Anti-vibrio parahaemolyticus character related SNP molecular marker of penaeus vannamei DnaJC22 gene and application
By screening the SNP molecular markers of the DnaJC22 gene of South American white shrimp, key genotypes were determined for breeding, the problem of anti-Vibirobacteria in South American white shrimp was solved, and efficient and accurate breeding and breeding applications of disease-resistant varieties were achieved.
Patent Information
- Application Number
- CN202510670627.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-08-08
AI Technical Summary
The resistance of existing South American white shrimp varieties to Vibrio parahaemolyticus is gradually weakening, resulting in frequent bacterial diseases, affecting the sustainable development of the breeding industry, and lacking effective breeding methods for disease-resistant varieties.
By screening the SNP molecular markers of the DnaJC22 gene of South American white shrimp, the genotype of the key sites was determined using PCR amplification and sequencing technology, and individuals of the AA or GG genotype were selected as backup parents for breeding, and new varieties of the anti-Vibrio parahemolytica were developed.
It has achieved stable inheritance of disease-resistant traits of white shrimp in South America, improved the efficiency and accuracy of breeding, and promoted the breeding and breeding application of disease-resistant varieties.
Smart Images
Figure CN120442815A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a SNP molecular marker related to the Vibrio parahaemolyticus resistance trait of a DnaJC22 gene of whiteleg shrimp and an application thereof. Background Art
[0002] Whiteleg shrimp ( Litopenaeus Vannamei ), also known as Vannamei shrimp, is favored by farmers and consumers for its high economic value and rich nutrition. However, with the deterioration of shrimp farming environment and the degradation of germplasm resources, the disease resistance of existing varieties has gradually weakened, resulting in frequent bacterial or viral diseases. In particular, Vibrio parahaemolyticus ( Vibrio parahaemolyticus Bacterial diseases caused by Vibrio parahaemolyticus (V. parahaemolyticus) have seriously threatened the sustainable development of shrimp farming. Therefore, breeding new varieties of Litopenaeus vannamei that are resistant to infection by Vibrio parahaemolyticus is considered an effective way to address this problem.
[0003] Heat shock protein 40 (HSP40), also known as DnaJ protein, belongs to the largest class of heat shock proteins and is widely present in a wide range of organisms, from bacteria to humans. In addition to its typical molecular chaperone functions, DnaJ proteins are involved in a variety of biological processes, including cell cycle regulation, transcriptional activation, signal transduction, and tumor suppression. Recent studies have revealed that the DnaJC22 gene (dnaJ homolog subfamily C member 22) can respond to bacterial or viral infection in vertebrates, and that DnaJ proteins participate in immune responses to bacterial or viral infection by regulating the expression of NF-κB and AP-1. However, studies on the role of HSP40 in the antibacterial properties of white shrimp (Penaeus vannamei) have not been reported.
[0004] Single nucleotide polymorphism (SNP) refers to a polymorphism caused by a mutation in a single nucleotide within the genomic DNA sequence of an organism. As an ideal genetic marker, SNPs serve as a link between genes and phenotypes. They have significantly promoted the application of molecular genetic markers in breeding and have become a crucial tool for genetic improvement of economic traits such as growth, reproductive performance, and disease resistance in aquatic animals. Currently, SNPs have been widely used in studies of shrimp reproduction, growth, and resistance to white spot disease, but research on Vibrio resistance in Litopenaeus vannamei remains relatively limited. Summary of the Invention
[0005] In response to the above-mentioned shortcomings, the present invention discloses a SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of the DnaJC22 gene of whiteleg shrimp and its application. Based on the dnaJ homolog subfamily C member 22-like gene of whiteleg shrimp, a SNP site associated with the Vibrio parahaemolyticus resistance trait is obtained through screening, and the SNP site is used as a SNP molecular marker for the Vibrio parahaemolyticus resistance trait of whiteleg shrimp, and is used for the selection and breeding of new Vibrio-resistant whiteleg shrimp varieties.
[0006] The present invention is achieved by adopting the following technical solutions: A SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of the DnaJC22 gene of whiteleg shrimp (Penaeus vannamei), the nucleic acid sequence of which is shown in Sequence 1 in the sequence listing, wherein the base at position 168 is A or T (the mutation types are A / A homozygous, A / T heterozygous, and T / T homozygous), and the base at position 297 is G or T (the mutation types are G / G homozygous, G / T heterozygous, and T / T homozygous).
[0007] The application of the SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of the DnaJC22 gene of the whiteleg shrimp is to use the SNP molecular marker for the breeding of whiteleg shrimp. Specifically, genomic DNA is extracted from the muscle tissue of the whiteleg shrimp to be tested, the genomic DNA is used as a template for PCR amplification and the PCR amplification product is purified, and then the obtained product is sequenced to determine the genotypes of the 168th and 297th sites in the SNP molecular marker; when the genotype of the 168th site is the AA genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of the 297th site is the GG genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding.
[0008] Furthermore, the PCR amplification uses a primer combination for detecting SNP molecular markers associated with the Vibrio parahaemolyticus resistance trait of the DnaJC22 gene of whiteleg shrimp, and the primer combination includes the following primers: Primer F: GCATCACCTGGTTGTTACC (as shown in sequence 2 in the sequence listing); Primer R: GGTGTGTGTGTGCACATATG (as shown in sequence 3 in the sequence listing).
[0009] Furthermore, the PCR amplification system includes the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template.
[0010] Furthermore, the amplification procedure of the PCR amplification comprises the following steps: S1, pre-denaturation at 95°C for 5 min; S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles; S3. Extend at 72°C for 5 min.
[0011] Compared with the existing technology, this technical solution has the following beneficial effects: The present invention provides SNP molecular markers closely associated with the Vibrio parahaemolyticus resistance of whiteleg shrimp. These markers can be applied to the breeding of new whiteleg shrimp varieties resistant to Vibrio parahaemolyticus, promoting the research and application of disease-resistant whiteleg shrimp aquaculture. Using the present method to breed whiteleg shrimp resistant to Vibrio parahaemolyticus, the genotypes of the selected individuals are stable and do not undergo genetic differentiation. Furthermore, the breeding efficiency and accuracy are high, providing a good foundation for the aquaculture and improvement of whiteleg shrimp varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] Figure 1 This is a partial fragment sequence (positions 165 to 171) of the SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of whiteleg shrimp described in Example 1, which shows the AA, AT, and TT peaks at position 168 (D. 44300 A>T 3' UTR).
[0013] Figure 2 This is a partial sequence of the SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of whiteleg shrimp described in Example 1 (positions 294 to 300), which shows the GG, GT, and TT peak maps of position 297 (D.44429 G>T 3'UTR). DETAILED DESCRIPTION
[0014] The present invention is further illustrated by the following examples, which are not intended to limit the present invention. Specific experimental conditions and methods not specified in the following examples are conventional methods well known to those skilled in the art.
[0015] Example 1: The screening process of the SNP molecular marker associated with the Vibrio parahaemolyticus resistance trait of the white shrimp DnaJC22 gene is as follows: (1) 245 whiteleg shrimp weighing about 20 grams were collected from the whiteleg shrimp breeding farm in Fangchenggang City, Guangxi Zhuang Autonomous Region. After 5 days of temporary culture, the whiteleg shrimp were injected with a concentration of 7×10 6cfu / mL of Vibrio parahaemolyticus; to exclude deaths caused by injection, deaths were recorded 6 hours after challenge, and 60 whiteleg shrimp that died first and survived 96 hours later were selected as samples of the whiteleg shrimp Vibrio parahaemolyticus-susceptible and Vibrio parahaemolyticus-tolerant groups, respectively. (2) Five whiteleg shrimps were randomly selected from the sensitive group and the tolerant group, and their muscle tissues were extracted. The genomic DNA was extracted using the conventional phenol-imide extraction method, and the obtained genomic DNA was stored at -20 °C for later use. (3) Based on the dnaJ homolog subfamily C member 22 gene sequence of white shrimp (accession number: NW_020870054.1), a primer combination was designed, namely primer F: GCATCACCTGGTTGTTACCA and primer R: GGTGTGTGTGTGCACATATG; The genomic DNA obtained in step (2) was used as a template and primers F and R were used to prepare a PCR amplification system, wherein the PCR amplification system included the following components: 2.0 μL of 10× Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template; At the same time, set the amplification program as: S1, pre-denaturation at 95°C for 5 min; S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles; S3. Extend at 72°C for 5 min.
[0016] (4) The product obtained by PCR amplification in step (3) was used as a SNP molecular marker related to the resistance of white shrimp to Vibrio parahaemolyticus. After 1% agarose gel electrophoresis, it was purified and sequenced. The sequencing results were compared and analyzed using DNAstar software, including nucleotide sequence alignment and peak analysis. The relevant SNPs sites were screened out to obtain the 168th site and the 297th site, and were recorded as D. 44300 A>T 3'UTR and D.44429 G>T 3'UTR respectively. The base at the 168th site (D. 44300 A>T 3'UTR) was A or T, and the mutation type was A / A homozygous, A / T heterozygous, or T / T homozygous. The base at the 297th site (D.44429 G>T 3'UTR) was G or T, and the mutation type was G / G homozygous, G / T heterozygous, or T / T homozygous. (5) The samples of the white shrimp susceptible group and the resistant group of Vibrio parahaemolyticus in step (1) were tested and genotyped according to the methods described in steps (2) to (4). Statistical analysis was performed on the two sites D. 44300 A>T 3'UTR and D.44429 G>T3'UTR, and the genotype frequency and allele frequency were calculated. The chi-square analysis was used for independence test. The specific results are shown in Table 1.
[0017] According to the analysis in Table 1, the genotype polymorphisms at the two loci had a significant effect on the resistance of whiteleg shrimp to Vibrio parahaemolyticus. Among them, the AA genotype at D. 44300 A>T 3'UTR had better resistance to Vibrio parahaemolyticus than the AT and TT genotypes. AA-type individuals can be selected as reserve parents for whiteleg shrimp breeding. The GG genotype at D. 44429 G>T 3'UTR had better resistance to Vibrio parahaemolyticus than the GT and TT genotypes. GG-type individuals can be selected as reserve parents for whiteleg shrimp breeding.
[0018] Table 1 Genotype and allele frequency distribution at each locus
[0019] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.
Claims
1. A SNP molecular marker associated with Vibrio parahaemolyticus resistance in the DnaJC22 gene of whiteleg shrimp, characterized by: The nucleic acid sequence of the SNP molecular marker is shown in Sequence 1 in the sequence listing, wherein the base at position 168 is A or T, and the base at position 297 is G or T.
2. The use of the SNP molecular marker associated with the anti-Vibrio parahaemolyticus trait of the DnaJC22 gene of the whiteleg shrimp according to claim 1, characterized in that: The SNP molecular marker is used for the breeding of whiteleg shrimp, specifically, by extracting genomic DNA from muscle tissue of the whiteleg shrimp to be tested, using the genomic DNA as a template for PCR amplification and purifying the PCR amplification product, and then sequencing the obtained product to determine the genotypes of the 168th and 297th sites in the SNP molecular marker; when the genotype of the 168th site is the AA genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding; when the genotype of the 297th site is the GG genotype, the individual is selected as a reserve parent for whiteleg shrimp variety breeding.
3. The use according to claim 2, characterized in that: The PCR amplification uses a primer combination for detecting SNP molecular markers associated with the Vibrio parahaemolyticus resistance trait of the white shrimp DnaJC22 gene, and the primer combination includes the following primers: primer F: GCATCACCTGGTTGTTACC; primer R: GGTGTGTGTGTGCACATATG.
4. The use according to claim 3, wherein: The PCR amplification system includes the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTP, 0.2 μL of Taq DNA polymerase, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template.
5. The use according to claim 1, characterized in that: The amplification procedure of the PCR amplification comprises the following steps: S1, pre-denaturation at 95°C for 5 min; S2, denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s for 34 cycles; S3. Extend at 72°C for 5 min.