, CAP-GAG capping agent, and nuclease-free water. The mRNA was incubated at 37°C for 2 hours. The mRNA was recovered and purified by the lithium chloride method. The mRNA concentration was determined to be 1 μg / μL by Nanodrop, and mRNA integrity was verified by nucleic acid electrophoresis.

[0196] The specific sequence of Msh5 mRNA is shown in SEQ ID NO: 1, and the sequence of Maps mRNA is shown in SEQ ID NO: 5.

[0197] 3. Preparation of mRNA-LNPs using microfluidics technology

[0198] (1) Lipid stock solution: First, mix 74.3 μL of 20 mg / mL DMG-PEG2000 stock solution, 253.3 μL of 50 mg / mL Lipids-003 stock solution (i.e., compound LNP 03 shown in Formula III), 293.8 μL of 20 mg / mL cholesterol stock solution, 156.0 μL of 20 mg / mL DSPC stock solution, and 889.4 μL of ethanol in a 5 mL centrifuge tube; vortex to mix thoroughly.

[0199] (2) mRNA stock solution: 1 mg of mRNA solution was mixed with 0.5 mL of 100 mM citrate buffer and the volume was adjusted to 5 mL with water. A Harvard Apparatus DDS 33 syringe pump was set up. The inner diameters of the 5 mL and 10 mL Luer lock syringes were entered into the DDS 33 syringe pump. The ethanol flow rate was set to 10 mL / min and the citrate flow rate to 30 mL / min. The pump pressure of both channels was set to 55%. The pump mode was set to independent mode.

[0200] (3) Mixing: The prepared lipid stock solution was loaded into a 5 mL Luer lock syringe and the solution was carefully pushed to the needle; the prepared mRNA citrate solution was loaded into a 10 mL Luer lock syringe and the solution was carefully pushed to the needle; the two syringes were installed on the right channel of the syringe pump and connected to a homemade three-way mixer; the push rod was locked and all the locks of the syringe pump were tightened; two 15 mL conical tubes were marked for collecting the product and the waste liquid respectively; the collection end was placed in the waste liquid tube and the syringe pump was started; after two seconds, the collection end was quickly transferred to the collection tube; two seconds before the end of the run, the collection end was returned to the waste liquid tube; the collection tube was placed in an ice bath for subsequent analysis and buffer replacement; the particle size of the LNP was measured by dynamic light scattering (DLS) and was 130 nm.

[0201] (4) Purification and concentration: Replace the mRNA-LNP mixture buffer: Mix 4 mL of ethanol and 36 mL of water in a 50 mL conical tube and pre-soak the dialysis bag for 10 minutes; remove the pre-wetted dialysis bag and add the mRNA-LNP mixture; place it in 2 L of TBS dialysis buffer; dialyze at 4 ° C for 4 hours, replace 2 L of TBS buffer, and then dialyze at 4 ° C overnight; the dialyzed mRNA-LNP solution is added to the pre-wetted ultrafiltration tube and centrifuged at 4 ° C, 3600 rpm for 2 hours; calculate the volume of the LNP mixture and add 1 / 3 of its volume of 40% (w / v) sucrose solution; use DLS to measure the LNP particle size and polydispersity index (PDI); use Ribogreen detection method to measure the encapsulation efficiency and mRNA concentration.

[0202] Example 2: Targeting

[0203] This example constructs 30 types of LNPs based on 30 cationic lipids ( Figure 1 ), characterized by particle size less than 150nm and polydispersity index (PDI) less than 0.2 ( Figure 2 ). 30 LNPs were randomly divided into 3 LNP libraries (Pool 1-3). After in vitro transfection into human embryonic kidney cell line (HEK293T), mouse testicular support cell line (TM4) and mouse testicular interstitial cell line (TM3), EGFP expression was observed ( Figure 3 Because the reproductive field has always lacked a stable and effective cell line that reflects the physiological function of spermatogenic cells in vivo, and the in vitro delivery efficiency of LNP cannot accurately reflect the in vivo delivery efficiency, we chose to use the reverse injection technique of the efferent tubules under a microscope to inject Pool 1-3 into the seminiferous tubules of wild-type male mice. 24 hours after injection, tissue fluorescence showed that EGFP expression was visible in the seminiferous tubules of the testis ( Figure 4 Because non-germ cells, Sertoli cells, exist within the seminiferous tubules, paraffin sections of testicular tissue were performed to further confirm the localization of EGFP expression. By co-staining with DDX4, a marker primarily expressed in the spermatocyte cytoplasm, spermatocyte-targeted LNP Pool 1 was screened and confirmed to be able to deliver EGFP to mouse testicular spermatocytes and achieve expression ( Figure 5 ).

[0204] To further clarify the LNPs in Pool 1 that target spermatocytes, the 10 LNPs in Pool 1 were injected into the seminiferous tubules of wild-type male testes using the efferent ductus retrograde injection technique under a microscope. Twenty-four hours later, tissue fluorescence showed that EGFP expression was visible in the seminiferous tubules after injection of the 10 LNPs ( Figure 6 To further confirm the localization of EGFP expression, paraffin sections of testicular tissue were performed and co-stained with DDX4, a marker mainly expressed in the cytoplasm of spermatocytes, to screen out LNP03 ( Figure 8 ), confirming that it can deliver EGFP to mouse testicular spermatocytes and achieve expression. In vitro transfection of the human embryonic kidney cell line HEK293T also confirmed that it can express EGFP ( Figure 7 The remaining nine LNPs were not co-localized with germ cells, suggesting that they were unable to deliver EGFP to spermatocytes ( Figure 9 ).

[0205] Example 3: Complex construction and characterization

[0206] Based on the coding region sequences of mouse Msh5 mRNA and Maps mRNA, in vitro transcription expression plasmids were constructed. Using pseudouracil as raw materials, wild-type mouse Msh5 mRNA and Maps mRNA were synthesized and purified based on co-transcriptional capping technology. Based on microfluidics technology, after adding equal amounts of EGFP mRNA, Msh5 mRNA+EGFP mRNA-LNP03 complexes and Maps mRNA+EGFP mRNA-LNP03 complexes were encapsulated respectively ( Figure 10 ).

[0207] Example 4: Mouse model validation

[0208] Based on the previously built Msh5 D486Y / D486Y The present invention uses the technique of reverse injection of the efferent duct under a microscope to inject the Msh5 mRNA+EGFP mRNA-LNP03 complex into 8-week-old Msh5 mice. D486Y / D486Y The testicular lumen of male rats (4 μg per testis) was injected into the seminiferous tubules. Testicular tissues were collected on days 7, 14, 21, 28, and 35. Tissue fluorescence confirmed that EGFP expression was still visible in the seminiferous tubules 14 days after injection ( Figure 11 Hematoxylin-eosin staining of paraffin sections of testicular tissue confirmed that Msh5 D486Y / D486Y A large number of sperm were observed in the lumen of the seminiferous tubules of male mice with point mutations, and spermatogenesis was restored. However, sperm disappeared from the lumen of the seminiferous tubules 28 and 35 days after injection, which is consistent with the characteristics of transient expression of mRNA ( Figure 12 a). Immunofluorescence staining of testicular tissue paraffin sections using spermatocyte nuclear marker SYCP3, sperm acrosome marker PNA, and elongated sperm tail marker AKAP3 confirmed that sperm were visible in the lumen of seminiferous tubules 21 days after injection of Msh5 mRNA+EGFP mRNA-LNP03 complex, while sperm disappeared in the lumen of seminiferous tubules 28 and 35 days after injection ( Figure 12 b, c). The above results confirmed that Msh5 mRNA-LNP03 can rescue Msh5 D486Y / D486YSpermatogenesis in male mice with point mutations. Based on the Maps knockout mice constructed in the early stage, the present invention uses the reverse injection technique of the efferent tubules under a microscope to inject the Maps mRNA+EGFP mRNA-LNP03 complex into the lumen of the seminiferous tubules of the testes of 8-week-old Maps knockout male mice (4 μg per testis), and collects the mouse testicular tissues on days 14 and 21, respectively. The paraffin sections of the testicular tissue were immunofluorescently stained, and the spermatocyte nuclear marker SYCP3, the sperm acrosome marker PNA, and the extended sperm tail marker AKAP3 were used for staining to confirm that a large number of sperm were visible in the lumen of the seminiferous tubules 21 days after the injection of the Maps mRNA+EGFP mRNA-LNP03 complex, and spermatogenesis was restored ( Figure 13 The above results confirmed that Maps mRNA-LNP03 can rescue spermatogenesis in Maps knockout male mice.

[0209] Part of this article

[0210] >SEQ ID NO:1

[0211] CDS:

[0212]

[0213] >SEQ ID NO:2

[0214] 5′UTR:

[0215] agaauaaacuaguauucucucuccuccacacacagagagagaacccgccacc

[0216] >SEQ ID NO:3

[0217] 3'UTR:

[0218] cucgagcugguacuccaugcacgcaugcuagcugcccuucccguccuggguaccgaccgacucccccgaccucggucgguaugcucccaccuccaccuccaccuccacuccucucucucuaguaguuccagacaccuccaagc acgcagcaaugcagcucaaacgcuuaagccuagccacacccacgggaaaaacgaaguuaacuaaacuacuaaccccaggguuggucauuucgugccagccacccuggagcuagc

[0219] >SEQ ID NO:4

[0220] PolyA:

[0221] Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaning being

[0222] >SEQ ID NO:5

[0223] CDS:

[0224] augucugaaaaacuacgaagaugcagaaaggagcugacugcugcuauagaccgagccuuugaaggagucaggcauucucaggagugcacagcccagcagaggcuggacgccccgucgcucaccucccagccgguacacaggcuccucugcagaaacccacuggcugccugccccucugcugccccauacucuggugccucgugugcuccugagagugagaacccggccuucgggacacaccauauuccgguuaauucaaaacuucagcagccucuauaccccaaaaggaaaccucugaccagcaaggaaaaugucuugaugcagucuuccauuuuggcacgugacagacaguuuuggagagcugcaggugauggggaagacuggagaaaagauaguuuaaggaaggauauggagagagauuuaaaagcugacccaaauguacugcucagcaguucuagccaagaggucacaaaggaucugcuagacaugauugaccauacaaguauccgaacuauugaagaauuggcuggaaaacuagaauuugaaaaugaauugaaccguguguguggacacugccaagauucacccuucaaggaggaagccugggcccugcuuguggaugagaguccucagaaggcucuggaugcugacccugguagccucaagcaggcuuuggaugaucagaauauaguugagacuguucuggacuuggaagaagacuacaacuugaugacuucuuuuaaauaccaaauagagugauga

[0225] >SEQ ID NO:6

[0226] 5’UTR:

[0227] agaauaaacuaguauucuucugguccccacagacucagagagaacccgccacc

[0228] >SEQ ID NO:7

[0229] 3’UTR:

[0230] cucgagcugguacuccaugcacgcaugcuagcugcccuucccguccuggguaccgaccgacucccccgaccucggucgguaugcucccaccuccaccuccaccuccacuccucucucucuaguaguuccagacaccuccaagc acgcagcaaugcagcucaaacgcuuaagccuagccacacccacgggaaaaacgaaguuaacuaaacuacuaaccccaggguuggucauuucgugccagccacccuggagcuagc

[0231] >SEQ ID NO:8

[0232] PolyA:

[0233] Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaning being

Claims

1. Use of a cationic lipid of formula III in preparing a nanoparticle composition targeting reproductive organs, cells of reproductive organs and / or tissues of reproductive organs, 2. The use according to claim 1, characterized in that The use has one or more of the following characteristics: The reproductive organ is a testicle, a vas deferens or an accessory gland. Preferably, the accessory gland includes a seminal vesicle and / or a prostate. The cell is a germ cell, preferably, the germ cell is a spermatogonia or spermatocyte, The nanoparticle composition further comprises phospholipids, optionally cholesterol and / or PEGylated lipids, preferably, the PEGylated lipids are PEGylated phospholipids, The tissue is one or more of epithelial tissue, connective tissue, muscle tissue, glandular tissue and germinal stem cell tissue. Preferably, the tissue includes spermatogenic epithelial tissue, interstitial tissue, epididymal epithelial tissue, vas deferens smooth muscle tissue, seminal vesicle glandular epithelium, and bulbourethral gland mucosal glandular tissue; preferably, the tissue includes seminiferous tubule epithelium, epididymal epithelium, glandular epithelium, testicular interstitial tissue, vas deferens connective tissue, vas deferens smooth muscle, urethral sphincter, seminal vesicle, prostate, bulbourethral gland, spermatogonia, and The nanoparticle composition is used to deliver therapeutic and / or prophylactic agents to reproductive organs, cells of reproductive organs, and / or tissues of reproductive organs.

3. The use according to claim 1 or 2, characterized in that The use has one or more of the following characteristics: The method for preparing the nanoparticle composition comprises the steps of mixing a lipid component and a therapeutic agent and / or a preventive agent to prepare the nanoparticle composition, wherein the lipid component comprises a cationic lipid and a phospholipid represented by formula III, and preferably, the lipid component further comprises cholesterol and / or a PEGylated lipid. The method comprises microfluidics, precipitation, emulsification, solvent evaporation and ultrasonic treatment to prepare the nanoparticle composition. Preferably, the method is microfluidics. Preferably, the method for preparing the nanoparticle composition is to mix the lipid component and the therapeutic agent and / or preventive agent and microfluidize them. The therapeutic and / or preventive agent comprises a polynucleotide, The polynucleotide comprises a coding sequence of a gene, The polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression, and The nucleic acid is selected from the group consisting of: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1), preferably, the nucleic acid construct is mRNA.

4. Use of a cationic lipid of formula III in the preparation of a medicament for treating a disease that would benefit from the delivery of a therapeutically active substance to a reproductive organ, cells of a reproductive organ, and / or tissue of a reproductive organ, Preferably, the disease is a germ cell disease, Preferably, the disease is spermatogenesis disorder or azoospermia, Preferably, the disease is spermatogenesis disorder caused by meiotic disorder.

5. The use according to claim 4, characterized in that The use has one or more of the following characteristics: The therapeutically active substance includes a polynucleotide, The polynucleotide comprises a coding sequence of a gene, The polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression, preferably, the nucleic acid is selected from the following group: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA or a combination thereof, and (2) a nucleic acid construct that can express or form (1), preferably, the nucleic acid construct is mRNA.

6. A nanoparticle composition comprising (1) a lipid component, and (2) a therapeutic and / or prophylactic agent, wherein: The lipid component includes a cationic lipid and a phospholipid as shown in Formula III, and the therapeutic agent and / or preventive agent is a polynucleotide, and the polynucleotide includes a coding sequence of MSH5 and / or MAPS, Preferably, the nanoparticle composition optionally further comprises cholesterol and / or PEGylated lipids, preferably, the PEGylated lipids are PEGylated phospholipids, Preferably, the polynucleotide is RNA or DNA, Preferably, the coding sequence of MSH5 is shown as SEQ ID NO: 1, preferably, the coding sequence of MAPS is shown as SEQ ID NO: 5, Preferably, the polynucleotide is RNA, which comprises in the 5'-3' direction: a 5' cap structure, a 5' UTR, a coding sequence of MSH5 and / or MAPS, a 3' UTR and Poly (A), Preferably, the backbone of the polynucleotide is pUC plasmid, pA17-eGFP plasmid, pET plasmid (pET28a(+), pET32a(+)), pGEX plasmid, pMAL plasmid, preferably, the backbone of the polynucleotide is pUC plasmid.

7. A method for preparing the nanoparticle composition according to claim 6, comprising the step of mixing the cationic lipid and phospholipid of formula III with a therapeutic agent and / or a preventive agent to prepare the nanoparticle composition, Preferably, the nanoparticle composition optionally further comprises cholesterol and / or a PEGylated lipid, preferably, the PEGylated lipid is a PEGylated phospholipid.

8. A pharmaceutical composition comprising the nanoparticle composition according to claim 6 and a pharmaceutically acceptable excipient.

9. A method for delivering a therapeutic agent and / or a prophylactic agent to a reproductive organ, cells of a reproductive organ and / or tissue of a reproductive organ, characterized in that: The method comprises delivering the therapeutic and / or prophylactic agent using a nanoparticle composition containing a cationic lipid represented by Formula III, Preferably, the nanoparticle composition optionally further comprises cholesterol and / or PEGylated lipids, preferably, the PEGylated lipids are PEGylated phospholipids, Preferably, the therapeutic and / or prophylactic agent comprises a polynucleotide, Preferably, the polynucleotide comprises the coding sequence of a gene, Preferably, the polynucleotide comprises a nucleic acid that specifically interferes with gene transcription and / or expression, Preferably, the nucleic acid is selected from the group consisting of: (1) self-replicating RNA, circular RNA, antisense nucleic acid, microRNA, siRNA, RNAi, dsRNA, sgRNA, or a combination thereof, and (2) a nucleic acid construct capable of expressing or forming (1), Preferably, the nucleic acid construct is mRNA.

10. A non-therapeutic method for producing a polypeptide in a germ cell, the method comprising contacting the cell with a nanoparticle composition comprising: (1) a lipid component comprising a cationic lipid and a phospholipid of formula III, and (2) a polynucleotide encoding the polypeptide, whereby the polynucleotide can be translated in a germ cell to produce the polypeptide, Preferably, the nanoparticle composition optionally further comprises cholesterol and / or PEGylated lipids, Preferably, the PEGylated lipid is a PEGylated phospholipid, Preferably, the polynucleotide is RNA or DNA, Preferably, the polynucleotide is a coding sequence of MSH5 and / or MAPS, Preferably, the polynucleotide is RNA, which comprises in the 5'-3' direction: a 5' cap structure, a 5' UTR, a coding sequence of MSH5 and / or MAPS, a 3' UTR and Poly (A), Preferably, the coding sequence of MSH5 is shown as SEQ ID NO:

1. Preferably, the coding sequence of MAPS is shown as SEQ ID NO: 5.

Images