SNP (Single Nucleotide Polymorphism) molecular marker closely linked with genetic sex of channa argus and application of SNP molecular marker

Through the SNP molecular markers and KASP primers with closely linked sex in the inheritance of linear birds, the accuracy and high throughput of linear birds are solved, and the efficient promotion of single-sex breeding and breeding of linear birds is achieved.

CN120442771AActive Publication Date: 2025-08-08PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510461035.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-08-08
Estimated Expiration
2045-04-14

AI Technical Summary

Technical Problem

The prior art cannot accurately, quickly and without loss identification of the genetic gender of vegetation, resulting in limited push of single-sexed breeding of vegetation, and high detection costs and low throughput.

Method used

Provide SNP molecular markers closely linked to the inherited sex of the vein and their specific KASP primers, and achieve high-throughput, low-cost gender identification through PCR amplification and fluorescence detection.

Benefits of technology

It realizes rapid, accurate and loss-free identification of linear bird gender, improves detection efficiency and accuracy, and supports large-scale single-sex breeding and breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005357103800000011
    Figure HDA0005357103800000011
  • Figure HDA0005357103800000012
    Figure HDA0005357103800000012
Patent Text Reader

Abstract

The invention belongs to the technical field of molecular biology, discloses an SNP molecular marker closely linked with genetic sex of channa maculata and application of the SNP molecular marker, and particularly discloses the SNP molecular marker closely linked with genetic sex of channa maculata, the sequence of the SNP molecular marker is as shown in SEQ ID NO: 1, the SNP site is located at the 151st site from the 5'terminal of the sequence as shown in SEQ ID NO: 1, and the basic group is T / G. The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker closely linked with an ophicephalus obscura sex gene. The genetic sex of the ophicephalus obscura can be accurately identified through the single base difference in the molecular marker. The invention also provides a specific KASP primer for amplifying the molecular marker closely linked with the sex gene of the snakehead, which can be used for detecting the genetic sex of the snakehead, is simple and easy to use, has high analysis flux and high accuracy, and is suitable for detecting a large number of samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a SNP molecular marker closely linked to the genetic sex of Channa fasciatus and an application thereof. Background Art

[0002] The snakehead fish (Channa striata) is classified as belonging to the genus Channa, family Channidae, order Perciformes. It is an important freshwater fish species in Southeast Asia and South Asia, widely distributed in rivers, lakes, and rice paddies in countries such as India, Bangladesh, Thailand, Vietnam, and Indonesia. Large-scale farming is also practiced in parts of my country. Due to its delicious and nutritious meat, market demand for the fish continues to grow. According to FAO statistics, global aquaculture production of the fish exceeded 500,000 tons in 2022. Males have a significant growth advantage in snakehead fish farming, growing 20%-30% faster than females. This difference is evident in the juvenile stage (1-2 months of age) and gradually increases with the extension of the farming cycle. This characteristic of snakehead fish is of great economic value, as monosexual farming shortens the farming cycle, significantly reduces farming costs, and increases unit yield, thereby improving aquaculture efficiency. However, due to the lack of obvious external sex characteristics, especially in juveniles, it is difficult to distinguish males and females by appearance. Traditional dissection and observation of the gonads can cause injury or even death. However, the use of molecular markers closely linked to sex can allow for rapid, accurate, and lossless sex identification in the early stages of snakehead aquaculture. Therefore, the development of molecular markers closely linked to sex is a key technology for promoting monosexed aquaculture of snakehead fish.

[0003] At present, there are still few studies on the sex determination mechanism of the line snakehead fish. The sex determination mechanism of the line snakehead fish has not yet been clarified, and the conservation of the reported sex-related genes (such as Dmrt1 and Foxl2) in the population is also unclear, and they cannot be directly used for marker development.

[0004] Prior art discloses marker primers and methods for identifying the genetic sex of snakehead fish. However, these methods do not accurately identify SNP sites that are closely linked to the genetic sex of snakehead fish. Instead, they amplify the snakehead fish gene using only one forward primer and one reverse primer, assuming that a single amplified band indicates females, while two amplified bands indicate males. This method carries a high risk of error in identifying the genetic sex of snakehead fish. Once amplification fails, a genetically male snakehead fish can be mistakenly identified as a genetically female snakehead fish, making accuracy difficult to guarantee. Furthermore, this method requires electrophoresis analysis, which is complex and difficult to perform in high-throughput testing. The cost of testing a single sample is also relatively high, making it unsuitable for large-scale molecular marker screening and having limited impact on the monosexed culture of snakehead fish. Summary of the Invention

[0005] In response to the technical problems existing in the prior art, the present invention aims to provide a specific molecular marker and a supporting detection method that are closely linked to the genetic sex of the line snakehead fish, so as to achieve rapid, high-throughput, high-precision and low-cost sex identification of the line snakehead fish, and promote single-sex breeding and farming.

[0006] The first aspect of the present invention aims to provide a SNP molecular marker that is tightly linked to the genetic sex of Channa tangli.

[0007] The second aspect of the present invention aims to provide KASP primers for amplifying the SNP molecular markers of the first aspect of the present invention.

[0008] The third aspect of the present invention aims to provide a reagent or a kit.

[0009] The fourth aspect of the present invention aims to provide applications of the SNP molecular marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, and the reagent or kit of the third aspect of the present invention.

[0010] The fifth aspect of the present invention aims to provide a method.

[0011] In order to achieve the above object, the technical solution adopted by the present invention is:

[0012] In a first aspect of the present invention, a SNP molecular marker tightly linked to the genetic sex of Channa tangli is provided. The sequence of the SNP molecular marker is shown in SEQ ID NO: 1. The SNP site is located at position 151 from the 5' end of the sequence shown in SEQ ID NO: 1, and its base is T / G.

[0013] In some embodiments of the present invention, when the base is T / T homozygous, the sex of the Channa tricholoma is female, and when the base is T / G heterozygous, the sex of the Channa tricholoma is male.

[0014] The physical position of the SNP molecular marker in the present invention is based on the genome of Channa striata GCA_033026295.1 (Genomeassembly C.striata_1.0), and is located at position 393098 of chromosome 1 of the genome of Channa striata.

[0015] The second aspect of the present invention provides a KASP primer for amplifying the SNP molecular marker of the first aspect of the present invention, comprising a forward primer X, a forward primer Y and a reverse primer;

[0016] Wherein, the forward primer X contains the nucleotide sequence shown in SEQ ID NO: 6 (ATGAGAGTACACGTCTTCCT);

[0017] The forward primer Y contains the nucleotide sequence shown in SEQ ID NO: 7 (AGTACACGTCTTCCGGC);

[0018] The nucleotide sequence of the reverse primer is shown in SEQ ID NO: 5.

[0019] In some embodiments of the present invention, the forward primer X and the forward primer Y contain a tag sequence of a fluorescent group, and the fluorescent groups of the forward primer X and the forward primer Y are different.

[0020] In some embodiments of the present invention, the fluorescent group tag sequence is located at the 5' end of the forward primer X and the forward primer Y.

[0021] In some embodiments of the present invention, the fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.

[0022] In some embodiments of the present invention, the 5' end of the forward primer X is added with a FAM fluorescent tag sequence as shown in SEQ ID NO: 8 (GAAGGTGACCAAGTTCATGCT).

[0023] In some embodiments of the present invention, the nucleotide sequence of the forward primer X is shown in SEQ ID NO: 3.

[0024] In some embodiments of the present invention, the 5' end of the forward primer Y is added with a HEX fluorescent tag sequence as shown in SEQ ID NO: 9 (GAAGGTCGGAGTCAACGGATT).

[0025] In some embodiments of the present invention, the nucleotide sequence of the forward primer Y is shown in SEQ ID NO:4.

[0026] The third aspect of the present invention provides a reagent or kit comprising the KASP primer according to the second aspect of the present invention.

[0027] In some embodiments of the present invention, the reagent or kit further contains DNA polymerase, dNTP and MgCl2.

[0028] In some embodiments of the present invention, the kit further comprises a TRET cassette fluorescent primer and a ROX internal reference dye.

[0029] The fourth aspect of the present invention provides the use of the SNP molecular marker of the first aspect of the present invention, the KASP primer of the second aspect of the present invention, or the reagent or kit of the third aspect of the present invention in any of the following aspects:

[0030] 1) Identify the sex of snakehead fish;

[0031] 2) Molecular marker-assisted breeding related to the sex of Channa tangata;

[0032] 3) Genotyping of Channa lineata;

[0033] 4) Construction of DNA fingerprint of Channa lineata;

[0034] 5) Assisted breeding of snakehead fish;

[0035] 6) preparing products for assisting breeding of Channa tangata.

[0036] A fifth aspect of the present invention provides a method comprising the steps of using the KASP primers of the second aspect of the present invention and the reagent or kit of the third aspect of the present invention to detect the SNP molecular marker of the first aspect of the present invention in the genome of a tested Channa nematode;

[0037] The method includes any one of (1) to (4):

[0038] (1) A method for identifying the sex of snakehead fish;

[0039] (2) A method for assisted breeding of snakehead fish;

[0040] (3) A method for genotyping of Channa fasciatus;

[0041] (4) A method for constructing a DNA fingerprint of snakehead fish.

[0042] In some embodiments of the present invention, the method comprises the following steps:

[0043] (1) extracting genomic DNA of the tested snakehead;

[0044] (2) using DNA as a template and performing PCR amplification using the KASP primers of the second aspect of the present invention or the reagent or kit of the third aspect of the present invention;

[0045] (3) Analyze the PCR amplification products to obtain the genotype of the SNP molecular marker in the genome of the tested snakehead fish.

[0046] In some embodiments of the present invention, when the genotype is TT, the genetic sex of the tested snakehead fish is female, and when the genotype is TG, the genetic sex of the tested snakehead fish is male.

[0047] In some embodiments of the present invention, the Channa tricholoma DNA can be extracted using conventional methods in the art, including the phenol-chloroform method and various DNA extraction kits.

[0048] In some embodiments of the present invention, the reaction program of the PCR amplification is 90-94°C for 10-15 minutes; 90-94°C for 20-30 seconds, 56-65°C for 50-60 seconds, with the annealing extension temperature reduced by 0.8°C per cycle, for 8-10 cycles; 90-94°C for 20-30 seconds, 56-57°C for 56-60 seconds, for 28-30 cycles.

[0049] The beneficial effects of the present invention are:

[0050] The invention provides a SNP molecular marker (Cshen 098) tightly linked to the sex gene of Channa tangata, wherein the SNP site is located at 392098bp of chromosome 1. The genetic sex of Channa tangata can be accurately identified through the single base difference in the molecular marker.

[0051] The present invention also provides a specific KASP primer for amplifying a molecular marker tightly linked to the sex gene of the line snakehead, which can detect the genetic sex of the line snakehead. The primer is simple to use, has high analysis throughput and high accuracy, and is suitable for detecting a large number of samples.

[0052] The molecular markers provided by this invention can help quickly and accurately screen for the desired genetically sexed germplasm of the snakehead mullet, significantly accelerating the progress of monosexed breeding or farming of the mullet. While reducing time and labor costs, they also enable high-throughput testing of multiple samples, significantly improving detection efficiency. This will play a significant role in monosexed breeding or farming of the mullet. Specifically, detecting this molecular marker has important practical significance for quickly and accurately screening male and female mullets, shortening breeding time, and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is the genome sequence comparison result of female and male snakehead samples.

[0054] Figure 2 Results of detecting 56 snakehead fish using the marker Cshen 098. DETAILED DESCRIPTION

[0055] The present invention is further described in detail below through specific examples.

[0056] It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0057] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0058] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0059] Example 1 Development of molecular markers for detecting the genetic sex of Channa fasciatus

[0060] Based on the results of a previous germplasm survey, the collected Channa tangutus germplasm resources were collated and 40 accessions were selected, including 20 female and 20 male samples. The genetic sex of these samples was determined through dissection and gonadal sectioning. The 40 Channa tangutus samples were sent to BGI Biotech Co., Ltd. for paired-end sequencing using the Illumina Xten platform, with a read length of 150 bp and a sequencing depth of 10×.

[0061] The resequencing data for the Channa tangata genome were aligned to the genome sequence of Channa tangata. Based on the sequence alignment results, a sequence segment with differential matches between male and female Channa tangata was identified. High-multiplier sequencing was then used to compare read coverage to identify a specific sequence segment. Based on this sequence, a SNP marker (denoted as SNP Cshen 098) was identified that was closely linked to this sequence segment. This SNP marker is located at 392,098 bp on chromosome 1 of Channa tangata and has a T / G polymorphism.

[0062] SNP locus information of Cshen 098 ( Figure 1 )as follows:

[0063] >C.striata female

[0064] GTGTGTTTCTCCCGGAAGTAAGGGTTTTTACAGTGTGAGCACAGCCTGCTCGATGCAATTTCTGTTTTTAATGCGCATAGCTTCACTGTCGTATGTTTTCTCTGTGAGCTAATGCAGCGTTTTATGGTTTTATGAGAGTACACGTCTTCCTGCAAACTCAAACAAACAACTTAAGGCAAATAATACTGTATAAGAAACATGGCTGTGGTGTGTGCCGCACAGG CCTTCTGGTGGGAAGCCTCGCTCCTAAAGAAAGGAAAAACTCCACACCGTTGACAGCTTAACGGAATAAGAGAAGTT (SEQ ID NO: 1), the bold bases in the sequence are SNP sites.

[0065] >C.striata male

[0066] GTGTGTTTCTCCCGGAAGTAAGGGTTTTTACAGTGTGAGCACAGCCTGCTCGATGCAATTTCTGTTTTTAATGCGCATAGCTTCACTGTCGTATGTTTTCTCTGTGAGCTAATGCAGCGTTTTATGGTTTTATGAGAGTACACGTCTTCCGG CAAACTCAAACAAACAACTTAAGGCAAATAATACTGTATAAGAAACATGGCTGTGGTGTGTGCCGCACAGGCCTTCTGGTGGGAAGCCTCGCTCCTAAAGAAAGGAAAAACTCCACACCGTTGACAGCTTAACGGAATAAGAGAAGTT(SEQ ID NO: 2), the bold bases in the sequence are SNP sites.

[0067] The SNP positions in the sequence were determined based on the publicly released whole genome sequence of Channa striata GCA_033026295.1 (Genome assembly C. striata_1.0).

[0068] Example 2 Design of primer combinations for KSAP detection molecular markers

[0069] In this embodiment, the SNP site obtained in Example 1 was used to search for 150bp of sequence sequence upstream and downstream of the 392098bp position of chromosome 1. The sequence copy number and GC content of this development site were analyzed to ensure that this site met the high success rate of the KASP marker. This site was then designed into a KASP marker, and based on the sequence characteristics of the SNP site, a complete set of KASP primers, ChS900001_K02, was designed for detecting the genotypes of different genetic sexes of the line snakehead. The primer sequences are shown in Table 1, including Primer X, Primer Y, and a reverse primer, wherein the 5' end of the forward primer Primer X carries a FAM fluorescent signal label (underlined in Table 1), and the 5' end of the forward primer Primer Y carries a HEX fluorescent signal label (underlined in Table 1). This primer combination sequence can specifically bind to the corresponding sequence upstream and downstream of the SNP site.

[0070] Table 1 KASP primer sequences

[0071] Primer X 5'-GAAGGTGACCAAGTTCATGCTATGAGAGTACACGTCTTCCT-3'(SEQ ID NO:3) Primer Y 5'-GAAGGTCGGAGTCAACGGATTAGTACACGTCTTCCGGC-3'(SEQ ID NO:4) Reverse primer 5'-AGGCTTCCCACCAGAAGGCCTGTG-3'(SEQ ID NO:5)

[0072] The above primer sequences were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping assay provided by this invention offers high throughput and simple operation. Simply add the specific KASP Primer mix and the universal KASP Master mix to a PCR microwell reaction plate containing a DNA sample and perform PCR amplification. The final results are analyzed using a fluorescence detector.

[0073] The KASP Master mix comprises the following components: universal TRET cassette fluorescent primers, ROX internal reference dye, KlearTaq DNA polymerase, dNTPs and MgCl2. The KASP Master mix is a product of LGC, a UK company, with a catalog number of KBS-1016-002.

[0074] Example 3 Verification of SNP Molecular Markers

[0075] The accuracy of the detection rate was verified using 56 snakehead fish of different genetic sexes, of which 28 were genetically female and 28 were genetically male (Table 2). DNA from the 56 snakehead fish was extracted using the phenol-chloroform method, and KASP primer genotyping was performed using the KASP primer ChS900001_K02 provided in Example 2.

[0076] Table 2 Genetic sex information of snakehead

[0077] Sample number Genetic sex Sample number Genetic sex Sample number Genetic sex Sample number Genetic sex A1 Female, XX A15 Female, XX B1 Male, XY B15 Male, XY A2 Female, XX A16 Female, XX B2 Male, XY B16 Male, XY A3 Female, XX A17 Female, XX B3 Male, XY B17 Male, XY A4 Female, XX A18 Female, XX B4 Male, XY B18 Male, XY A5 Female, XX A19 Female, XX B5 Male, XY B19 Male, XY A6 Female, XX A20 Female, XX B6 Male, XY B20 Male, XY A7 Female, XX A21 Female, XX B7 Male, XY B21 Male, XY A8 Female, XX A22 Female, XX B8 Male, XY B22 Male, XY A9 Female, XX A23 Female, XX B9 Male, XY B23 Male, XY A10 Female, XX A24 Female, XX B10 Male, XY B24 Male, XY A11 Female, XX A25 Female, XX B11 Male, XY B25 Male, XY A12 Female, XX A26 Female, XX B12 Male, XY B26 Male, XY A13 Female, XX A27 Female, XX B13 Male, XY B27 Male, XY A14 Female, XX A28 Female, XX B14 Male, XY B28 Male, XY

[0078] Extracted DNA was diluted to 18–22 ng / μL (preferably 20 ng / μL) and used as a template. Amplification was performed using a 10 μL PCR amplification reaction system, consisting of 5 μL of DNA template, 5 μL of KASP Primer mix (Primer X and Primer Y at 1 μM, reverse primer at 3 μM), and 0.14 μL of KASP Master mix. The PCR reaction program was as follows: 94°C for 15 minutes; 94°C for 20 seconds, followed by 65°C–56°C for 60 seconds, with the annealing and extension temperature decreasing by 0.8°C each cycle, for 10 cycles; and 94°C for 20 seconds, followed by 57°C for 60 seconds, for 30 cycles. PCR amplification products were analyzed for fluorescence signals using ARAYA, and data analysis and genotyping were performed using INTELLICS.

[0079] KASP genotyping results are as follows Figure 2As shown, two genotypes were detected: TT and TG. As shown in the figure, genotypes were determined by detecting the two fluorescent colors and intensities of the KASP product. Each dot in the figure represents a test sample. All samples were divided into red and purple zones, with red dots indicating the homozygous TT genotype and purple dots indicating the heterozygous TG genotype. There were 28 individuals with the TT genotype and 28 with the TG genotype. Statistical analysis of genotype and genetic sex of the snakehead fish was performed (Table 3).

[0080] The genotypes obtained by KASP were compared with the corresponding genetic sex of the snakehead fish to determine the accuracy of the detection. As shown in Table 3, when the genotype detected at this SNP site was TT, 100% of the test results were genetically female, while when the genotype was TG, 100% of the test results were genetically male.

[0081] Therefore, molecular marker typing of Channa tangata using KASP primer ChS900001_K02 can accurately predict its genetic sex, providing a reliable method and basis for sex screening and selection of Channa tangata during the seedling stage, and also laying the foundation for the development of molecular-assisted parthenogenesis breeding technology for Channa tangata.

[0082] Table 3 Results of genetic sex identification of Channa fasciatus based on SNP loci

[0083] Sample number Genetic sex KASP genotype Sample number Genetic sex KASP genotype A1 Female, XX T:T B1 Male, XY T:G A2 Female, XX T:T B2 Male, XY T:G A3 Female, XX T:T B3 Male, XY T:G A4 Female, XX T:T B4 Male, XY T:G A5 Female, XX T:T B5 Male, XY T:G A6 Female, XX T:T B6 Male, XY T:G A7 Female, XX T:T B7 Male, XY T:G A8 Female, XX T:T B8 Male, XY T:G A9 Female, XX T:T B9 Male, XY T:G A10 Female, XX T:T B10 Male, XY T:G A11 Female, XX T:T B11 Male, XY T:G A12 Female, XX T:T B12 Male, XY T:G A13 Female, XX T:T B13 Male, XY T:G A14 Female, XX T:T B14 Male, XY T:G A15 Female, XX T:T B15 Male, XY T:G A16 Female, XX T:T B16 Male, XY T:G A17 Female, XX T:T B17 Male, XY T:G A18 Female, XX T:T B18 Male, XY T:G A19 Female, XX T:T B19 Male, XY T:G A20 Female, XX T:T B20 Male, XY T:G A21 Female, XX T:T B21 Male, XY T:G A22 Female, XX T:T B22 Male, XY T:G A23 Female, XX T:T B23 Male, XY T:G A24 Female, XX T:T B24 Male, XY T:G A25 Female, XX T:T B25 Male, XY T:G A26 Female, XX T:T B26 Male, XY T:G A27 Female, XX T:T B27 Male, XY T:G A28 Female, XX T:T B28 Male, XY T:G

[0084] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. A SNP molecular marker tightly linked to the genetic sex of Channa tanglii, wherein the sequence of the SNP molecular marker is shown in SEQ ID NO:

1. The SNP site is located at position 151 from the 5' end of the sequence shown in SEQ ID NO: 1, and its base is T / G.

2. The SNP marker according to claim 1, wherein When the base is T / T homozygous, the sex of the line fish is female, and when the base is T / G heterozygous, the sex of the line fish is male.

3. KASP primers for amplifying the SNP molecular marker according to claim 1 or 2, comprising a forward primer X, a forward primer Y and a reverse primer; in, The forward primer X contains the nucleotide sequence shown in SEQ ID NO: 6; The forward primer Y contains the nucleotide sequence shown in SEQ ID NO: 7; The nucleotide sequence of the reverse primer is shown in SEQ ID NO:

5.

4. The KASP primer according to claim 3, characterized in that The forward primer X and the forward primer Y contain a tag sequence of a fluorescent group, and the fluorescent groups of the forward primer X and the forward primer Y are different; Preferably, the tag sequence of the fluorescent group is located at the 5' end of the forward primer X and the forward primer Y.

5. The KASP primer according to claim 4, characterized in that The fluorescent group is selected from any one of FAM, HEX, VIC, TAMRA, ROX, Texas-Red, CY5, MGB, BHQ1, BHQ2 and BHQ3.

6. A reagent or kit comprising the KASP primer according to any one of claims 3 to 5; Preferably, the reagent or kit further contains DNA polymerase, dNTP and MgCl2.

7. Use of the SNP molecular marker according to claim 1 or 2, the KASP primer according to any one of claims 3 to 5, or the reagent or kit according to claim 6 in any of the following aspects: 1) Identify the sex of snakehead fish; 2) Molecular marker-assisted breeding related to the sex of Channa tangata; 3) Genotyping of Channa lineata; 4) Construction of DNA fingerprint of Channa lineata; 5) Assisted breeding of snakehead fish; 6) preparing products for assisting breeding of Channa tangata.

8. A method comprising the steps of using the KASP primers according to any one of claims 3 to 5 and the reagent or kit according to claim 6 to detect the SNP molecular marker according to claim 1 or 2 in the genome of a tested Channa fasciatus; The method includes any one of (1) to (4): (1) A method for identifying the sex of snakehead fish; (2) A method for assisted breeding of snakehead fish; (3) A method for genotyping of Channa fasciatus; (4) A method for constructing a DNA fingerprint of snakehead fish.

9. The method according to claim 8, characterized in that The method comprises the following steps: (1) extracting genomic DNA of the tested snakehead; (2) using DNA as a template and performing PCR amplification using the KASP primers described in claim 4 or 5 or the reagent or kit described in claim 6; (3) Analyze the PCR amplification products to obtain the genotype of the SNP molecular marker in the genome of the tested snakehead fish.

10. The method according to claim 9, characterized in that When the genotype is TT, the genetic sex of the tested snakehead fish is female, and when the genotype is TG, the genetic sex of the tested snakehead fish is male.

Citation Information

Patent Citations

  • Molecular marker, primer group, kit and method for identifying sex of ophicephalus obscura

    CN116042856A

  • SNP molecular marker related to genetic sex of oxyeleotris marmorata and application of SNP molecular marker

    CN117925805A

  • KASP molecular marker for identifying sex of channa argus and application of KASP molecular marker

    CN119391871A

  • A method of snake fish extraction

    US20240016854A1