Rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus and application thereof
The vesicular stomatitis virus vector replaces rabies virus glycoprotein and undergoes amino acid site mutations to construct a recombinant virus, which solves the problem that existing vaccines are difficult to achieve convenient and effective oral immunity, and has achieved efficient oral vaccine development for rabies, providing broad-spectrum protection for rabies.
Patent Information
- Application Number
- CN202510609982.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-08-08
AI Technical Summary
The existing rabies vaccines are mainly inactivated vaccines. They are vaccinated through intramuscular injection, making it difficult to achieve convenient and effective immunity to wildlife groups. There is a lack of safe and effective vaccines for oral administration, and it is impossible to effectively control the spread of rabies.
The vesicular stomatitis virus is used as a vector to replace its glycoprotein-encoded gene, rabies virus glycoprotein, and stabilize the conformation of the rabies virus glycoprotein before fusion through mutations of key amino acid sites, and construct a recombinant virus for oral immunity, ensuring high viral titer and immunogenicity.
It achieves efficient oral immunity, induces strong neutralizing antibody responses, provides broad-spectrum protection against rabies virus, and is suitable for immunity in susceptible wild animals and stray dogs and cats, making up for the shortcomings of intramuscular vaccination.
Smart Images

Figure CN120442567A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biomedicine, and in particular to a chimeric recombinant vesicular stomatitis virus based on rabies virus glycoprotein and applications thereof. Background Art
[0002] Rabies is an acute infectious disease caused by infection with the rabies virus (RABV), primarily transmitted through bites from infected animals. The main symptoms of rabies include hydrophobia, aeolian fear, pharyngeal muscle spasms, and progressive paralysis. Once the disease strikes, the mortality rate is 100%. Therefore, the primary countermeasure against rabies is immunization, namely, rabies vaccination. Currently, commercialized rabies vaccines for human and veterinary use are primarily inactivated vaccines, which effectively prevent the occurrence of rabies. According to the World Health Organization, the global economic losses caused by rabies amount to US$8.6 billion annually. Furthermore, rabies can also cause psychological illness in humans, known as "rabies phobia," which poses a serious threat to human life and health.
[0003] The World Health Organization has proposed to make the eradication of rabies by 2030 a common global goal. Many developed countries in Europe and the United States have effectively blocked the spread of rabies virus and achieved zero rabies by delivering attenuated live rabies vaccines to wild animals. In my country, the number of rabies cases has been decreasing year by year, from 1,917 in 2011 to 170 in 2024. To eliminate rabies virus, it must be controlled at the source. The main animal sources of rabies virus transmission are wild animals such as foxes and raccoon dogs, in addition to stray dogs and cats. Therefore, for these animal groups, the development of a safe and effective oral vaccine is a more practical option. Compared with intramuscular injection, oral immunization is a more convenient and feasible immunization route, which is of great significance for the full establishment of wild animal population immunity.
[0004] Vesicular stomatitis virus (VSV) is a widely used viral vector that is used in basic research, vaccines and oncolytic viruses. Among them, the Ebola vaccine based on the vesicular stomatitis virus vector showed excellent safety, immunogenicity and protective efficacy in phase III human clinical trials and was approved for marketing. Given that the vesicular stomatitis virus and rabies virus belong to the same family of Rhabdoviridae, the present invention is based on the vesicular stomatitis virus as a vector to express the rabies virus glycoprotein to construct a recombinant virus, which has certain feasibility. In addition, since the vesicular stomatitis virus vector vaccine has shown the potential for oral administration in the research of Ebola virus and new coronavirus vaccine, the development of an oral vaccine based on this vector is also a feasible option. Summary of the Invention
[0005] One of the objects of the present invention is to provide a rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus, wherein the genome of the recombinant vesicular stomatitis virus is obtained by replacing the glycoprotein encoding gene in the vesicular stomatitis virus genome with a rabies virus glycoprotein gene, and in addition, the same rabies virus glycoprotein gene or the rabies virus glycoprotein gene stabilized in a pre-fusion conformation is inserted into an additional transcription unit between the N gene and the P gene in the recombinant vesicular stomatitis virus genome, and the rabies virus glycoprotein gene is derived from the rabies virus ERA strain.
[0006] The replacement described above refers to replacing the complete coding region of the vesicular stomatitis virus glycoprotein encoding gene with the glycoprotein (G) gene of the rabies virus ERA strain. Rabies virus (RABV) glycoprotein (G) is the only surface protein that mediates the entry of the virus into the host cell by interacting with the host cell receptor. It is a key protein for viral invasion and the main target protein for inducing neutralizing antibodies. Rabies virus glycoprotein belongs to class I transmembrane glycoprotein, which forms a trimeric spike structure and a hairpin-like post-fusion conformation after cleavage by the precursor enzyme. The rabies virus glycoprotein stabilized in the pre-fusion conformation of the present invention is stabilized in the pre-fusion conformation by point mutations at key amino acid sites. This structure is more conducive to the full exposure of the antigenic epitope and is therefore more conducive to the generation of an immune response.
[0007] Furthermore, the nucleotide sequence of the rabies virus glycoprotein is shown as SEQ ID No. 1, and the amino acid sequence of the rabies virus glycoprotein is shown as SEQ ID No. 2.
[0008] Furthermore, the nucleotide sequence of the rabies virus glycoprotein stabilized in the pre-fusion conformation is shown as SEQ ID NO.3, and the amino acid sequence of the rabies virus glycoprotein stabilized in the pre-fusion conformation is shown as SEQ ID NO.4.
[0009] Furthermore, the recombinant vesicular stomatitis virus comprises vesicular stomatitis virus nucleoprotein, vesicular stomatitis virus phosphoprotein, vesicular stomatitis virus matrix protein, vesicular stomatitis virus RNA polymerase and two rabies virus glycoproteins, but does not comprise vesicular stomatitis virus glycoprotein.
[0010] The genome of vesicular stomatitis virus is from the Indiana vaccine strain of vesicular stomatitis virus, and its Genbank accession number is J02428.1.
[0011] The recombinant vesicular stomatitis virus provided by the present invention can achieve high virus titers during in vitro proliferation culture, has good immune effects when administered orally as an immunogen, and has broad-spectrum protective efficacy against the virulent rabies virus strain CVS24.
[0012] The present invention also provides a method for preparing the recombinant vesicular stomatitis virus described above, comprising: introducing the recombinant vector and the helper plasmid into a host cell to obtain a recombinant host cell, culturing the recombinant host cell and harvesting the released virus.
[0013] The auxiliary plasmids are four mammalian expression plasmids which respectively express RNA polymerase, nucleoprotein, phosphoprotein and glycoprotein of vesicular stomatitis virus.
[0014] Preferably, during the introduction into the host cells, the amount of the recombinant vector is 1-1.5 μg, the amount of the auxiliary plasmid expressing the RNA polymerase of the vesicular stomatitis virus is 0.2-0.4 μg, the amount of the auxiliary plasmid expressing the nucleoprotein of the vesicular stomatitis virus is 0.5-0.9 μg, the amount of the auxiliary plasmid expressing the phosphoprotein of the vesicular stomatitis virus is 1-1.5 μg, and the amount of the auxiliary plasmid expressing the glycoprotein of the vesicular stomatitis virus is 1.5-3 μg.
[0015] In some embodiments of the present invention, the method for preparing the recombinant vesicular stomatitis virus comprises the following steps:
[0016] (1) constructing the recombinant vector and the helper plasmid;
[0017] (2) Rescuing the recombinant virus using hamster kidney cells with a cell density of not less than 90%, transfecting the recombinant vector obtained in step (1) and the helper plasmid into hamster kidney cells by calcium phosphate transfection (Invitrogen), and culturing the cells in a medium containing fetal bovine serum to obtain rescued recombinant virus, which is recorded as P1 generation;
[0018] (3) The P1 generation recombinant virus was harvested and inoculated into African green monkey kidney cells and incubated. Fetal bovine serum cell culture medium was added and cultured at a constant temperature for 48-72 hours. The culture was collected and frozen and thawed, and recorded as the P2 generation. The same method was used to continuously subculture to the P5 generation to obtain the recombinant vesicular stomatitis virus.
[0019] In the above step (2), the culture medium containing fetal bovine serum is a DMEM culture medium containing 2-10% fetal bovine serum.
[0020] In the above step (3), the incubation conditions are 0.8-1.2 h at 37°C and the freeze-thaw temperature is -75 to -85°C.
[0021] A second object of the present invention is to provide the use of the above-mentioned rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus in the preparation of a drug for preventing and / or treating rabies virus infection or diseases caused by rabies virus infection. The drug is preferably a vaccine.
[0022] A third object of the present invention is to provide a rabies virus vaccine comprising the aforementioned chimeric recombinant vesicular stomatitis virus containing the rabies virus glycoprotein. In addition to the recombinant vesicular stomatitis virus, the vaccine may also contain excipients or adjuvants permitted in the vaccine field. The rabies virus vaccine may utilize the recombinant vesicular stomatitis virus alone as an immunogen, or may also contain other immunogens.
[0023] Furthermore, the vaccine is an oral vaccine.
[0024] The rabies virus vaccine provided by the present invention can be used for immunization of humans or animals, wherein the animal can be any animal susceptible to RABV, including but not limited to dogs, cats, foxes, raccoon dogs, etc.
[0025] The present invention has demonstrated through animal experiments that the rabies virus vaccine has excellent immune effects when administered orally, can induce the production of neutralizing antibodies against RABV, and has protective efficacy against lethal attacks by RABV.
[0026] A fourth object of the present invention is to provide a recombinant nucleic acid molecule encoding the above-mentioned rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus.
[0027] A fifth object of the present invention is to provide a recombinant vector comprising the above-mentioned recombinant nucleic acid molecule.
[0028] Furthermore, the recombinant vector is a mammalian expression plasmid.
[0029] The recombinant vector is obtained by inserting the above-mentioned recombinant nucleic acid molecule into a mammalian expression plasmid. The present invention has no particular limitation on the type of mammalian expression plasmid, and any plasmid that can replicate and express proteins in animal cells can be used.
[0030] In some embodiments of the present invention, the mammalian expression plasmid is pcDNA3.1.
[0031] The above-mentioned recombinant vector and the helper plasmid are co-transfected into host cells to prepare a recombinant vesicular stomatitis virus expressing the glycoprotein of the rabies virus ERA strain, which has a high rescue efficiency and can obtain a high virus titer during in vitro proliferation culture.
[0032] The auxiliary plasmid can be obtained by connecting the N gene, P gene, L gene and G gene of the vesicular stomatitis virus to the mammalian expression plasmid respectively.
[0033] A sixth object of the present invention is to provide a host cell containing the above-mentioned recombinant vector or the above-mentioned recombinant nucleic acid molecule integrated into its genome.
[0034] The host cells include microbial cells or animal cells. The present invention has no particular limitation on the type of host cells, wherein microbial cells include but are not limited to Escherichia coli and yeast, and animal cells include but are not limited to golden hamster kidney cells (BSR).
[0035] Compared with the prior art, the technical effects of the present invention are:
[0036] The present invention uses VSV as a viral vector and replaces the G gene in the VSV genome with the complete natural G gene of RABV, thereby ensuring the replication and proliferation ability, stable growth characteristics and higher growth titer of the recombinant VSV virus, and is more conducive to inducing mucosal immunity. On this basis, the rabies virus glycoprotein (preG) or the natural rabies virus glycoprotein (G) that is stable in the pre-fusion conformation is inserted into the additional transcription unit between the N and P genes of the VSV genome by mutation of key amino acid sites, showing similar maximum growth titers. After construction and screening, two strains expressing two rabies virus glycoprotein recombinant nucleic acid molecules and recombinant vectors were obtained. Compared with other chimeric designs that retain the VSV G gene, the G gene in the VSV genome is replaced with the G gene of RABV, so that only the G protein of RABV is assembled on the surface of the recombinant virus, which is more conducive to ensuring safety and immunogenicity.
[0037] Preferably, the recombinant nucleic acid molecule and its recombinant vector provided by the present invention can achieve the assembly of two rabies virus glycoproteins into a vesicular stomatitis virus vector during recombinant virus rescue, wherein one glycoprotein is in a pre-fusion form and the other is in a native form. The vesicular stomatitis virus recombinant rabies virus prepared thereby has a high viral titer and is convenient for in vitro culture. Specifically, by mutation of key amino acid sites, the structure of the rabies virus glycoprotein is stabilized in a pre-fusion conformation, thereby ensuring the exposure of more antigenic epitopes, thereby being more conducive to the generation of an immune response, inducing a higher neutralizing antibody response, and exhibiting better immunogenicity.
[0038] The recombinant vesicular stomatitis virus provided by the present invention has similar growth kinetics properties as rabies virus. The recombinant virus can be used as a substitute for rabies virus, better simulating the infection process and invasion mechanism, cell tissue tropism and immunogenicity of rabies virus, and can be used as a rabies virus alternative virus model. It is also the basis for achieving oral immunity.
[0039] The present invention further utilizes the VSV reverse genetic operating system to construct and screen a RABV recombinant VSV vector vaccine prepared from the recombinant virus. Oral immunization can induce animals to produce a strong rabies virus neutralizing antibody response, with excellent immune effect, a single injection and a fast response speed. The neutralizing antibody titer 7, 14 and 28 days after immunization is much higher than the international standard (0.5IU), and the glycoprotein is in the form of a pre-fusion double G strain, which is significantly better than the double G strain expressing two natural rabies virus glycoproteins and the recombinant virus vector vaccine expressing a single rabies virus glycoprotein. In addition, the present invention conducted immunogenicity evaluation and virus protection tests in a mouse animal model, proving that the recombinant vector vaccine of the present invention has excellent immunogenicity and broad-spectrum protection efficacy, with a 100LD 50 After being attacked by RABV, the immunized animal can provide 100% protection against the virus. Compared with vaccines delivered by intramuscular injection, oral vaccines are more convenient and economical, and can achieve immunization of large animal populations in a short period of time. Therefore, this vaccine can be used as a convenient and effective mucosal immunization candidate vaccine, which is of great significance for the source control of rabies virus - immunization of susceptible wild animals and stray dogs and cats. The oral vaccine of this invention makes up for the shortcomings of vaccines delivered by intramuscular injection and provides a basis for the development of new rabies virus vaccines. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.
[0041] Figure 1 Schematic diagram of the overall process of recombinant virus preparation and vaccine development provided by the embodiments of the present invention.
[0042] Figure 2 This is an immunoblotting and immunoelectron microscopy image of the recombinant virus protein provided in the embodiment of the present invention.
[0043] Figure 3 The oral immunization neutralizing antibody titer provided in the embodiments of the present invention.
[0044] Figure 4 This is the neutralizing antibody titer for intramuscular immunization provided in the embodiments of the present invention.
[0045] Figure 5 This is the RABV challenge protection result provided by the embodiment of the present invention. DETAILED DESCRIPTION
[0046] To help those skilled in the art better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by those skilled in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.
[0047] Unless otherwise specified, the test materials used in the following examples were purchased from conventional biochemical reagent stores. The experimental methods in the following examples were conventional methods unless otherwise specified.
[0048] In the following examples, HST08 competent cells were purchased from Baoriyi Biotechnology (Beijing) Co., Ltd. (9128); the plasmid carrying the G gene of the RABV ERA strain was preserved in this laboratory, and the G gene fragment carrying the RABV ERA strain stabilized in the pre-fusion conformation was achieved by the Novozan point mutagenesis reagent (C214-01 / 02) kit. The specific mutation sites included H280L and H289P (the nucleotide and amino acid sequences after mutation are shown in SEQ ID NO.3 and SEQ ID NO.4). Since the two mutation sites are located close to each other, the present invention designed a pair of homologous recombination primers (primer F1:
[0049] gactttcgctcagacgaaattgagccccttgttgtagaggagttggtcag, R1:
[0050] ttcgtctgagcgaaagtcgagcaggttcaccaactgatcgg) to achieve double-site mutation. Mouse anti-RABV G polyclonal antibody was purchased from Millipore (MAB8727); HRP-conjugated goat anti-mouse IgG was purchased from Bioworld Biotechnology; PrimeSTAR Max DNA Polymerase was purchased from Takara (R045A); SgsI (AscI), PvuI fast digester, and AnzaT4 ligase were purchased from Thermo Fisher Scientific (FD1894, FD0624, and IVGN2108); LB broth and LB broth agar were purchased from Sangon Biotech (Shanghai) Co., Ltd. (A507002 and A507003); fetal bovine serum (FBS) and DMEM were purchased from Gbico (10100147 and C11995500BT); calcium phosphate transfection reagent was purchased from Thermo Fisher Scientific (K278001); DMSO was purchased from Beijing Solebao Technology Co., Ltd. (D8371); and Immobilon Biotechnology (Immobilon) was purchased from Immobilon. Western chemiluminescence HRP substrate and DAPI were purchased from Merck Group (MFCD01779855, D9542, WBKLS0050); the endotoxin-free plasmid mini-extraction kit was purchased from Kangwei Century Biotechnology Co., Ltd. (CW2106); the endotoxin-free plasmid large-scale extraction kit and gel recovery kit were purchased from OMEGA (D2500); the recombinant VSV strain rVSVΔG-ERA G expressing a single rabies virus glycoprotein, the RABV-CVS11 standard strain, and the RABV-CVS24 challenge strain were from the Laboratory of Animal Virology and Special Animal Epidemics, Changchun Veterinary Research Institute, Chinese Academy of Agricultural Sciences.
[0051] Example 1 Rescue and Identification of Recombinant Viruses rVSVΔG-REA 2G and rVSVΔG-REA preG-G
[0052] 1. Construction of full-length infectious clone plasmid
[0053] (1) Preparation of materials
[0054] BSR-T7 cells and Vero E6 cells are both commercially available. The VSV / Indiana full-length genome plasmid p3.1-VSV and the auxiliary plasmids p3.1-VSV-N, p3.1-VSV-P, p3.1-VSV-L, and p3.1-VSV-G were all constructed using conventional genetic engineering techniques and are maintained in our laboratory. The VSV / Indiana full-length genome plasmid p3.1-VSV is constructed by ligating the VSV / Indiana full-length genome into the pcDNA3.1 plasmid and adding reverse genetic elements to the corresponding positions. An additional transcription unit, namely the transcription initiation GS sequence (shown in SEQ ID NO. 5) and the transcription termination GE sequence (shown in SEQ ID NO. 6), are added between the N and P genes for the insertion of exogenous genes. p3.1-VSV-N, p3.1-VSV-P, p3.1-VSV-L, and p3.1-VSV-G were generated by ligating the N, P, L, and G genes of VSV, respectively, into the pcDNA3.1 plasmid. Plasmid p3.1-ERA-G, carrying the G gene of the ERA strain of RABV, was synthesized by Shanghai Sangon Biotechnology Co., Ltd. on the pcDNA3.1 vector based on the reference sequence of ERA G (SEQ ID NO. 1).
[0055] (2) Primer design and synthesis for constructing the target fragment of infectious cDNA clone
[0056] Based on the G gene of the RABV ERA strain (sequence shown in SEQ ID NO. 1), primers (primers F2 and R2) were designed using SnapGene 2.3.2. The native RABV G gene was ligated to the upstream and downstream restriction sites of the p3.1-VSV G gene using the restriction sites AscI and PvuI to replace the VSV G gene. The G gene containing a prefusion-stabilized mutation (sequence shown in SEQ ID NO. 3, primers F3 and R3) or the native G gene (sequence shown in SEQ ID NO. 1) was ligated to the additional transcription unit between the N and P genes of the VSV genome using the restriction site BsiwI. The primer sequence information is as follows:
[0057] Primer F2: 5'-AT GGCGCGCC ATGGTTCCTCAGGCTCTCCT-3';
[0058] Primer R2: 5'- CGATCG TCACAGTCTGGTCTCACCCC-3'
[0059] Primer F3: 5'- TTAATTAA ATGGTTCCTCAGGCTCTCCT-3';
[0060] Primer R3: 5'- CGTACG TCACAGTCTGGTCTCACCCC-3'
[0061] Note: The underlined areas indicate the sequence information of restriction endonuclease sites (AscI, PvuI, PacI, BsiwI).
[0062] (3) Construction of the recombinant plasmids p3.1-VSVΔG-REA2G (expressing a total of two native forms of the RABV G glycoprotein between the N and P genes of the VSV genome and at the position replacing the VSV G gene, respectively) and p3.1-VSVΔG-REApreG-G (expressing a glycoprotein (preG) stabilized in a prefusion structure between the N and P genes of the VSV genome and expressing the native form of the RABV G glycoprotein at the position replacing the VSV G gene)
[0063] The primers designed in (2) above were used to amplify the G gene fragment of RABV ERA strain by PCR. The amplification reaction system and reaction procedure are shown in Tables 1 and 2, respectively.
[0064] Table 1 RABV G PCR amplification reaction system
[0065]
[0066] Table 2 RABV G PCR amplification reaction procedure
[0067]
[0068] The RABV G gene fragment and vector plasmid p3.1-VSV were double-digested with restriction endonucleases AscI / PvuI (the digestion system is shown in Table 3). After recovery, the target gene RABV G fragment was cloned into the VSV vector backbone plasmid using T4 DNA ligase (the ligation system is shown in Table 4) to obtain the infectious clone full-length plasmid p3.1-VSVΔG-G. Subsequently, in the same manner, the native structure or the RABV G gene sequence stabilized in the pre-fusion structure was cloned into p3.1-VSVΔG-G using the PacI / BsiwI restriction sites. The resulting target recombinant plasmids were named p3.1-VSVΔG-REA 2G and p3.1-VSVΔG-REA preG-G, respectively.
[0069] Table 3 RAVB G enzyme digestion system
[0070]
[0071] Table 4 Infectious clone full-length plasmid ligation system
[0072]
[0073] 2. Rescue of recombinant viruses rVSVΔG-REA 2G and rVSVΔG-REA preG-G
[0074] BSR-T7 cells were cultured in DMEM supplemented with 10% FBS and passaged into 35mm six-well plates overnight. Transfection was performed at a density of 90%. Transfection was performed according to the protocol of a calcium phosphate transfection kit. The following plasmids were transfected per well of the six-well plate: p3.1-p3.1-VSVΔG-REA 2Gpre / VSVΔG-REA 2G 1.25μg, p3.1-VSV-N 0.75μg, p3.1-VSV-P 1.25μg, p3.1-VSV-L 0.25μg, and p3.1-VSV-G 2μg. Six wells were rescued using each of the two recombinant viruses.
[0075] Transfected cells were cultured in DMEM with 5% FBS at 37°C in a 5% CO2 incubator for 16 hours, then shocked with PBS containing 10% DMSO for 2.5 minutes. Fresh DMEM with 5% FBS was then added and cultured for 72 hours before passage. During passage, cells and supernatant were harvested, frozen and thawed at -80°C, and centrifuged at 3000 rpm for 5 minutes to remove cell debris. Cells were then passaged onto Vero E6 cells, incubated at 37°C for 2 hours, and then incubated with DMEM with 5% FBS for an additional 48 hours. When the cytopathic effect exceeded 90%, cells and supernatant were harvested and stored in aliquots at -80°C. All procedures were performed in a biological safety cabinet.
[0076] 3. Protein immunoblotting identification of recombinant viruses
[0077] Vero E6 cells were cultured in DMEM supplemented with 10% FBS. When the cells reached a density of 90% in a six-well plate, the medium was discarded and the cells were infected with P5 rVSVΔG-REA 2G and rVSVΔG-REA preG-G at an MOI of approximately 0.01. After infection at 37°C for 1 hour, the cells were cultured in DMEM supplemented with 10% FBS. Twenty-four hours after infection, the cells were harvested and lysed with NP-40 lysis buffer at 4°C for 1 hour. SDS-PAGE electrophoresis was performed, and the target protein was transferred to a PVDF membrane and blocked with 5% skim milk for 30 minutes at room temperature. The cells were incubated with mouse anti-RABV G (1:2500) as the primary antibody at room temperature for 2 hours and then washed three times with PBST. Then, HRP-labeled goat anti-mouse IgG (1:10000) was incubated at room temperature for 1 hour and then washed three times with PBST. After adding chemiluminescent HRP substrate, imaging was performed using the Tanon-5200 Multi chemiluminescent imaging system. The parent virus VSV was set as the negative control group. The results are shown in Figure 2 , a specific band was observed at around 70kDa, indicating that the G protein of RABV was effectively expressed in the recombinant virus rVSVΔG-S. After incubation with RABV G-specific primary antibody and gold-labeled secondary antibody, followed by transmission electron microscopy, the results showed that both rVSVΔG-REA 2G and rVSVΔG-REA-preG-G were recognized by the antibody, exhibiting a bullet-shaped morphology with a diameter of about 200cnM and about 20nM gold-labeled particles on the surface ( Figure 2 ).
[0078] Example 2 Oral Immunization and Virus-Challenge Protection Test in Mice Using Recombinant Virus Vector Vaccine
[0079] 1. Immunization plan
[0080] Mouse immunization: Eighteen four-week-old female BALB / c mice were randomly divided into four groups. There were 6 mice in the rVSVΔG-REA preG-G immunization group, 6 mice in the rVSVΔG-REA 2G immunization group, 6 mice in the rVSVΔG-REA G immunization group, and 6 mice in the DMEM control group. The recombinant viral vector vaccine was administered orally with a titer of 10 7 TCID 50 / mL of recombinant virus was directly delivered to the animal's mouth at a dose of 0.1mL per animal to ensure that it was completely drunk. The control group of 6 animals drank the same volume of DMEM at the same time point. Blood was collected on the 7th, 14th and 28th days after immunization (blood was collected from the suborbital venous plexus) and serum was separated for neutralizing antibody detection. In addition, four groups of intramuscular injection immunization groups were added, including 6 rVSVΔG-REA preG-G immunization groups, 6 rVSVΔG-REA 2G immunization groups, 6 rVSVΔG-REA G immunization groups, and 6 DMEM control groups. Single-dose leg muscle injection of recombinant viral vector vaccine, using 10 7 TCID 50 / mL, the dose of 0.1mL per animal, and the control group was injected with the same volume of DMEM.
[0081] 2. Neutralizing antibody detection
[0082] Serum nAbs were detected using the rabies virus CVS11 strain. Serum was inactivated at 56°C for 30 minutes. Neutralizing antibody detection was performed according to international standards. Serum was diluted in a 96-well plate, starting with a 3-fold dilution and then diluted to 6531 times. RABV-CVS11 virus was then added to the 96-well plate, 100 TCID 50 / 50μL per well. Incubate in a 37°C, 5% CO2 incubator for 1 hour, then add 100μL of BHK-21 cells to each well. Set up positive serum controls, negative serum controls, virus controls, and blank cell controls. After 72 hours, perform direct immunofluorescence staining and observe the results under an inverted fluorescence microscope. The maximum serum dilution factor that can neutralize all viral fluorescence signals is used as the titer of mouse serum. The titer of serum is calculated using the ExcelFAVN calculation program based on the Spear-Karbar method. The formula is: serum inhibition titer of the sample to be tested antibody titer (IU / mL) / standard reference serum inhibition titer*2. See the results. Figure 3 The animals in the oral immunization group produced a high neutralizing antibody titer on the 7th day, and the neutralizing antibodies produced by all animals in the experimental group were greater than the international standard of 0.5 IU. The neutralizing antibody titer was further improved on the 14th day, and the neutralizing antibody was maintained at a considerable level on the 28th day, indicating that the neutralizing antibody titer had reached its peak on the 14th day. Combining the neutralizing antibody results at the three time points, the neutralizing antibody level induced by the rVSVΔG-REA preG-G group was significantly higher than that of the rVSVΔG-REA 2G and rVSVΔG-REA G groups (P < 0.01). The results of intramuscular injection immunization are shown in Figure 4, animals in each immunization group produced high neutralizing antibody titers on the 7th day, and the neutralizing antibodies produced by all animals in the experimental group were greater than the international standard of 0.5 IU. The neutralizing antibody titer was further improved on the 14th day, and the neutralizing antibody was maintained at a considerable level on the 28th day. Combining the neutralizing antibody results at the three time points, the neutralizing antibody level induced by the rVSVΔG-REA preG-G group was higher than that of the rVSVΔG-REA 2G and rVSVΔG-REA G groups, but the difference was not significant. The above results indicate that the pre-fusion mutation of the rabies virus glycoprotein in the recombinant viral vector vaccine rVSVΔG-REA preG-G significantly enhanced the immunogenicity of the recombinant viral vector vaccine, and induced a higher level of neutralizing antibody response in mice by oral immunization.
[0083] 3. Poison attack experiment
[0084] On the 35th day after immunization, the two experimental groups and the control group were challenged with the lethal challenge strain RABV-CVS24, 100LD 50 The survival and mortality rates of mice in each group were recorded and the observation was continued for two weeks. Figure 5 As shown, no mortality occurred in the rVSVΔG-REApreG-G and rVSVΔG-REA 2G immunization groups during two weeks of continuous observation, while all animals in the control group died from lethal RABV challenge between days 6 and 10. These results indicate that both the rVSVΔG-REA preG-G and rVSVΔG-REA2G groups can provide 100% protection against rabies virus challenge.
[0085] The above-described embodiments are only specific implementation methods of the present application, which are used to illustrate the technical solutions of the present application, rather than to limit them. The scope of protection of the present application is not limited thereto. Although the present application has been described in detail with reference to the above-mentioned embodiments, those skilled in the art should understand that any person skilled in the art can modify or easily conceive of changes to the technical solutions described in the above-mentioned embodiments within the technical scope disclosed in the present application, or perform equivalent replacements for some of the technical features thereof; and these modifications, changes or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application. They should all be included in the scope of protection of the present application. Therefore, the scope of protection of the present application shall be subject to the scope of protection of the claims.
Claims
1. A chimeric recombinant vesicular stomatitis virus containing rabies virus glycoprotein, characterized in that: The genome of the recombinant vesicular stomatitis virus is obtained by replacing the glycoprotein encoding gene in the vesicular stomatitis virus genome with a rabies virus glycoprotein gene. In addition, the same rabies virus glycoprotein gene or a rabies virus glycoprotein gene stabilized in a pre-fusion conformation is inserted into an additional transcription unit between the N gene and the P gene in the recombinant vesicular stomatitis virus genome, and the rabies virus glycoprotein gene is derived from the rabies virus ERA strain.
2. The rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus according to claim 1, characterized in that The nucleotide sequence of the rabies virus glycoprotein is shown in SEQ ID No. 1, and the amino acid sequence of the rabies virus glycoprotein is shown in SEQ ID No.
2.
3. The rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus according to claim 1, characterized in that: The nucleotide sequence of the rabies virus glycoprotein stabilized in the pre-fusion conformation is shown in SEQ ID NO.3, and the amino acid sequence of the rabies virus glycoprotein stabilized in the pre-fusion conformation is shown in SEQ ID NO.
4.
4. The rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus according to claim 1, characterized in that The recombinant vesicular stomatitis virus comprises vesicular stomatitis virus nucleoprotein, vesicular stomatitis virus phosphoprotein, vesicular stomatitis virus matrix protein, vesicular stomatitis virus RNA polymerase and two rabies virus glycoproteins, but does not comprise vesicular stomatitis virus glycoprotein.
5. Use of the rabies virus glycoprotein chimeric recombinant vesicular stomatitis virus according to claim 1 in the preparation of a medicament for preventing and / or treating rabies virus infection or diseases caused by rabies virus infection.
6. A rabies virus vaccine, characterized in that: A chimeric recombinant vesicular stomatitis virus comprising the rabies virus glycoprotein according to claim 1.
7. The rabies virus vaccine according to claim 6, characterized in that The vaccine is an oral vaccine.
8. A recombinant nucleic acid molecule, characterized in that A chimeric recombinant vesicular stomatitis virus encoding the rabies virus glycoprotein according to claim 1. A recombinant vector comprising the recombinant nucleic acid molecule according to claim 8 .
10. A host cell comprising the recombinant vector according to claim 9 or the recombinant nucleic acid molecule according to claim 8 integrated into its genome.
Citation Information
Patent Citations
Fusion protein containing rabies virus G protein, preparation method of fusion protein, application of fusion protein, and vaccine
CN110981968A
Recombinant virus strain for expressing double-copy Lassa fever virus GP gene as well as construction method and application of recombinant virus strain
CN115820572A
Adenovirus recombinant rabies vaccine as well as preparation method and application thereof
CN115820738A
Rabies virus vaccine based on vesicular stomatitis virus vector
CN119040279A
Rabies virus G protein mutant as well as preparation method and application thereof
CN119552227A