Design and application of an RNAi target gene and its dsRNA for the control of wheat aphid.

By screening tyrosine hydroxylase genes as RNAi targets and designing dsRNAs, the gene expression of wheat aphids was interfered with by wheat seedlings. This solved the problems of environmental pollution and pest resistance caused by chemical pesticides in the control of wheat aphids, and achieved a highly efficient and environmentally friendly control effect.

CN120442660BActive Publication Date: 2026-01-30INST OF PLANT PROTECTION HENAN ACAD OF AGRI SCI
View PDF 7 Cites 0 Cited by

Patent Information

Application Number
CN202510584996.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-07
Publication Date
2026-01-30
Estimated Expiration
2045-05-07

AI Technical Summary

Technical Problem

Current technologies for controlling wheat aphids mainly rely on chemical pesticides, leading to pesticide residues and increased pest resistance. Furthermore, conventional pesticides are toxic to non-target organisms, necessitating the search for new, efficient, and environmentally friendly control methods.

Method used

Tyrosine hydroxylase genes were screened as RNAi targets, and dsRNA was designed and synthesized. This RNAi technology was used to interfere with the expression of specific genes of wheat aphids by soaking wheat seedlings.

Benefits of technology

It significantly inhibits the expression of tyrosine hydroxylase in wheat aphids, leading to stunted growth and development and a lethal effect, thus achieving long-term control of wheat aphids and reducing the frequency of chemical pesticide use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442660B_ABST
    Figure CN120442660B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of biotechnology, specifically relating to the design and application of an RNAi target gene and its dsRNA for controlling the wheat aphid. The invention involves sequencing, annotation, and verification to obtain the wheat aphid tyrosine hydroxylase gene, whose nucleotide sequence is SEQ ID No: 1. Using the wheat aphid tyrosine hydroxylase gene as a target gene, dsRNA was designed, including the design of primers with a 5' end T7 promoter sequence, resulting in the nucleotide sequence of the tyrosine hydroxylase dsRNA, which is SEQ ID No: 4. This invention uses the wheat aphid tyrosine hydroxylase gene as a target gene and designs corresponding wheat aphid tyrosine hydroxylase dsRNA, both of which are applied to control the wheat aphid, leading to inhibited growth and development and a lethal effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the design and application of an RNAi target gene and its dsRNA for controlling wheat aphid. Background Technology

[0002] Wheat aphids, as a type of pest, feed on wheat leaves in the early stages and then damage the ears after wheat heading, leading to a decrease in wheat yield. Besides direct damage through feeding, wheat aphids are also major vectors for viral diseases such as wheat yellow dwarf disease. Three common wheat aphid species in my country include the long-tubed wheat aphid (also known as the reed-web aphid), the grain-web aphid, and the wheat two-forked aphid, with the long-tubed wheat aphid being the dominant species in several wheat-growing areas. Currently, wheat aphid control still relies mainly on chemical control, commonly using neonicotinoid pesticides such as imidacloprid and thiamethoxam for seed treatment and spraying. However, wheat aphids reproduce extremely rapidly, and relying solely on chemical control will exacerbate pesticide residues, endangering food safety. Furthermore, neonicotinoid pesticides commonly used in wheat aphid control are highly toxic to bees, silkworms, and shrimp, and the EU has restricted their use. Therefore, finding new methods for wheat aphid control is of great significance.

[0003] RNA interference (RNAi) is a highly specific gene silencing phenomenon mediated by double-stranded RNA (dsRNA) and involving specific enzymes. It is ubiquitous in organisms and can effectively block the expression of target genes. Nucleic acid pesticides based on RNAi technology represent a cutting-edge field in global agricultural science and technology. The world's first commercially available nucleic acid insecticide is already on the market in the United States. Therefore, combining RNAi and other novel pest control technologies to screen for highly lethal genes against the wheat aphid is of great significance for building a green control system for the wheat aphid, promoting the sustainable development of my country's wheat industry, and increasing my country's future competitiveness in related industries.

[0004] Gene screening for the control of wheat aphid has shown initial success. Existing invention patents, CN201410474661.8 ("A peroxidase gene dsRNA and its application in the control of wheat aphid") and CN201410474665.6 ("A carboxylesterase gene dsRNA and its application in the control of wheat aphid"), both disclose that dsRNA can be used for the control of wheat aphid. Another invention patent, CN201210205601.7 ("A cytochrome P450 gene dsRNA and its application in inhibiting aphid growth"), discloses the use of RNAi technology to silence cytochrome P450 in wheat aphids and peach aphids. Finally, there is an invention patent, CN201410328241.9 ("A ecdysone receptor gene EcR"). The invention patents CN201410328484.2, "A molting hormone receptor gene USP dsRNA and its application in controlling aphid damage", both disclose the technical content of using RNAi technology to inhibit the expression of the corresponding gene in the wheat aphid, resulting in the aphid's growth and development being hindered and producing a lethal effect. Summary of the Invention

[0005] One of the objectives of this invention is to screen out a highly lethal gene as a target for the control of wheat aphid.

[0006] The second objective of this invention is to design and synthesize dsRNA using target genes.

[0007] The third objective of this invention is to apply the target gene dsRNA to the control of wheat aphid.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] Tyrosine hydroxylase genes were screened out as RNAi target genes for the control of wheat aphid. Tyrosine hydroxylase (TH) is a key enzyme involved in the biosynthesis of dopamine, which plays an important role in the nervous system, behavioral regulation, growth and development and immune response of insects.

[0010] An RNAi target gene for controlling wheat aphid is a tyrosine hydroxylase gene of wheat aphid obtained through sequencing-annotation-verification, and its nucleotide sequence is SEQ ID No: 1.

[0011] Furthermore, dsRNA was designed using the wheat aphid tyrosine hydroxylase gene as a target, and dsRNA synthesis fragments were obtained.

[0012] The above design process includes designing primers with a T7 promoter sequence added to the 5' end. The specific nucleotide sequences of the primers are shown below:

[0013] G-t7: TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG, denoted as SEQ ID No: 2.

[0014] R-t7: TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC, denoted as SEQ ID No: 3.

[0015] Furthermore, the specific nucleotide sequence of the designed dsRNA is SEQ ID No: 4.

[0016] Using the tyrosine hydroxylase gene of the wheat aphid as a target gene, corresponding tyrosine hydroxylase dsRNA of the wheat aphid was designed. Both were applied to control the wheat aphid, resulting in inhibited growth and development and a lethal effect.

[0017] An application of an RNAi target gene for the control of wheat long-tubed aphid is as follows: long-term control of wheat long-tubed aphid populations is achieved through RNAi technology, and the tyrosine hydroxylase gene is a potential target for the development of nucleic acid pesticides.

[0018] An application of a target gene dsRNA for controlling wheat aphids is as follows: tyrosine hydroxylase dsRNA can be transmitted through wheat seedlings and interfere with the expression of the corresponding specific gene of wheat aphids.

[0019] The beneficial effects of this invention are as follows:

[0020] 1. This invention addresses the problems of indiscriminate and excessive use of chemical pesticides in the current control of wheat aphid, which leads to environmental pollution and increased pest resistance. It utilizes RNAi technology to screen and obtain a tyrosine hydroxylase target gene that has a long-term control effect on wheat aphid populations. By delivering specific dsRNA through seedling soaking, the expression of the wheat aphid tyrosine hydroxylase gene can be effectively reduced. This invention has high reference value for the long-term control of wheat aphids using nucleic acid pesticides, is simple to use, and has good potential for widespread application.

[0021] 2. In this invention, the tyrosine hydroxylase gene fragment of *Aphis longiflora* was obtained through comparison and annotation using transcriptome data of *Aphis longiflora*, and identified by conventional PCR and sequencing. Subsequently, dsRNA of *Aphis longiflora* tyrosine hydroxylase was synthesized using an in vitro dsRNA synthesis system, and wheat seedlings were soaked in the RNA. Following this, *Aphis longiflora* were inoculated with the RNA to conduct a bioassay experiment. Quantitative PCR results showed that after *Aphis longiflora* consumed wheat seedlings soaked in tyrosine hydroxylase dsRNA, the expression level of tyrosine hydroxylase was significantly inhibited (p<0.05), indicating that tyrosine hydroxylase dsRNA can be transmitted through wheat seedlings and interfere with the expression of the corresponding specific gene of *Aphis longiflora*. Bioassay results showed that consuming wheat seedlings soaked in tyrosine hydroxylase dsRNA led to the mortality of 18.3% of aphids within 48 hours, and the mortality rate reached 77.7% within 5 days. These results indicate that the tyrosine hydroxylase gene can be used for long-term control of *Aphis longiflora* populations through RNAi technology, and is a potential target for developing nucleic acid pesticides. Attached Figure Description

[0022] Figure 1 The results of the tyrosine hydroxylase interference efficiency detection in this invention;

[0023] Figure 2 These are the bioassay results for RNAi in this invention. Detailed Implementation

[0024] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0025] Tyrosine hydroxylase (TH) is a key enzyme involved in the biosynthesis of dopamine, which plays an important role in the nervous system, behavioral regulation, growth and development, and immune response of insects.

[0026] This invention uses the tyrosine hydroxylase gene as the RNAi target gene for the control of wheat aphid, and performs screening and verification of the target gene, synthesis of the target gene dsRNA, and RNAi bioassay.

[0027] Example 1: Screening and validation of target genes

[0028] Transcriptome sequencing: Twenty adult wheat aphids were collected in triplicate for transcriptome sequencing. Total RNA extraction from the aphids was performed using TRIzol (Invitrogen, Carlsbad, CA, United States) according to the instructions. RNA quality was analyzed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA). Aphid mRNA was enriched using Oligo(dT) magnetic beads, then fragmented into small fragments using fragmentation buffer, and first-strand cDNA was synthesized using random primers. The first-strand cDNA was obtained by amplification and purified using a QiaQuick PCR extraction kit (Qiagen, Venlo, The Netherlands), followed by the addition of sequencing adapters. The size of the ligated fragments was determined by agarose gel electrophoresis, and suitable fragments were selected for downstream sequencing. Transcriptome sequencing was performed on an Illumina HiSeq 4000 sequencing platform (Gene Denovo Biotechnology, Guangzhou, China) using a paired-end sequencing strategy of 250 bp.

[0029] Transcriptome analysis: Adapters and low-quality sequences (including sequences with more than 10% unknown base N and sequences with a quality value less than 20) were removed from the raw sequencing reads using the FASTP program. Transcriptome assembly was performed using Trinity software with default parameters. Gene functional annotation was performed using BLASTx alignment to the NCBI Nr (non-redundant protein) database, with an e-value of 1×10⁻⁵. The tyrosine hydroxylase gene of the wheat aphid was identified and annotated; the annotation results are shown in the table below.

[0030]

[0031]

[0032] The tyrosine hydroxylase gene fragment of the wheat aphid was obtained through alignment and annotation, and the specific nucleotide sequence is SEQ ID No: 1.

[0033] Using the tyrosine hydroxylase gene fragment of the wheat aphid as the target gene, primers were synthesized based on the above nucleotide sequence SEQ ID No: 1, and the sequence was verified by RT-PCR. The specific operation method is as follows.

[0034] Reverse transcription was performed using total RNA from aphids as a template, Oligo dT as a primer, and PrimeScript.TM The RT-PCR was performed using the 1st StrandcDNA Synthesis Kit (TaKaRa, Dalian, China), following the kit's instructions. The RT-PCR reaction mixture consisted of 10 μl of 2×Premix Taq. TM (TaKaRa Taq TM Version 2.0plus dye (TaKaRa, Dalian, China), 0.8 μl each of forward and reverse primers (10 mM), 2 μl of reverse transcription product, and double-distilled water to make up to 20 μl. The PCR reaction program was: 94℃ pre-denaturation for 2 minutes; 94℃ denaturation for 10 seconds, 53℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for a total of 35 cycles; and a final extension at 72℃ for 10 minutes. 1-2 μl of the PCR product was loaded into the wells of a 1.0% agarose gel placed in an electrophoresis tank and electrophoresed at 120V. The gel was then analyzed using a UV transilluminator or gel imaging analyzer. Specific amplification primer sequences (F: GAATCATCCGAATCATCTG; R: CCGGGGTGGTTCATGTCC), primer synthesis, and PCR product sequencing were all performed by Sangon Biotech (Shanghai) Co., Ltd.

[0035] Target gene validation results: A 464bp gene fragment was obtained through RT-PCR amplification and sequencing. The gene sequence of the wheat aphid tyrosine hydroxylase gene obtained by comparison with transcriptome data was completely consistent, which proved the reliability of the wheat aphid tyrosine hydroxylase gene sequence and provided a reliable gene sequence for the subsequent synthesis of dsRNA.

[0036] Example 2: Synthesis of target gene dsRNA

[0037] The CDS sequence of the target gene was analyzed. By predicting the target site of siRNA, GC content, and secondary structure, a suitable dsRNA segment was selected, and primers with the T7 promoter sequence added to the 5' end were designed.

[0038] The specific nucleotide sequence of the T7 promoter is shown below: 5'-TAATACGACTCACTATAGGG-3',

[0039] The specific nucleotide sequences of the primers are shown below:

[0040] F-t7: TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG (referred to as SEQ ID No: 2)

[0041] R-t7: TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC (referred to as SEQ ID No: 3)

[0042] PCR amplification yielded a template containing the T7 promoter. The reaction was then carried out at 37°C for 4-6 hours using T7 RNA polymerase, buffer, and NTPs, followed by annealing at 72°C and slow cooling to room temperature to terminate the reaction. The synthesized dsRNA was purified using magnetic beads to remove unsynthesized NTPs, proteins, and ions from the reaction solution. It was then eluted with enzyme-free water, and the dsRNA concentration was determined using NanaDrop. This experiment was commissioned to Shanghai PlantScience Biotechnology Co., Ltd. for custom synthesis.

[0043] The dsRNA fragment obtained by the above method is designated as SEQ ID No: 4, and its specific nucleotide sequence is as follows:

[0044]

[0045]

[0046] Example 3: RNAi bioassay

[0047] Twenty 4-day-old (approximately second instar) aphid nymphs were collected and repeated three times. They were fed on wheat seedlings soaked in dsRNA (1500 ng / ul) (GFP as a control) for 48 hours (2 days) and 120 hours (5 days), respectively, and the mortality rate was recorded.

[0048] RNAi bioassay results are as follows Figure 2 As shown, bioassay results indicated that feeding on wheat seedlings soaked in tyrosine hydroxylase dsRNA led to the mortality of 18.3% of aphids within 48 hours, and the mortality rate reached 77.7% within 5 days. These results demonstrate that the tyrosine hydroxylase gene can provide long-term control of wheat aphid populations using RNAi technology, and represents a potential target for developing nucleic acid pesticides.

[0049] Example 4: RNAi interference efficiency detection

[0050] Forty-eight hours after feeding, a suitable number of surviving aphids were selected, and the relative expression level of the target gene was detected by quantitative PCR (qRT-PCR) to verify the efficiency of RNAi.

[0051] Specifically, the aphid housekeeping gene was used as a control, with three replicates for each treatment. Total RNA was extracted using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa). Reverse transcription was performed using aphid total RNA as a template, Oligo dT as a primer, and PrimeScript. TM The qRT-PCR was performed using a 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China), following the kit's instructions. The qRT-PCR reaction mixture consisted of: 10 μl 2×Green Realtime PCR Master Mix (Toyobo, Shanghai, China), 0.8 μl each of forward and reverse primers (10 mM), 2 μl of reverse transcription product, and double-distilled water to a final volume of 20 μl. The qRT-PCR program was: 95℃ pre-denaturation for 5 seconds, 55℃ annealing for 10 seconds, and 72℃ extension for 15 seconds, for a total of 40 cycles; melting curve analysis was performed at the end. The qRT-PCR primer sequences (F: CCGTGGTTCCCGAGACAC; R: CCAATAGCACCTCTTCTT), primer synthesis, and PCR product sequencing were all performed by Sangon Biotech (Shanghai) Co., Ltd.

[0052] The results of RNAi interference efficiency detection are as follows: Figure 1 As shown, the results indicated that the expression of tyrosine hydroxylase was significantly inhibited (p<0.05) after the wheat aphid fed on wheat seedlings soaked in tyrosine hydroxylase dsRNA. This suggests that tyrosine hydroxylase dsRNA can be transmitted through wheat seedlings and interfere with the expression of the corresponding specific gene in the wheat aphid.

Claims

1. A RNAi target gene for preventing and controlling Sitobion avenae, characterized in that, The tyrosine hydroxylase gene of Sitobion avenae is obtained by sequencing-annotation-verification, and the nucleotide sequence is SEQ ID No:

1.

2. A target gene dsRNA for preventing and controlling Sitobion avenae, characterized in that, The dsRNA is designed by taking the tyrosine hydroxylase gene of Sitobion avenae as a target, and the specific nucleotide sequence is SEQ ID No:

4.

3. The target gene dsRNA for preventing and controlling Sitobion avenae according to claim 2, characterized in that, The nucleotide sequence of the target gene dsRNA is as follows: F-t7: TAATACGACTCACTATAGGGTAGGGTCACTCGGCCCGTCG, recorded as SEQ ID No: 2, R-t7: TAATACGACTCACTATAGGGGCGAAATGCGCTACGGCTGC, recorded as SEQ ID No:

3.

4. The use of the RNAi target gene of claim 1 in the prevention and control of Sitobion avenae, characterized in that, The tyrosine hydroxylase gene of Sitobion avenae is taken as a target gene, and the population of Sitobion avenae is controlled by the RNAi technology.

5. The use of the target gene dsRNA of claim 2 in the prevention and control of Sitobion avenae, characterized in that, The tyrosine hydroxylase dsRNA of Sitobion avenae can be transmitted through wheat seedlings, and interfere with the expression of the specific gene of Sitobion avenae.

Citation Information

Patent Citations

  • Cytochrome P450 dsRNA (double-stranded ribonucleic acid) and application to aphid growth inhibition

    CN102776189A

  • An ecdysone receptor gene EcR dsRNA and its application in controlling aphid damage

    CN104109672B

  • A kind of ecdysone receptor gene usp dsRNA and its application in controlling aphid damage

    CN104109673B

  • Peroxidase gene dsRNA (double-stranded ribonucleic acid) and application of peroxidase gene dsRNA in control of sitobion avenae

    CN104232645A

  • Carboxylesterase gene dsRNA and applications thereof in prevention and treatment of sitobion avenae

    CN104293809A