Method for detecting gene mutations using single dntp deletion binding polymerase / ligase reaction
By designing a combination of three probes and two Partzymes, and combining polymerase/ligase reaction with fluorescence signal monitoring of MNAzyme, a highly specific and sensitive detection of gene mutations was achieved, solving the problems of detection specificity and complexity in existing technologies. This method is suitable for liquid biopsy and detection of minimal residual lesions.
Patent Information
- Application Number
- CN202510661786.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2026-02-24
- Estimated Expiration
- 2045-05-22
AI Technical Summary
Existing technologies for detecting gene mutations, especially low-frequency mutations, suffer from poor specificity and complex operation, making it difficult to achieve high sensitivity and high specificity.
A method based on single dNTP deletion combined with polymerase/ligase reaction was adopted. Three probes and two partzymes were designed. Through the specific extension of DNA polymerase and the specific ligation of DNA ligase, combined with the specific recognition of MNAzyme, the fluorescence signal was monitored in real time to achieve real-time quantitative detection of target nucleic acids.
It improves the specificity and sensitivity of gene mutation detection, enabling the detection of DNA concentrations up to 10 aM and distinguishing low-frequency mutations as low as 0.05%, making it suitable for liquid biopsy and detection of minimal residual disease.
Smart Images

Figure CN120442798B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular detection and diagnostic technology, and in particular relates to a method for detecting gene mutations based on a single dNTP deletion combined with polymerase / ligase reaction. Background Technology
[0002] Gene mutations refer to changes at the molecular level of DNA in the genome. They are diverse, including single-base mutations, insertions, and deletions. A significant number of gene mutations are closely linked to human diseases, such as tumors and various hereditary diseases. For example, the JAK2 V617F mutation occurs due to a single nucleotide substitution at position 1849 in exon 14 of the JAK2 gene; the original base G is replaced by T. This change alters the amino acid at position 617 in the encoded JAK2 protein, changing valine (V) to phenylalanine (F). The JAK2 V617F mutation is present in most patients with myeloproliferative cancers (myeloproliferative neoplasms). For example, in polycythemia vera (PV), this mutation can be detected in over 95% of PV cases. In-depth research on gene mutations, especially the determination of low-frequency mutations, can provide powerful tools for liquid biopsy and minimal residual disease (MRD) detection.
[0003] Among the methods for detecting gene mutations, polymerase chain reaction (PCR) and gene sequencing are commonly used. PCR uses polymerase for amplification, offering high sensitivity but lacking specificity. Therefore, PCR is often combined with other reactions to reduce its limitations. For example, amplification of difficult-to-mutate systems using polymerase chain reaction (ARMS-PCR) (Jones AV, et al., 2005) is simple and rapid, but its mutation frequency discrimination is generally only around 0.5%. Polymerase chain reaction-single-strand conformation polymorphism analysis (PCR-SSCP) involves electrophoresis of the amplified products to detect bands, a cumbersome process. Gene sequencing encompasses various types, including first-generation sequencing technologies (such as Sanger sequencing) and second-generation sequencing technologies. While first-generation sequencing can accurately detect DNA sequences, it can only detect about 10% of mutations. Second-generation sequencing can sequence thousands of genes or even the entire genome, enabling simultaneous parallel sequencing of multiple genes. However, second-generation sequencing is more complex in terms of data analysis, and ultra-high-depth sequencing is required to detect low-frequency mutations.
[0004] Therefore, it is necessary to develop a new, highly specific and easy-to-operate method for detecting gene mutations (especially low-frequency mutations). Summary of the Invention
[0005] To address the aforementioned technical problems, this invention provides a method for detecting gene mutations based on a single dNTP deletion combined with a polymerase / ligase reaction. This invention designs three probes and two partzymes based on the mutant target nucleic acid sequence. Using the target DNA nucleic acid as a template, specific extension based on base deletion is performed under the action of DNA polymerase, while a specific ligation reaction occurs under the action of DNA ligase. The two partzymes recognize the ligation product and assemble to form an active MNAzyme cleavage signal probe. The fluorescence signal generated by cleavage is monitored in real time, enabling real-time quantitative detection of the target nucleic acid. This invention is a real-time detection method that combines the specific extension of polymerase and the specific ligation of ligase, thus improving the specificity of the method.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] One objective of this invention is to provide a composition for detecting gene mutations based on a single dNTP deletion binding polymerase / ligase reaction. The composition comprises a probe set and an enzyme system set; the probe set includes nucleic acid probes 1, 2, and 3, and a signal probe; the enzyme system set includes a polymerase, a ligase, and an MNAzyme; wherein:
[0008] The probe 1 is complementary to one strand of the mutant target nucleic acid, the probes 2 and 3 are complementary to the other strand of the target nucleic acid, the probe 3 is complementary to the probe 1, and the probes 2 and 3 are separated by a base.
[0009] The MNAzyme includes Partzyme A and Partzyme B, each containing a target nucleic acid recognition arm, an active center, and a signal probe recognition arm. The target nucleic acid recognition arm is complementary to the probe 1 and its extended sequence, and the signal probe recognition arm is complementary to the signal probe.
[0010] Preferably, the 5ʹ terminal base of the probe 3 is a designed missing dNTP base and is phosphorylated; the probe 2 and the probe 3 are separated by 1-5 bases and cannot contain a missing dNTP base.
[0011] Furthermore, in this invention, the 5ʹ terminal base of probe 3 should not be more prominent than that of probe 1 during the design process.
[0012] Preferably, the active center of the MNAzyme is an 8-17 DNAzyme or a 10-23 DNAzyme.
[0013] Preferably, the ratio of the amount of probe 1, probe 2, probe 3, Partzyme A and Partzyme B is (1-3):(0.8-1.2):(0.8-1.2):(1.8-2.2):(1.8-2.2).
[0014] Preferably, the polymerase is a hot-start DNA polymerase without 5ʹ-3ʹ exonuclease activity; the ligase is a heat-resistant DNA ligase; the signal probe contains RNA bases in the middle, a quenching group is labeled at one end, and a fluorescent group is labeled at the other end or near the middle, with a spacing of less than 20 bp between the fluorescent group and the quenching group.
[0015] A second objective of this invention is to provide the application of the composition in the preparation of gene mutation detection products, wherein the method of using the gene mutation detection products includes the following steps:
[0016] (1) The nucleic acid to be tested and probe 1, probe 2, probe 3, Partzyme A, Partzyme B, signal probe, polymerase, and ligase in the detection product are thoroughly mixed and ligated in a real-time quantitative PCR instrument to carry out ligation and polymerization reactions, so that the target nucleic acid recognition arms of Partzyme A and Partzyme B hybridize with probe 1 and its extended sequence, assemble into MNAzyme and activate its catalytic cleavage activity, cyclically cleave the signal probe hybridized with it, and release the fluorescent signal of the fluorescent group;
[0017] (2) Monitor the fluorescence signal intensity to obtain the real-time amplification curve, establish a standard curve by the relationship between the cycle number and the concentration of the target nucleic acid, and calculate the content of the target nucleic acid based on the cycle number of the target nucleic acid.
[0018] Preferably, the gene mutations detected by the application include the JAK2 V617F gene mutation, the mutation sequences of which are shown in SEQ ID NO.1-SEQ ID NO.2; in step (1), the probe 1 sequence used to detect the JAK2 V617F gene mutation is shown in SEQ ID NO.5, the probe 2 sequence is shown in SEQ ID NO.6, the probe 3 sequence is shown in SEQ ID NO.7, the Partzyme A sequence is shown in SEQ ID NO.8, and the Partzyme B sequence is shown in SEQ ID NO.9.
[0019] Preferably, in step (1), the polymerase used to detect the JAK2 V617F gene mutation includes Hieff UNICON® HotStart Super Specific Taq DNA polymerase, and the ligase includes Hieff® Taq DNA ligase.
[0020] Preferably, in step (1), the polymerase / ligase reaction process for detecting the JAK2 V617F gene mutation is as follows: the mixed solution is transferred into a real-time quantitative PCR instrument, and two cycles are immediately executed. The first cycle is: denaturation at 90-99℃ for 5-30 s, followed by amplification at 58-65℃ for 20-60 s, for 5-30 thermal cycles. The second cycle is: holding at 90-99℃ for 5-30 s, holding at 58-65℃ for 20-60 s, holding at 50℃ for 60 s, and repeating the thermal cycles.
[0021] The application described in this invention also includes a method for detecting gene mutations based on a single dNTP deletion combined with a polymerase / ligase reaction, the method comprising the following steps:
[0022] (1) Based on the sequence of the nucleic acid to be tested, design three probes, namely probe 1, probe 2 and probe 3;
[0023] Among them, probe 1 is complementary to one strand of the target nucleic acid, probe 3 is complementary to probe 1, and the 5ʹ end of probe 3 is phosphorylated. The 3ʹ end of probe 3 and Partzyme B are amino blocked. Probe 2 and 3 are separated by a base.
[0024] (2) Design two parts of MNAzyme: Partzyme A and Partzyme B. Partzyme A and Partzyme B respectively contain a target nucleic acid recognition arm, an active center, and a signal probe recognition arm;
[0025] Among them, the target nucleic acid recognition arm of Partzyme is complementary to probe 1 and its extended sequence, and the signal probe recognition arm of Partzyme is complementary to the signal probe;
[0026] (3) Thoroughly mix the nucleic acid to be tested, probe 1, probe 2, probe 3, Partzyme A, Partzyme B, signal probe, polymerase and ligase, and perform ligase reaction and polymerase reaction in a real-time quantitative PCR instrument;
[0027] In this process, the extension of probe 1 and probe 2 is carried out under the action of DNA polymerase, and the ligation reaction is to ligate probe 2 and probe 3 under the action of DNA ligase to form a long DNA chain.
[0028] Among them, the target nucleic acid recognition arms of Partzyme A and Partzyme B hybridize with probe 1 and its extended sequence, assemble into MNAzyme and activate its catalytic cleavage activity, cyclically cleave the signal probe that it hybridizes with, and release the fluorescent signal of the fluorescent group.
[0029] (4) Monitor the fluorescence signal intensity to obtain the real-time amplification curve, establish a standard curve by the relationship between the cycle number and the concentration of the target nucleic acid, and calculate the content of the target nucleic acid based on the cycle number of the target nucleic acid;
[0030] Preferably, the active center of the MNAzyme in step (2) is 8-17 DNAzyme or 10-23 DNAzyme.
[0031] Preferably, the ratio of the amount of probe 1, probe 2, probe 3, Partzyme A and Partzyme B in step (3) is 1:1:1:2:2.
[0032] Preferably, probes 2 and 3 in step (1) are separated by four bases (TTCT) and the reaction lacks a G base. TTCT originates from... The position of the first T in the direction is the location where the target chain undergoes a mutation, and the polymerization reaction will stop at the first place where a G base is needed.
[0033] Preferably, the signal probe described in step (3) contains RNA bases in the middle, a quenching group is labeled on one end, and a fluorescent group is labeled on the other end or near the middle, with a 16bp interval between the fluorescent group and the quenching group.
[0034] More preferably, the fluorescent group is FAM, VIC, ROX, CY5, HEX, Texas Red, or LightCycler Red640.
[0035] Preferably, the polymerase in step (3) is a hot-start DNA polymerase and the ligase is a heat-resistant DNA ligase.
[0036] Preferably, the DNA polymerase is obtained from a bacterium selected from the group consisting of: Thermus aquaticus (Taq), Thermusthermophiles (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis, Thermus antranildanii, Thermus caldophllus, Thermus chliarophilus, Thermusflavus, Thermus igniterrae, Thermus lacteus, Thermus oshimai, Thermus ruber, Thermus rubens, Thermus scotoductus, Thermus silvanus, Thermus thermophllus, Thermotoga maritima, Thermotoga neapolitana, Thermosipho africanus, Thermococcuslitoralis, Thermococcus barossi, Thermococcus gorgonarius, Thermotoga maritima, Thermotoga neapolitana, Thermosiphoafricanus, Pyrococcus woesei, Pyrococcushorikoshii, Pyrococcus abyssi, Pyrodictium occultum, Aquifexpyrophilus and Aquifexaeolieus.
[0037] More preferably, the DNA polymerase is Taq polymerase;
[0038] Preferably, the hot-start DNA polymerase is Hieff UNICON® HotStart Super Specific Taq DNA polymerase, and the heat-resistant DNA ligase is Hieff® Taq DNA ligase.
[0039] Preferably, the polymerase / ligase reaction process in step (3) is as follows: the mixed solution is quickly transferred into a real-time quantitative PCR instrument and two cycles are immediately executed. The first cycle is: denaturation at 94 °C for 15 s, followed by amplification at 62 °C for 60 s, for a total of 26 thermal cycles. The second cycle is: holding at 94 °C for 15 s, holding at 62 °C for 30 s, holding at 50 °C for 60 s, and repeating the thermal cycles.
[0040] The method for detecting gene mutations based on dGTP-deficient polymerase / ligase reaction in this invention operates on the principle that MNAzyme is composed of two or more oligonucleotides, at least two of which are composed of multiple recognition sequences and are called Partzyme. In the presence of the target nucleic acid, two Partzymes (A and B) self-assemble to form a catalytically active MNAzyme. MNAzyme can simultaneously recognize the target nucleic acid and the signal probe. This invention introduces it into the dGTP-deficient polymerase / ligase reaction as a real-time detection strategy. First, probes 1, 2, and 3 and two Partzymes are designed. Then, through high-temperature denaturation and low-temperature annealing, probe extension and ligation are performed under the action of DNA polymerase and DNA ligase to amplify the target nucleic acid. The Partzyme then binds to the reaction product, assembling to form an MNAzyme with an active center. The MNAzyme can cleave the signal probe to release a fluorescent signal, forming a real-time amplification curve for real-time detection (see schematic diagram). Figure 1 (As shown).
[0041] A third objective of this invention is to provide a gene mutation detection product, which includes the composition or the gene mutation detection product in the application, and its product form includes detection reagents and detection kits.
[0042] Compared with the prior art, the present invention has the following technical effects:
[0043] (1) This invention innovatively combines polymerase reaction and ligase reaction. By designing probes with bases separated by a base (such as TTCT) and lacking dNTPs (such as dGTP) required by the lost-wild template in the system, the polymerase will not extend with the wild template, but only allow the mutant template to complete the polymerization and ligation reactions, thereby enhancing the specific recognition of single-base mutations. This invention designs three probes (probes 1, 2, and 3), among which probes 2 and 3 are deliberately designed with bases separated by a base, and combined with the phosphorylation modification of probe 3, the ligation is completed only when the mutant template is present, which significantly improves the ability to distinguish mutations. Although the missing bases in the prior art may be used to block extension, this invention combines them with the ligation reaction and MNAzyme to achieve highly specific mutation detection, which is an inventive combination.
[0044] (2) This invention cleverly combines polymerization, ligation, and MNAzyme reactions. Specific extension is performed under the action of DNA polymerase, while specific ligation is performed under the action of DNA ligase. Combined with the specific recognition of MNAzyme, this greatly improves the specificity of the detection method, enabling it to effectively distinguish single-base differences. The highly sensitive polymerization / ligation reaction in this invention is carried out simultaneously with MNAzyme, allowing for simultaneous amplification and detection, and simplifying the operation. Very low-frequency DNA mutations can be detected during the reaction, making it suitable for quantitative detection of mutant DNA. By simultaneously utilizing polymerase extension and ligase ligation, this invention achieves dual specificity verification (extension termination + ligation verification) in a single reaction system, significantly reducing false positives.
[0045] (3) The detection sensitivity of this invention reaches 10 aM and can distinguish low-frequency mutation ratios of 0.05%, which is more advantageous in clinical applications (such as liquid biopsy and detection of minimal residual lesions). Therefore, this invention will provide a new approach for real-time detection with good specificity for nucleic acid detection. Attached Figure Description
[0046] Figure 1 This is a schematic diagram illustrating the principle of gene mutation detection based on the dGTP-binding polymerase / ligase reaction in this invention.
[0047] Figure 2 This is an amplification curve diagram of different enzymes present in the verification experiment of Example 1 of the present invention, wherein: Figure 2 a) indicates that polymerase and ligase are present simultaneously; Figure 2 b indicates that only ligase is present; Figure 2 c indicates that only polymerase is present.
[0048] Figure 3 The sensitivity detection result in Embodiment 1 of the present invention is shown below, wherein: Figure 3 a is a graph showing the relationship between △Fl and the cycle number; Figure 3 b is C T The value shows a linear relationship with the logarithm of the sample concentration.
[0049] Figure 4 The following describes the effects of different probe ratios in Example 1 of the present invention, wherein: a. 10: 20: 20: 20: 20; b. 20: 20: 20: 40: 40; c. 40: 20: 20: 80: 80; d. 60: 20: 20: 120: 120 (nM).
[0050] Figure 5 This is a specific amplification curve used in Example 1 of the present invention to evaluate the ability to distinguish single base differences.
[0051] Figure 6The verification results of the method in Example 1 of this invention can be used for quantitative determination of base mutations, wherein: Figure 6 a is the amplification curve of JAK mut and JAK wild at different ratios; Figure 6 b is the logarithm of the ratio of JAK mut to JAK wild and its C T A graph showing the relationship between values. Detailed Implementation
[0052] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of the invention. The reagents, products, instruments, etc., used in the following examples are all commercially available, and the methods used in the examples, unless otherwise specified, are consistent with conventionally used methods.
[0053] The technical solution of the present invention will be further described in detail below with reference to the embodiments.
[0054] Example 1
[0055] This embodiment provides a method for detecting JAK2 V617F gene mutations based on the deletion of dGTP-binding polymerase / ligase reaction. The nucleic acid sequences used are shown in Table 1, and the method specifically includes the following steps:
[0056] Table 1 Nucleic Acid Sequence Details
[0057] name sequence JAK-mut ACAAGCATTTGGTTTTAAATTATGGAGTATGTTTCTGTGGAGACGAGAGTAAGTAAAAC (SEQ ID NO.1) JAK-mut-c GTTTTACTTACTCTCGTCTCCACAGAAACATACTCCATAATTTAAAACCAAATGCTTGT (SEQ ID NO.2) JAK-wild ACAAGCATTTGGTTTTAAATTATGGAGTATGTGTCTGTGGAGACGAGAGTA (SEQ ID NO.3) JAK-wild-c GTTTTACTTACTCTCGTCTCCACAGACACATACTCCATAATTTAAAACCAAATGCTTGT (SEQ ID NO.4) Probe 1 TTTTACTTACTCTCGTCTCCACAG (SEQ ID NO.5) Probe 2 ATTTGGTTTTAAATTATGGAGTATGT (SEQ ID NO.6) Probe 3 P-GTGGAGACGAGAGTAAGTAAAA-NH2C6 (SEQ ID NO.7) Partzyme A TTTTAAATTATGGAGTATGTTACAACGAGAGGAAGCCT (SEQ ID NO.8) Partzyme B TGCCACAGGGAGGCTAGCTTCTGTGGAGACGAGA-NH2C6 (SEQ ID NO.9) signal probe AGGCTT(FAM)CCTC / rG / / rU / CCCTGTGGCA-BHQ1 (SEQ ID NO.10)
[0058] Note: In JAK-mut and JAK-mut-c, the underlined bases are single-base differential sites; P in probe 3 indicates phosphorylation modification; in Partzyme, the single-underlined base is a sensing arm that hybridizes complementaryly with probe 1 and its extended sequence; italicized text indicates active regions; double-underlined markings indicate signal probe recognition arms; in the signal probe, T(FAM) is a T base modified with the FAM group; and BHQ1 is a quenching group modification. Also: Because in NIPO ST.26, "T" represents uracil in the RNA sequence and thymine in the DNA sequence, the "U" in the above sequences was converted to "T" during fabrication.
[0059] 1. Experimental Methods 1.1 Target Strain Hybridization
[0060] A 10 μL hybridization system was prepared by mixing 1 μL of 10 μM JAK-mut, 1 μL of 10 μM JAK-mut-c, and 8 μL of STE buffer (100 mM NaCl, 10 mM Tris-HCl (pH 8), 1 mM EDTA (pH 8)). The entire process was performed on an ice plate to maintain a low-temperature environment. The mixture was then transferred to a preheated 2720 PCR instrument (thermal cycler) and denatured at 95°C for 5 min, followed by hybridization at 25°C for 20 min. The mixture was then stored at -20°C for later use. Wild-type JAK and wild-type JAK-c were prepared as control groups using the same method (high concentrations of the reaction product can be prepared and stored at -20°C for short periods).
[0061] 1.2 Detection of JAK2 V617F gene mutation based on dGTP-deleted polymerase / ligase reaction
[0062] The reaction was carried out in a 10 μL system containing 1 μL Ampligase® Buffer (10×) (200 mM Tris-HCl, 250 mM KCl, 100 mM MgCl2, 5 mM NAD, 0.1% Triton, pH 8.3, 25℃), 0.3 μL MgCl2 (100 mM), 0.2 μL Probe 1 (1 μM), 0.2 μL Probe 2 (1 μM), 0.2 μL Probe 3 (1 μM), 0.4 μL Part A (1 μM), 0.4 μL Part B (1 μM), 0.5 μL dCTP (100 μM), 0.5 μL dATP (100 μM), 0.5 μL dTTP (100 μM), 1 μL Signal Probe (2 μM), 0.15 μL RNAsin® Plus RNase Inhibitor (40 U / μL), and 0.125 μL of other reagents. Add 0.2 μL Hieff® Taq DNA Ligase (40 U / μL), 0.2 μL Hieff UNICON® HotStartSuper Specific Taq DNA polymerase (0.5 U / μL), and then add 1 μL of DNA of different concentrations hybridized according to step 1.1 (including blank experiments without the target analyte). Make up the remainder with RNase-free water. Mix thoroughly (all operations are performed on an ice plate). Finally, quickly transfer the mixture to a real-time quantitative PCR instrument and immediately perform two cycles. Phase 1: Denature at 94℃ for 15 s, cool to 62℃ for 60 s for amplification, repeating this cycle 26 times. Phase 2: Hold at 94℃ for 15 s, 62℃ for 30 s, and 50℃ for 60 s, repeating this cycle 60 times. Acquire fluorescence signals at 50℃.
[0063] 1.3 Data Processing
[0064] The relationship between cycle number and fluorescence (Fl) was obtained using FAM fluorescence signals. The initial slow upward trend of the amplification curve represents the substrate signal caused by the signal probe. To subtract the substrate signal, a linear relationship between Fl during the slow upward phase of the amplification curve and the cycle number was obtained, and the substrate Fl value was calculated for different cycle numbers. The difference between the Fl value and the substrate Fl value was linearly fitted to the cycle number to obtain the relationship between ΔFl and the cycle number. Finally, a threshold was defined, and the intersection of the threshold and the amplification curve was taken as C. T Value, Analysis of C T The relationship between the value and the concentration of the target substance.
[0065] 1.4 Evaluation of the ability to distinguish single base differences
[0066] Add a mixture of JAK2 V617F with different mutation frequencies to a 10 μL system, with a total volume of 100 fM. The mutation frequencies are 0%, 0.05%, 0.5%, 5%, 50%, and 100%, respectively. The remaining reagents, dosages, and procedures are performed in accordance with section 1.2.
[0067] 1.5 Cell Culture and DNA Extraction
[0068] Human erythroleukemia cells (HEL) were placed in 1940 (BIOFIL) medium containing 10% (v / v) fetal bovine serum (FBS), 100 U / mL penicillin, and 100 μg / mL streptomycin. The medium was incubated at 37°C in a carbon dioxide incubator containing 5% CO2. DNA was extracted from the cells using a DNA extraction kit (TIANGEN) according to the manufacturer's instructions. The extracted DNA samples were quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). The quantified DNA samples were stored at -20°C for subsequent actual sample testing.
[0069] 2. Feasibility Verification
[0070] To verify the feasibility of the method of the present invention, this embodiment first tested the signals in the presence of different enzymes, such as... Figure 2 As shown, a signal is generated only when both DNA ligase and hot-start DNA polymerase (without 5ʹ→3ʹ polymerase activity) are present simultaneously. At this time, the C100 fM sample... T The value is much smaller than the blank C. T The values clearly distinguish between the two. Neither the blank nor the sample showed a signal when only DNA ligase or only hot-start DNA polymerase was present. This demonstrates that the chain reaction and amplification can only occur when both DNA ligase and hot-start DNA polymerase are present simultaneously, proving the feasibility of the method's design.
[0071] 3. Sensitivity Testing
[0072] In this embodiment, standard curves were determined using different concentrations of DNA double-stranded DNA as target sequences, and the sensitivity of the experiment was tested. Figure 3 As shown in figure a, as the target DNA concentration increases from 10 aM to 100 fM, the corresponding C T The value is constantly decreasing, with the logarithm of the sample concentration as the abscissa, C T Plotting the values on the ordinate yields... Figure 3 b, Figure 3 b indicates the C corresponding to each sample within the concentration range of 10 aM - 100 fM. TThe value shows a good linear relationship with the logarithm (lgC) of the sample concentration, and the linear equation is: C T =-52.35-4.53 lgC, correlation coefficient is R 2 = 0.9997. We also performed parallel real-time fluorescence curve analysis on 10 fM target DNA seven times, calculating a relative standard deviation (RSD) of 6.92%, indicating that this method has good reproducibility.
[0073] 4. The effect of different probe ratios
[0074] Different probe ratios (probe 1:probe 2:probe 3:partzyme A:partzyme B) will affect the reaction efficiency and sensitivity of the invention. This embodiment tested four ratios. The specific experimental conditions are as follows:
[0075] Signal probe: 200 nM; Ampligase® Buffer 1×; MgCl2 3 mM; dCTP, dATP, dTTP: 5 μM; RNAsin®Plus RNase Inhibitor 0.6 U / μL; Hieff® Taq DNA Ligase 0.5 U / μL; HieffUNICON® HotStart Super Specific Taq DNA polymerase 0.01 U / μL; Probe 1: Probe 2: Probe 3: 20 nM; Partzyme A and Partzyme B are respectively 10: 20: 20: 20: 20 nM (group a), 20: 20: 20: 40: 40 nM (group b), 40: 20: 20: 80: 80 nM (group c), 60: 20: 20: 120: 120 nM (group d) (The concentrations of each reagent are the final concentrations in a 10 μL reaction volume). Procedure: 94℃ / 15 s, 62℃ / 60 s, 26 cycles; 94℃ / 15 s, 62℃ / 30 s, 50℃ / 60 s, 60 cycles. Three parallel measurements were performed.
[0076] like Figure 4 As shown, when the probe ratio is 10:20:20:20:20, the amount of probe 1 used is less than that of probe 2 and probe 3, resulting in insufficient probe 1 extension products and ineffective assembly of Partzyme A / Partzyme B, thus failing to form an amplification curve. However, an effective amplification curve can be formed when the probe ratio is 20:20:20:40:40. Further changes in the probe ratio to 40:20:20:80:80 or even 60:20:20:120:120 resulted in variations in the blank and sample C. TThe values gradually increased, which may be due to the greater difference in the ratio of probe 2 and probe 3 to probe 1, resulting in a decrease in amplification efficiency. However, they can still be distinguished well, but the time is longer.
[0077] 5. Evaluation of the ability to distinguish differences between single bases
[0078] To evaluate the ability of this invention to distinguish single-base differences, a JAK wild DNA differing from the target DNA by only one base was introduced. The specific experimental conditions are as follows:
[0079] Probe 1, Probe 2, Probe 3: 20 nM; Partzyme A, Partzyme B: 40 nM; Signal probe: 200 nM; Ampligase® Buffer 1×; MgCl2 3 mM; dCTP, dATP, dTTP: 5 μM; RNAsin® Plus RNase Inhibitor 0.6 U / μL; Hieff® Taq DNA Ligase 0.5 U / μL; Hieff UNICON® HotStartSuper Specific Taq DNA polymerase 0.01 U / μL (all reagent concentrations are final concentrations in a 10 μL reaction volume). Program: 94℃ / 15 s, 62℃ / 60 s, 26 Cycles; 94℃ / 15 s, 62℃ / 30 s, 50℃ / 60 s, 60 Cycles. Three parallel assays were performed.
[0080] from Figure 5 It can be seen that when a mutated base is present, the cycle number of wild-type DNA is similar to that of the blank group and much greater than that of the mutated DNA, indicating that the method has good specificity and can be used to distinguish single-base differences in DNA sequences.
[0081] This invention further uses JAK mut and JAK wild in different proportions as samples, with a total amount of 100 fM, and the mutant JAK mut content being 0%, 0.05%, 0.5%, 5%, 50%, and 100%, respectively, for reaction. Figure 6 As shown in Figure a, as the proportion of JAK mut increases, its C T The value is constantly decreasing, C T The value shows a good linear relationship with the logarithm of the mutation rate, and the regression equation is: C T =19.14-5.34 lgMR (MR is the Mutation Ratio, R 2 = 0.9948). The above results indicate that the present invention can be used for the quantitative determination of base mutations.
[0082] 5. Spike recovery of actual samples
[0083] To evaluate the effectiveness of this invention on actual samples, a spiked recovery method was used to determine the DNA of human erythroleukemia cells (HEL). The results are shown in Table 2.
[0084] Table 2 Results of spiked recovery experiments on actual samples (n=3)
[0085] Sample Recovery (%) RSD (%) 10 ng + 10 fM 96.4 8.56 10 ng + 20 fM 98.4 1.17 20 ng + 10 fM 86.7 7.84 20 ng + 20 fM 87.2 6.30
[0086] As shown in Table 2, the recovery rate of this invention is between 86.7% and 98.4%, and the relative standard deviation (RSD) is between 1.17% and 8.56%, which confirms that this invention can effectively determine the cellular DNA content and its effectiveness in detecting actual samples.
[0087] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A composition for detecting gene mutations based on a single dNTP deletion combined with a polymerase / ligase reaction, characterized in that, The composition comprises a probe set and an enzyme system set; the probe set includes nucleic acid probes 1, 2, and 3, and a signal probe; the enzyme system set includes polymerase, ligase, and MNAzyme; wherein: The probe 1 is complementary to one strand of the mutant target nucleic acid, the probes 2 and 3 are complementary to the other strand of the target nucleic acid, the probe 3 is complementary to the probe 1, and the probes 2 and 3 are separated by a base. The MNAzyme includes Partzyme A and Partzyme B, wherein Partzyme A and Partzyme B respectively contain a target nucleic acid recognition arm, an active center and a signal probe recognition arm, wherein the target nucleic acid recognition arm is complementary to the probe 1 and its extended sequence, and the signal probe recognition arm is complementary to the signal probe. The 5ʹ terminal base of probe 3 is a designed missing dNTP base and is modified by phosphorylation; probe 2 and probe 3 are separated by 1-5 bases and cannot contain a missing dNTP base.
2. The composition according to claim 1, characterized in that, The active center of the MNAzyme is either an 8-17 DNAzyme or a 10-23 DNAzyme.
3. The composition according to claim 2, wherein the concentration ratio of probe 1, probe 2, probe 3, Partzyme A and Partzyme B is (1-3):(0.8-1.2):(0.8-1.2):(1.8-2.2):(1.8-2.2).
4. The composition according to claim 3, characterized in that, The polymerase is a hot-start DNA polymerase without 5ʹ-3ʹ exonuclease activity; the ligase is a thermostable DNA ligase; the signal probe contains RNA bases in the middle, a quenching group is labeled at one end, and a fluorescent group is labeled at the other end or near the middle, with a spacing of less than 20 bp between the fluorescent group and the quenching group.
5. The use of the composition according to any one of claims 1-4 in the preparation of gene mutation detection products, characterized in that, In the application described, the method of using the gene mutation detection product includes the following steps: (1) The nucleic acid to be tested and probe 1, probe 2, probe 3, Partzyme A, Partzyme B, signal probe, polymerase and ligase in the detection product are thoroughly mixed and ligated in a real-time quantitative PCR instrument to carry out ligation and polymerization reactions, so that the target nucleic acid recognition arms of Partzyme A and Partzyme B hybridize with probe 1 and its extended sequence, assemble into MNAzyme and activate its catalytic cleavage activity, cyclically cut the signal probe hybridized with it, and release the fluorescent signal of the fluorescent group; (2) Monitor the fluorescence signal intensity to obtain the real-time amplification curve, establish a standard curve by the relationship between the cycle number and the concentration of the target nucleic acid, and calculate the content of the target nucleic acid based on the cycle number of the target nucleic acid.
6. The application according to claim 5, characterized in that, The gene mutations detected by the application include the JAK2V617F gene mutation, the mutation sequences of which are shown in SEQ ID NO.1-SEQ ID NO.2; in step (1), the probe 1 sequence used to detect the JAK2 V617F gene mutation is shown in SEQ ID NO.5, the probe 2 sequence is shown in SEQ ID NO.6, the probe 3 sequence is shown in SEQ ID NO.7, the Partzyme A sequence is shown in SEQ ID NO.8, and the Partzyme B sequence is shown in SEQ ID NO.
9.
7. The application according to claim 6, characterized in that, In step (1), the polymerase used to detect the JAK2V617F gene mutation includes HotStart Super Specific Taq DNA polymerase, and the ligase includes Taq DNA ligase.
8. The application according to claim 7, characterized in that, In step (1), the polymerase / ligase reaction process for detecting the JAK2V617F gene mutation is as follows: the mixed solution is transferred into a real-time quantitative PCR instrument and two cycles are immediately executed. The first cycle is: denaturation at 90-99℃ for 5-30 s, followed by amplification at 58-65℃ for 20-60 s, for 5-30 thermal cycles. The second cycle is: holding at 90-99℃ for 5-30 s, holding at 58-65℃ for 20-60 s, holding at 50℃ for 60 s, and repeating the thermal cycle.
9. A gene mutation detection product, characterized in that, It includes the composition according to any one of claims 1-4, and its product form includes detection reagents and detection kits.
Citation Information
Patent Citations
Method for detecting mononucleotide variation by positioning probe mediated shear trigger index amplification based on triple recognition
CN117286221A
Method for preparing single-stranded circular DNA (Deoxyribose Nucleic Acid) by utilizing self-ligation of intrachain nucleic acid and application
CN118685493A