A common Bacteroides and its uses
By isolating and identifying Bacteroides vulgaris J2525 and optimizing culture conditions, efficient production of 3-IPA was achieved, solving the problem of the lack of stable biological sources in existing technologies. This technology can be applied in the fields of medicine and agriculture to increase the concentration of 3-IPA in the body, and has hypoglycemic and anti-inflammatory effects.
Patent Information
- Application Number
- CN202510918931.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-03
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-07-03
AI Technical Summary
There are few studies on the function of Bacteroides vulgaris in the current technology, and its in vivo application has not been reported. 3-Indolepropionic acid (3-IPA), as a potential health-promoting factor of intestinal microbial metabolites, lacks a stable and efficient biological source.
A human intestinal strain, Bacteroides vulgaris J2525, was isolated and identified. By optimizing the anaerobic culture conditions, it was fermented in brain heart extract medium to produce a high concentration of 3-IPA, and its metabolites were detected by UPLC-MS.
It provides a stable and efficient biological source of 3-IPA, meeting the needs of the pharmaceutical and agricultural fields, significantly increasing the concentration of 3-IPA in the body, and has hypoglycemic and anti-inflammatory effects.
Smart Images

Figure CN120442502B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbiology, and more specifically, to a novel Bacteroides var. mongolica and its uses. Background Technology
[0002] Bacteroides plebeius exists in the human gut microbiota, but there is relatively little research on its function both domestically and internationally. It has only been found that it can degrade complex polysaccharides in seaweed, and there are currently no reports on in vivo experiments related to its applications.
[0003] 3-Indolepropionic acid (3-IPA), a metabolite of gut microbiota, has attracted widespread attention in recent years. Studies have shown that higher levels of 3-IPA are associated with improved insulin sensitivity, maintenance of the blood-brain barrier, improved kidney function, maintenance of intestinal barrier function, and antioxidant and anti-inflammatory effects, and are considered potential health-promoting factors. Gut microbiota are the main source of 3-IPA in the body, and variations in their types and quantities directly affect 3-IPA production and bioactivity. Therefore, screening for human gut microbial strains capable of producing 3-IPA can not only increase 3-IPA production but also provide richer and more effective microbial resources for the treatment of various diseases. Furthermore, biological methods for producing 3-IPA are more environmentally friendly, while 3-IPA directly produced by human gut microbiota has better biocompatibility and application potential. Summary of the Invention
[0004] Based on existing technology, one objective of this invention is to provide a human intestinal strain producing 3-IPA, *Bacteroides vulgaris* J2525, deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC NO. 46398. This bacterium is a Gram-negative bacterium isolated and purified from human feces, an anaerobic bacterium living in the human intestine, and possesses advantages such as rapid reproduction (this strain can achieve a rapid exponential increase in OD value from 0.15 to 1.1 within 8 hours), metabolic stability (possessing 3-IPA production function both in vivo and in vitro), and high 3-IPA production (compared with other *Bacteroides* and *Escherichia coli*). 3-IPA is a metabolic product of intestinal microorganisms, possessing various health-promoting effects such as improving glucose metabolism, anti-inflammation, and anti-oxidation. Furthermore, this invention also provides the use of *Bacteroides vulgaris* of this invention in the production of 3-IPA.
[0005] In this regard, the present invention includes, but is not limited to, the following:
[0006] In one aspect, the present invention provides a Bacteroides vulgaris, characterized in that it was deposited on April 25, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 46398.
[0007] In another aspect, the present invention provides the use of the Bacteroides commonis described herein in the production of 3-indolepropionic acid.
[0008] In another aspect, the present invention provides a method for producing 3-indolepropionic acid, comprising:
[0009] (1) Anaerobic culture of the *Bacteroides vulgaris* described in this invention under suitable conditions; and
[0010] (2) Separation and purification of 3-indolepropionic acid from the supernatant of the culture medium.
[0011] In one aspect, the culture medium used in step (1) of the method of the present invention is selected from brain and heart extract culture medium. Preferably, the brain and heart extract culture medium has the following formula: 10.0 g / L peptone, 12.5 g / L dehydrated calf brain extract powder, 5.0 g / L dehydrated calf heart extract powder, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, and pH value of 7.4 ± 0.2.
[0012] In one aspect, the culture medium of the present invention also contains heme chloride.
[0013] In one aspect, the gaseous conditions for cultivation in step (1) of the method of the present invention are 90% nitrogen, 5% carbon dioxide and 5% hydrogen.
[0014] In one aspect, the culture temperature in step (1) of the method of the present invention is 35-37°C.
[0015] In one aspect, the culture temperature in step (1) of the method of the present invention is 35°C, 36°C or 37°C.
[0016] In one aspect, the culture temperature in step (1) of the method of the present invention is 37°C.
[0017] In another aspect, the present invention provides the application of the Bacteroides commonis described herein in increasing the content of 3-indolepropionic acid in the body.
[0018] In another aspect, the present invention provides the use of the Bacteroides commonis described herein in the preparation of drugs / formulations that increase the content of 3-indolepropionic acid in the body.
[0019] Beneficial technical effects:
[0020] This invention is the first to isolate a human intestinal Bacteroides strain capable of producing 3-IPA, and its functional characteristics were systematically verified through single-strain in vitro fermentation experiments and in vivo intervention studies in mice. This discovery has significant innovation and practicality, mainly reflected in the following aspects: First, the novel 3-IPA-producing Bacteroides strain isolated in this invention provides a stable and efficient biological source for the large-scale production of 3-IPA. Compared with traditional chemical synthesis methods, biosynthesis has the advantages of less environmental pollution and stronger sustainability. By optimizing culture conditions, the yield of 3-IPA can be significantly increased, meeting the growing demand for 3-IPA in the fields of medicine and agriculture. In addition, the Bacteroides strain of this invention can increase the concentration of 3-IPA in the body's blood, and may be developed as a probiotic with good hypoglycemic effects, thus enabling its clinical application. Attached Figure Description
[0021] Figure 1 The growth curve of Bacteroides J2525 is shown.
[0022] Figure 2 The results showed that Bacteroides vulgaris J2525 can produce 3-IPA in vitro.
[0023] Figure 3 The results showed that Bacteroides vulgaris J2525 can produce 3-IPA in vitro.
[0024] Figure 4 The results showed that gavage administration of Bacteroides J2525 significantly increased the content of 3-IPA in mouse serum. Detailed Implementation
[0025] Example 1: In vitro fermentation experiment of Bacteroides vulgaris
[0026] Experimental methods:
[0027] 1. Screening, identification, and preservation of Bacteroides J2525
[0028] 1.1 Sample Source
[0029] The strain used in this invention was isolated from the feces of healthy adult males in the Hangzhou area.
[0030] 1.2 Isolation and purification of strains
[0031] Approximately 2g of fresh fecal sample was collected in a sterile tube and immediately sent to the laboratory for bacterial isolation. 1g of sample was placed in 9mL of heme-supplemented brain heart extract (h-BHI) liquid culture medium, vortexed, and then enriched under anaerobic conditions at 37℃ for 24h. Then, 1mL of the enriched solution was extracted in a laminar flow hood and serially diluted tenfold with sterile physiological saline. 10... -6 10 -7 10 -8 Three dilution gradients were used, with 100 μL of bacterial culture from each gradient plated onto h-BHI agar medium and incubated at 37°C for 24–48 h. After incubation, plates with 50–150 single colonies were selected from the agar medium, and typical colonies were picked and purified again on h-BHI agar medium. Single colonies were then picked and amplified on h-BHI agar medium. The amplified bacterial culture was used for cryopreservation (50% glycerol) and 16S rDNA sequencing identification.
[0032] 1.3 16S rDNA Identification
[0033] Genomic DNA was extracted from bacterial culture using the TIANamp bacterial genomic DNA extraction kit. The extracted genomic DNA was used as a template for PCR amplification, and PCR experiments were performed using universal bacterial primers 27F and 1492R for 16S rDNA. After PCR amplification, the PCR product was analyzed by agarose gel electrophoresis and photographed; the amplified fragment length was approximately 1.4 kbp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The results are shown in SEQ ID NO: 1. BLAST sequence alignment on the NCBI website showed that the sequence had over 99% homology with the identified 16S rDNA sequence of *Bacteroides vulgaris*, confirming that the selected strain was *Bacteroides vulgaris*.
[0034] The strain of this invention, Bacteroides plebeius J2525, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 46398, and the deposit date is April 25, 2025.
[0035] In this invention, the preparation method of Bacteroides vulgaris J2525 bacterial suspension is as follows: Bacteroides vulgaris J2525 preserved in glycerol tubes is first streaked 2-3 times on h-BHI agar plates for activation. Then, single colonies are picked and cultured in h-BHI liquid medium at 37°C for 24-36 hours until the bacterial suspension concentration reaches 10%. 9 ~10 10The concentration is approximately CFU / mL, used as a bacterial suspension. In actual use, the concentration can be adjusted using conventional methods.
[0036] The isolation and culture of the above-mentioned strains were carried out in an anaerobic incubator at 37°C, with a gaseous environment of 90% nitrogen, 5% carbon dioxide, and 5% hydrogen. Under these conditions, *Bacteroides vulgaris* achieved a rapid exponential growth from an OD value of 0.15 to 1.1 within 8 hours (see [link to relevant documentation]). Figure 1 The detailed formulation of the above-mentioned h-BHI medium is as follows: 10.0 g peptone; 12.5 g dehydrated calf brain extract; 5.0 g dehydrated calf heart extract; 5.0 g sodium chloride; 2.0 g glucose; 2.5 g disodium hydrogen phosphate. Adjust the pH to 7.4 ± 0.2; bring the volume to 1 L, and autoclave at 121°C for 15 minutes.
[0037] Bacteroides vulgaris ( Bacteroides plebeius Strain J2525 was isolated from a human fecal sample, and its 16S rRNA was sequenced, as shown in SEQ ID NO: 1.
[0038] >BP.16S-27FSEQ ID NO: 1:
[0039] CTCGGCTTACCATGCAGTCGAGGGGCAGCGGGATTGAAGCTTGCTTCAATTGCCGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCGTACACTCAGGGATAGCCTTTCGAAAGAAAGATTAATACCTGATGGTATGATGAGATTGCATGATAGCATCATTAAAGATTTATCGGTGTACGATGGGGATGCGTTCCATTAGGTAGTAGGCGGGGTAACGGCCCACCTAGCCTACGATGGATAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGAGAGTCTGAACCAGCCAAGTAGCGTGAAGGATGAAGGTCCTACGGATTGTAAACTTCTTTTATAAGGGAATAAAACCTCCCACGTGTGGGAGCTTGTATGTACCTTATGAATAAGCATCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGTCGTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGATACTGGCGTCCTTGAGTGCGGTTGAGGTGTGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGAAGGCAGCACACTAAGCCGTAACTGACGTTCATGCTCGAAAGTGTGGGTATCAAACAGGATTAGATACCCTGGTAGTCCACACGGTAAACGATGGATACTCGCTGTTGGCGATATACAGTCAGCGGCTTAGCGAAAGCGTTAAGTATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTAAATTGCAAAGGAATGATCTGGAAACAGGTCAGTC。
[0040] 2. In vitro transformation experiment of common Bacteroides
[0041] To verify the ability of Bacteroides vulgaris to produce 3-IPA (3-IPA), we conducted an in vitro transformation experiment. The experiment was designed with three treatments (four replicates per group): (1) BHI medium as the control group (CON); (2) BHI medium supplemented with Bacteroides vulgaris; (3) BHI medium supplemented with Escherichia coli (E. coli). Escherichia coli ( ) served as a negative control. All cultures were performed anaerobically at 37°C for 72 hours. After treatment, the supernatant was collected by centrifugation and analyzed by ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS). Metabolite identification was performed by comparing the precise molecular weight and retention time of the 3-IPA standard. Quantification was performed using multiple reaction monitoring (MRM), with the MRM transition being m / z 188 → 59. Please refer to [link to mass spectrometry results] for details. Figure 2 .
[0042] 3. Detection of 3-IPA in culture medium supernatant
[0043] This analysis was performed using an ultra-high performance liquid chromatography-mass spectrometry (UPLC-MS) system, consisting of an Agilent 1290 Infinity II UPLC system coupled with an Agilent 6545 Q-TOF / MS mass spectrometer (Agilent Technologies). Chromatographic separation was achieved using an ACQUITY UPLC BEH C18 column (100 mm × 2.1 mm, 1.7 μm). The mobile phase consisted of: Phase A: aqueous solution containing 10 mM formic acid; Phase B: methanol solution. The flow rate was set to 0.30 mL / min, and the elution program was as follows: initial 20% Phase B, maintenance for 1 min; linear gradient up to 95% Phase B within 6 min; maintenance at 95% Phase B for 2 min; linear gradient down to 20% Phase B within 0.5 min; equilibration at 20% Phase B for 1.5 min. The injection volume was 2 μL. Mass spectrometry data were acquired via electrospray ionization (ESI-) in negative ion mode, with a mass scan range of 200–1200 m / z. Key mass spectrometry parameters are as follows: sheath gas temperature: 300℃; sheath gas flow rate: 11 L / min; VCap voltage: 3500 V; capillary current: 0.09 mA; nozzle voltage: 0 V; drying gas temperature: 275℃; fragmentation voltage: 150 V; deflector voltage: 65 V. Raw data were processed using Profinder 10.0 software (Agilent Technologies) for peak detection, peak alignment, and peak area integration.
[0044] 4. Experimental Results
[0045] Depend on Figure 2The mass spectrometry results show that the 3-IPA in the sample has the same precise molecular weight and retention time as the standard, indicating that the detection method is reliable. This demonstrates that the Bacteroides vulgaris J2525 of this invention can produce 3-IPA in the in vitro fermentation experiment.
[0046] Depend on Figure 3 It is evident that, in in vitro fermentation experiments, the Bacteroides vulgaris J2525 of this invention can produce 3-IPA, significantly increasing the 3-IPA concentration in the culture medium supernatant. Escherichia coli, however, does not possess the ability to produce 3-IPA. This indicates that 3-IPA production is a unique function of Bacteroides vulgaris.
[0047] Example 2: In vivo intervention experiment of Bacteroides J2525
[0048] 1. Experimental Design
[0049] Thirty-two healthy male C57BL / 6 mice of similar weight and 8 weeks of age were selected as experimental subjects and randomly divided into four groups: blank control group (n=8), Escherichia coli intervention group (n=8), Bacteroides monomorpha intervention group (n=8), and Bacteroides vulgaris J2525 intervention group (n=8). All mice were housed in a standard SPF environment with environmental conditions of 20-24°C, 40%-60% relative humidity, a 12-hour diurnal cycle, and normal diet and water.
[0050] 2. Bacterial colonization test
[0051] Escherichia coli, Bacteroides monomorpha intervention group, and Bacteroides vulgaris J2525 were all isolated from the feces of healthy individuals. The experiment was set up with 4 groups:
[0052] (1) Normal group (blank control, CON, n=8 / group): basal diet + 100μL physiological saline by gavage for 1 week;
[0053] (2) Bacteroides vulgaris J2525 intervention group (n=8 / group): basic diet + 100μL Bacteroides vulgaris by gavage for 1 week;
[0054] (3) Escherichia coli intervention group (negative control group 1, n=8 / group): basic diet + 100μL Escherichia coli by gavage for 1 week;
[0055] (4) Bacteroides monomorpha intervention group (negative control group 2, n=8 / group): basic diet + 100μL Bacteroides monomorpha by gavage for 1 week;
[0056] Eight mice were placed in each group for a one-week bacterial colonization experiment. The mice were administered 100 μL of bacteria via gavage once daily, with a total bacterial count of 10... 8CFU / day. After the experiment, mice were anesthetized with isoflurane, and blood was collected from their hearts. The collected blood was immediately and gently injected into ordinary EP tubes. After the EP tubes were allowed to stand at room temperature, they were centrifuged at 4°C, 1000g for 10 minutes. After separation, the upper pale yellow transparent liquid was collected, and the serum was carefully transferred to pre-labeled sterile cryovials using a pipette. The cryovials were stored at -80°C until analysis.
[0057] 3. Experimental Results
[0058] Referring to the 3-IPA detection method in Example 1, the concentration of 3-IPA in mouse serum was detected, and the results are as follows. Figure 4 As shown. By Figure 4 It was found that intervention with Bacteroides J2525 significantly increased the concentration of 3-IPA in mouse serum, while neither Escherichia coli nor Bacteroides monomorpha, which also belongs to the Bacteroides genus, possessed this metabolic function. The results indicate that Bacteroides J2525 can be metabolized in vivo to produce 3-IPA.
Claims
1. A common Bacteroides, characterized in that, It was deposited at the China General Microbiological Culture Collection Center (CGMCC) on April 25, 2025, with accession number CGMCC NO. 46398.
2. The use of Bacteroides vulgaris according to claim 1 in the production of 3-indolepropionic acid.
3. A method for producing 3-indolepropionic acid, characterized in that, include: (1) Anaerobic culture of the common Bacteroides according to claim 1 under suitable conditions; as well as (2) Separation and purification of 3-indolepropionic acid from the supernatant of the culture medium.
4. The method according to claim 3, characterized in that, The culture medium used in step (1) is selected from brain heart infusion culture medium.
5. The method according to claim 4, characterized in that, The culture medium for the brain and heart extract is formulated as follows: 10.0 g / L peptone, 12.5 g / L dehydrated calf brain extract powder, 5.0 g / L dehydrated calf heart extract powder, 5.0 g / L sodium chloride, 2.0 g / L glucose, 2.5 g / L disodium hydrogen phosphate, and pH 7.4 ± 0.
2.
6. The method according to claim 4, characterized in that, The culture medium also contains heme chloride.
7. The method according to claim 3, characterized in that, The gaseous conditions for cultivation in step (1) are 90% nitrogen, 5% carbon dioxide and 5% hydrogen.
8. The method according to claim 3, characterized in that, The culture temperature in step (1) is 35-37℃.
Citation Information
Patent Citations
Application of common bacteroides in treatment or prevention of rheumatoid arthritis or related diseases thereof
CN104546940A
Rational design of microbial-based biotherapeutics
US20200027524A1