Molecular marker of mrc1 gene related to white spot syndrome virus resistance in penaeus vannamei and detection primer and application thereof

Abstract

The application discloses a MRC1 gene molecular marker related to a white shrimp anti- hepatoparasite disease trait, a detection primer and an application thereof, and has the characteristics that the molecular marker A nucleotide sequence is shown in SEQ ID NO. 1, the 759th base is mutated as T>C, and the dominant genotype is A / C heterozygosis; the nucleotide sequences of molecular markers B, C and D are shown in SEQ ID NO. 2, the 332th base is mutated as T>A, the dominant genotype is A / A homozygosis, the 711th base is mutated as T>A, the dominant genotype is T / T homozygosis, and the 972th base is mutated as G>A, the dominant genotype is G / A heterozygosis; the nucleotide sequence of the molecular marker E is shown in SEQ ID NO. 3, the 99th base is mutated as C>T, and the dominant genotype is C / T heterozygosis; and the application has the advantages of good breeding efficiency and accuracy.

Description

Technical Field

[0001] This invention belongs to the field of Litopenaeus vannamei breeding technology, specifically relating to a molecular marker of the MRC1 gene related to resistance to enterocytozoonosis in Litopenaeus vannamei, its detection primers, and applications. Background Technology

[0002] Litopenaeus vannamei ( Penaeus vannamei As the world's largest farmed shrimp species, shrimp plays a vital role in the fisheries industry in terms of scale and economic value. However, with the widespread adoption of high-density intensive farming methods, frequent shrimp diseases have become a core issue restricting the sustainable development of the industry. Among these, hepatocellular carcinoma (HEC) is a significant concern. Enterocytozoon hepatopenaei Hepatopancreatic microsporidiasis caused by *E. hepatisimilaria* (EHP) is highly insidious, destructive, and difficult to control, resulting in significant losses for the Litopenaeus vannamei aquaculture industry. EHP infection can lead to atrophy of the hepatopancreatic ducts, reduced feed conversion ratio, and increased susceptibility to other diseases. Currently, EHP prevention and control mainly rely on improving the aquaculture environment and strengthening feed management, but this requires substantial investment of manpower, resources, and capital, and its effectiveness is influenced by various factors, making it difficult to fundamentally solve the EHP infection problem. Therefore, developing new Litopenaeus vannamei varieties with EHP resistance has become an urgent need for the industry's development.

[0003] The macrophage mannose receptor 1 (MRC1) gene is an important immune-related gene, and the protein it encodes plays a crucial role in the body's recognition and clearance of pathogens. Previous studies have shown that polymorphisms in the MRC1 gene are associated with disease resistance traits in various aquatic animals.

[0004] With breakthroughs in molecular biology techniques, marker-assisted breeding systems based on genetic markers have demonstrated significant advantages. Among these, single nucleotide polymorphism (SNP) markers, due to their core advantages such as large-scale parallel detection, high genome coverage density, and compatibility with automated analysis platforms, have become a crucial technological support for achieving precise and efficient genetic improvement. In Litopenaeus vannamei breeding, SNP markers have been successfully applied, reporting molecular markers associated with traits such as ammonia nitrogen tolerance, nitrate tolerance, and resistance to hepatopancreatic necrosis. However, due to the complexity of shrimp population genetic structure, existing markers are insufficient to cover most strains, and there is a lack of SNP markers associated with resistance to Enterocytozoa hepatisimilaria for genetic trait assessment and genomic selection analysis. Summary of the Invention

[0005] The technical problem to be solved by this invention is to provide a molecular marker for the MRC1 gene associated with resistance to enterocytozoonosis in Litopenaeus vannamei, along with its detection primers and applications. This invention enables rapid, accurate, and effective detection of disease-resistant individuals in Litopenaeus vannamei using SNP marker amplification primers, with good breeding efficiency and accuracy.

[0006] The technical solution adopted by the present invention to solve the above-mentioned technical problems is as follows: a molecular marker for the MRC1 gene related to the resistance of Litopenaeus vannamei to enterocytozoonosis, including at least one of molecular marker A, molecular marker B, molecular marker C, molecular marker D and molecular marker E;

[0007] The molecular marker A is named MRC1-759, and its nucleotide sequence is shown in SEQ ID NO.1. The mutation type at the 759th base is A>C.

[0008] The molecular marker B is named MRC1-1469, and its nucleotide sequence is shown in SEQ ID NO.2. The mutation type at the 332nd base is T>A.

[0009] The molecular marker C is named MRC1-1848, and its nucleotide sequence is shown in SEQ ID NO.2. The mutation type at the 711th base is T>A.

[0010] The molecular marker D is named MRC1-2109, and its nucleotide sequence is shown in SEQ ID NO.2. The mutation type at the 972nd base is G>A.

[0011] The molecular marker E is named MRC1-2243, and its nucleotide sequence is shown in SEQ ID NO.3, with a mutation type of C>T at the 99th base.

[0012] This invention also provides detection primers for the above-mentioned MRC1 gene molecular marker, wherein the primer pair for detecting the molecular marker A is:

[0013] The sequence of the forward primer F1 is ATGTCACAGTTGCCATGCTATG.

[0014] The sequence of the reverse primer R1 is CAACTTCCACAAACTGCGAAGGC;

[0015] The primer pairs for detecting the molecular markers B, C, and D are:

[0016] The sequence of the forward primer F2 is GAGCCAGGCCTCATGTTCATTAC.

[0017] The sequence of the reverse primer R2 is GGGACAGACTCTCCTGTGGTGTA;

[0018] The primer pair for detecting the molecular marker E is:

[0019] The sequence of the forward primer F3 is ATATAGCAGCCCATAGTTTCTGGCT.

[0020] The sequence of the reverse primer R3 is TCCTTGGTAGACACACAGAGGG.

[0021] The present invention also provides the application of the detection primers for the MRC1 gene molecular marker related to the above-mentioned resistance to enterocytozoonosis in Litopenaeus vannamei in screening Litopenaeus vannamei parents resistant to enterocytozoonosis.

[0022] Furthermore, the application is as follows: if the parent Litopenaeus vannamei is found to have the AC genotype at the MRC1-759 locus, the AA genotype at the MRC1-1469 locus, the TT genotype at the MRC1-1848 locus, the GA genotype at the MRC1-2109 locus, and the CT genotype at the MRC1-2243 locus, then it is selected as a parent resistant to enterocytozoonosis in shrimp.

[0023] Furthermore, the specific steps are as follows:

[0024] Step 1: Extract genomic DNA from the muscle tissue of Litopenaeus vannamei to be tested;

[0025] Step 2: Using the extracted DNA as a template, perform PCR amplification using the detection primers for the 5 SNP markers, and then sequence the obtained PCR amplification products to determine the genotypes of molecular markers A, B, C, D and E.

[0026] Step 3: When the genotype of molecular marker A is the dominant genotype AC, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker B is the dominant genotype AA, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker C is the dominant genotype TT, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker D is the dominant genotype GA, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker E is the dominant genotype CT, select this individual as a backup parent for Litopenaeus vannamei breeding.

[0027] Compared with existing technologies, the advantages of this invention are as follows: This invention relates to the MRC1 gene molecular markers associated with resistance to Enterocytozoon hepaticis in Litopenaeus vannamei, along with their detection primers and applications. Based on screening the MRC1 gene of Litopenaeus vannamei, SNP molecular markers associated with Enterocytozoon hepaticis are obtained. These SNP molecular markers are used as functional markers for the Enterocytozoon hepaticis resistance trait in Litopenaeus vannamei, and are applied to the breeding of Litopenaeus vannamei varieties with good resistance to Enterocytozoon hepaticis. It can be applied to the breeding of new Litopenaeus vannamei varieties resistant to Enterocytozoon hepaticis, and the bred individuals have stable genotypes and do not undergo genetic differentiation. Furthermore, the method of this invention has good breeding efficiency and accuracy, providing a solid foundation for the cultivation and improvement research of Litopenaeus vannamei varieties. Attached Figure Description

[0028] Figure 1 These are partial sequences of the products obtained from amplifying the MRC1 gene in the examples. 'a' represents positions 757-761 of amplified product 1, showing the peak values ​​of AA, CC, and AC at the MRC1-759 A>C site; 'b' represents positions 320-334 of amplified product 2, showing the peak values ​​of TT, AA, and TA at the MRC1-1469 T>A site; 'c' represents positions 769-713 of amplified product 2, showing the peak values ​​of TT, AA, and TA at the MRC1-1848 T>A site; 'd' represents positions 970-974 of amplified product 2, showing the peak values ​​of GG, AA, and GA at the MRC1-2109 G>A site; and 'e' represents positions 97-101 of amplified product 3, showing the peak values ​​of CC, TT, and CT at the MRC1-2243 C>T site. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Specific experimental conditions and methods not specified in the following embodiments are generally conventional methods well known to those skilled in the art.

[0030] The screening process for the MRC1 gene molecular markers associated with resistance to enterocytozoonosis in Litopenaeus vannamei is as follows:

[0031] Step 1, Experimental Animals:

[0032] Four hundred Litopenaeus vannamei shrimp weighing approximately 3 grams were selected and temporarily reared for 7 days. Then, Litopenaeus vannamei shrimp infected with EHP were introduced into the shrimp rearing tank for artificial EHP infection. Subsequently, they were fed ordinary feed, and the rearing period lasted for two months. The final weight of the Litopenaeus vannamei shrimp was recorded. One hundred shrimp with a final weight greater than 8 grams and one hundred shrimp with a final weight less than 6 grams were selected as samples for the Litopenaeus vannamei shrimp susceptible group and the Litopenaeus vannamei shrimp tolerant group, respectively.

[0033] Step 2, Experimental Method

[0034] 2.1 Initial screening of MRC1 gene molecular markers

[0035] Muscle tissue was extracted from Litopenaeus vannamei in both the sensitive and tolerant groups. Genomic DNA was extracted using the TIANGEN Marine Animal Tissue Genomic DNA Kit and stored at -20°C for later use. SNP marker A was located in the second exon region of the MRC1 gene, molecular marker B in the fourth exon region, molecular marker C in the fourth exon region, SNP marker D in the fifth intron region, and molecular marker E in the sixth intron region.

[0036] 2.2 Primer design and amplification

[0037] Using Litopenaeus vannamei MRC1 genome data (LOC113819957) in the NCBI database as a reference, a partial fragment of the MRC1 gene was amplified, and primers F1, R1, F2, R2, F3 and R3 were designed. Then, SNP sites located in the MRC1 gene were amplified and screened.

[0038] The sequence of the forward primer F1 is: ATGTCACAGTTGCCATGCTATG;

[0039] The sequence of the reverse primer R1 is: CAACTTCCACAAACTGCGAAGGC;

[0040] The sequence of the forward primer F2 is: GAGCCAGGCCTCATGTTCATTAC;

[0041] The sequence of reverse primer R2 is: GGGACAGACTCTCCTGTGGTGTA;

[0042] The sequence of the forward primer F3 is: ATATAGCAGCCCATAGTTTCTGGCT;

[0043] The sequence of reverse primer R3 is: TCCTTGGTAGACACACAGAGGG;

[0044] PCR amplification system 1 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F1, 1 μL of primer R1, and 1 μL of DNA template.

[0045] PCR amplification system 2 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F2, 1 μL of primer R2, and 1 μL of DNA template.

[0046] PCR amplification system 3 consists of the following components: 25 μL of 2×TransStar FastPfu Fly PCRSuperMix, 22 μL of ddH2O, 1 μL of primer F3, 1 μL of primer R3, and 1 μL of DNA template.

[0047] The reaction procedures for PCR1, PCR2, and PCR3 amplification described above all include the following steps:

[0048] S1. Pre-denaturate at 98℃ for 1 min;

[0049] S2. Denature at 98℃ for 10s, anneal at 60℃ for 5s, extend at 72℃ for 30s, for 34 cycles;

[0050] S3, extend at 72℃ for 5 minutes.

[0051] The PCR amplification products were purified and sequenced after detection by 1wt% agarose gel electrophoresis. Geneiousprime software was used to perform comparative analysis of the sequencing results, including nucleotide sequence alignment and peak analysis. Figure 1

[0052] The nucleotide sequence of PCR amplification product 2 is shown in SEQ ID NO.2:

[0053]

[0054] The nucleotide sequence of PCR amplification product 3 is shown in SEQ ID NO. 3:

[0055]

[0056] Step 4: Based on the selected SNPS loci, Litopenaeus vannamei in the sensitive and tolerant groups were tested and genotyped according to the above method. The samples of different SNP loci in the sensitive and tolerant groups were counted, the genotype frequency and allele frequency were calculated, and the independence test was performed by chi-square analysis. The results of the chi-square analysis are shown in Table 1.

[0057] Table 1. Chi-square analysis results of MRC1 gene molecular marker sites

[0058]

[0059] Analysis of Table 1 shows that the dominant genotype for molecular marker A is AC, for molecular marker B it is AA, for molecular marker C it is TT, for molecular marker D it is GA, and for molecular marker E it is CT. When molecular marker A is A / C heterozygous, molecular marker B is A / A homozygous, molecular marker C is T / T homozygous, molecular marker D is G / A heterozygous, and molecular marker E is C / T heterozygous, this individual is selected as a backup parent for Litopenaeus vannamei breeding. The molecular markers provided by this invention are closely related to EHP resistance, significantly improving breeding efficiency and accuracy, and providing key technical support for the breeding of disease-resistant Litopenaeus vannamei varieties.

[0060] The above description is not intended to limit the present invention, nor is the present invention limited to the specific embodiments described above. Any modifications, equivalent substitutions, or improvements made by those skilled in the art without departing from the spirit of the present invention should be included within the scope of protection of the present invention.

Claims

1. The application of a primer for detecting the MRC1 gene molecular marker associated with resistance to enterocytozoonosis in Litopenaeus vannamei in screening Litopenaeus vannamei parents resistant to enterocytozoonosis, characterized in that... Including molecular marker A, molecular marker B, molecular marker C, molecular marker D, and molecular marker E; The molecular marker A is named MRC1-759, and its nucleotide sequence is shown in SEQ ID NO.

1. The mutation type at the 759th base is A > C. The molecular marker B is named MRC1-1469, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 332nd base is T>A. The molecular marker C is named MRC1-1848, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 711th base is T>A. The molecular marker D is named MRC1-2109, and its nucleotide sequence is shown in SEQ ID NO.

2. The mutation type at the 972nd base is G>A. The molecular marker E is named MRC1-2243, and its nucleotide sequence is shown in SEQ ID NO.

3. The mutation type at the 99th base is C>T.

2. The application according to claim 1, characterized in that... The specific primers for detecting the MRC1 gene molecular marker are as follows, and the primer pair for detecting molecular marker A is: The sequence of the forward primer F1 is ATGTCACAGTTGCCATGCTATG. The sequence of the reverse primer R1 is CAACTTCCACAAACTGCGAAGGC; The primer pairs for detecting the molecular markers B, C, and D are: The sequence of the forward primer F2 is GAGCCAGGCCTCATGTTCATTAC. The sequence of the reverse primer R2 is GGGACAGACTCTCCTGTGGTGTA; The primer pair for detecting the molecular marker E is: The sequence of the forward primer F3 is ATATAGCAGCCCATAGTTTCTGGCT. The sequence of the reverse primer R3 is TCCTTGGTAGACACACAGAGGG.

3. The application according to claim 2, characterized in that... The application is as follows: if the parent shrimp of Litopenaeus vannamei are found to have the AC genotype of MRC1-759, the AA genotype of MRC1-1469, the TT genotype of MRC1-1848, the GA genotype of MRC1-2109, and the CT genotype of MRC1-2243, then they are selected as parent shrimp resistant to enterocytozoonosis.

4. The application according to claim 3, characterized in that... The specific steps are as follows: Step 1: Extract genomic DNA from the muscle tissue of Litopenaeus vannamei to be tested; Step 2: Using the extracted DNA as a template, perform PCR amplification using the detection primers, and then sequence the obtained PCR amplification products to determine the genotypes of molecular markers A, B, C, D and E. Step 3: When the genotype of molecular marker A is the dominant genotype AC, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker B is the dominant genotype AA, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker C is the dominant genotype TT, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker D is the dominant genotype GA, select this individual as a backup parent for Litopenaeus vannamei breeding; when the genotype of molecular marker E is the dominant genotype CT, select this individual as a backup parent for Litopenaeus vannamei breeding.

Images