Molecular markers tightly linked to the major QTL-qSHL-1B for coleoptile length under alkali stress in wheat and their application

By developing the molecular marker KNchr1B-691, which is tightly linked to the major QTL-qSHL-1B for wheat coleoptile length under alkaline stress, the difficult problem of genetic research on wheat coleoptile length was solved, rapid breeding progress was achieved in alkaline soil environment, and the application of molecular breeding tools for wheat breeding efficiency and yield traits was improved.

CN120442854BActive Publication Date: 2025-09-12LUDONG UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510941756.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-09
Publication Date
2025-09-12
Estimated Expiration
2045-07-09

AI Technical Summary

Technical Problem

In alkaline soil environments, genetic research on wheat coleoptile length is difficult to accurately locate, resulting in slow progress in wheat breeding. Existing studies have reported few QTLs for coleoptile length on chromosome 1B, affecting the molecular breeding process for wheat yield traits.

Method used

A molecular marker KNchr1B-691 was developed, which was tightly linked to the major QTL for coleoptile length under alkali stress in wheat. By designing a specific nucleotide sequence primer pair (SEQ ID NO: 1 and SEQ ID NO: 2) for PCR amplification, it was possible to quickly and accurately determine whether the wheat variety had the major QTL for coleoptile length, qSHL-1B.

Benefits of technology

It provides a fast and accurate genetic resource selection tool, reduces the workload of phenotypic identification, improves breeding efficiency, saves costs, can be used in the wheat bud stage, and significantly accelerates the breeding process of high-yield new varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442854B_ABST
    Figure CN120442854B_ABST
Patent Text Reader

Abstract

The present invention discloses a molecular marker tightly linked to the QTL‑qSHL‑1B for the main effect of coleoptile length under alkali stress in wheat and its application, belonging to the field of wheat molecular biotechnology and breeding technology. The molecular marker is KNchr1B‑691, which is tightly linked to the QTL‑qSHL‑1B for the main effect of coleoptile length under alkali stress located on wheat chromosome 1B. The nucleotide sequence is shown in SEQ ID NO: 4, and can be amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2. The benefit of the present invention is that the molecular marker KNchr1B‑691 fully reflects the QTL for the main effect of coleoptile length under alkali stress in wheat varieties (lines), and can quickly and accurately determine whether the wheat variety (line) has the main effect of coleoptile length under alkali stress, providing excellent gene resources and selection tools for molecular breeding of wheat yield traits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a molecular marker and an application thereof, in particular to a molecular marker tightly linked to a major effect QTL-qSHL-1B for coleoptile length under alkali stress in wheat and an application thereof in wheat assisted breeding and genetic improvement, belonging to the field of wheat molecular biotechnology and breeding technology. Background Art

[0002] Currently, soil salinization is an increasingly serious problem. Alkaline soil environments significantly affect the growth and quality of wheat, and also significantly impact wheat yield. Breeding wheat varieties with strong alkaline tolerance is of great significance. The mechanisms of wheat's alkaline resistance are complex. Discovering new alkaline resistance genetic loci in wheat and its related species and incorporating them into breeding efforts has become the most economical, effective, and safe approach to developing alkaline-tolerant wheat varieties.

[0003] The coleoptile is a cone-shaped sheath that grows outside the embryo of grasses. It is a sheath-like structure that protects the young leaves and growth cone within the embryo. During seed germination, the coleoptile first emerges from the ground, protecting the embryo from damage during emergence. The coleoptile's tip contains auxin, and its length and elongation rate are crucial for seedling emergence. During the early stages of seedling growth, they ensure that wheat seedlings successfully emerge from the soil even when sown deep. Studies have shown that coleoptile length varies among wheat populations with different alkali tolerance levels under alkaline stress. Bud-stage coleoptile length can be used as a marker for identifying bud-stage alkali tolerance. Therefore, identifying superior alleles controlling coleoptile length and developing functional molecular markers could significantly accelerate the breeding of new high-yielding wheat varieties and provide superior genetic resources and selection tools for molecular breeding of wheat yield traits.

[0004] Wheat coleoptile length is a quantitative trait, influenced and controlled by multiple genes. However, due to the vulnerability of the coleoptile to environmental influences and the relatively complex genetic background, the precise location and specific role of genes cannot be accurately determined. This makes genetic research on wheat coleoptile length difficult and progress has been slow. With the development of disciplines such as molecular biology and biostatistics, quantitative trait loci (QTL) mapping can determine the association between unknown QTLs and known genomic DNA markers, providing an effective technical means for studying the inheritance of quantitative traits. Therefore, identifying genes related to wheat coleoptile length by developing molecular markers within the target region is extremely important for subsequent breeding efforts.

[0005] Numerous studies have been published on the mechanisms of coleoptile growth and physiological responses. Hao Qianlin et al. used phenotypic data from 275 Doumai / Shi 4185 recombinant inbred lines (RILs) and 186 natural populations to identify QTLs for coleoptile length in wheat under three different environments. In both populations, a major QTL for coleoptile length was identified on chromosome 4BS. Yuan Qianqian et al. used an immortalized F2 (IF2) population containing 168 combinations derived from the DH line of the wheat line Huapei 3 × Yumai 57. They performed QTL mapping analysis under normal conditions and simulated water stress treatments with 10%, 20%, and 30% polyethylene glycol (PEG-6000). They detected a QTL for coleoptile length on chromosome 4B.

[0006] At present, there are few reports on the localization of QTLs for wheat coleoptile length under simulated alkaline stress conditions at a concentration of 0.10wt% NaHCO3, and relatively few reports on QTLs for sheath length on chromosome 1B. Summary of the Invention

[0007] The purpose of the present invention is to provide a molecular marker tightly linked to the major effect QTL-qSHL-1B of wheat coleoptile length under alkali stress and its application, and to detect whether wheat varieties (lines) have QTL sites that increase coleoptile length by using the obtained molecular marker tightly linked to the major effect QTL of wheat coleoptile length under alkali stress, so as to accelerate the breeding process of new high-yield wheat varieties.

[0008] In order to achieve the above objectives, the present invention adopts the following technical solutions:

[0009] A molecular marker tightly linked to the major QTL for coleoptile length under alkali stress in wheat, qSHL-1B. The molecular marker is KNchr1B-691, tightly linked to the major QTL for coleoptile length under alkali stress, qSHL-1B, located on wheat chromosome 1B. The nucleotide sequence is shown in SEQ ID NO: 4, with a sequence length of 591 bp. The marker can be amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2, both of which are single-stranded DNA molecules.

[0010] The application of the aforementioned molecular marker KNchr1B-691, which is tightly linked to the major effect QTL-qSHL-1B for coleoptile length under alkali stress in identifying the coleoptile length trait under alkali stress in wheat, and in breeding wheat with the major effect QTL-qSHL-1B for coleoptile length.

[0011] The present invention is beneficial in that:

[0012] (1) The molecular marker KNchr1B-691 provided by the present invention fully reflects the major effect QTL for coleoptile length under alkaline stress in wheat varieties (lines). Using the genomic DNA of the wheat variety (line) to be tested as a template, PCR amplification of the wheat variety (line) is performed using the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO: 2. This can quickly and accurately determine whether the wheat variety (line) has the major effect QTL for coleoptile length under alkaline stress - qSHL-1B, providing an excellent gene resource and selection tool for molecular breeding of wheat yield traits;

[0013] (2) The molecular marker KNchr1B-691 provided by the present invention is used in wheat molecular breeding, which can greatly reduce the workload of phenotypic identification and can be used in the wheat bud stage, thus saving breeding costs and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a confidence interval plot of the major QTL for coleoptile length under alkali stress in wheat, qSHL-1B, on chromosome 1B. The hollow rectangles represent chromosomes, the labels on the right are the names of the molecular markers, and the labels on the left are the positions of the molecular markers on the chromosome (in Mb). There are two molecular markers in the figure (InDel markers and SNP markers). KNchr1B-691 is an InDel marker, and the rest are SNP markers. The three solid rectangles to the right of the hollow rectangle represent the confidence intervals of the major QTL for coleoptile length, qSHL-1B, under the three environments A1, A2, and A3, respectively.

[0015] Figure 2 Figure 1 is a graph showing the PCR amplification results of the molecular marker KNchr1B-691 in some families of the RIL population, where D represents a 2000 bp DNA marker, K represents the amplification result of the wheat variety Kenong 9204, J represents the amplification result of the wheat variety Jing 411, and numbers 1-22 represent the amplification results of some families of the RIL population;

[0016] Figure 3 This is the result of single marker analysis of coleoptile length based on molecular marker KNchr1B-691 for 188 families in RIL populations under different environments. The white bars are alleles from Kenong 9204, and the black bars are alleles from Jing 411. * indicates significant difference (P<0.05), and ** indicates extremely significant difference (P<0.01). DETAILED DESCRIPTION

[0017] The present invention will be described in detail below with reference to the accompanying drawings and embodiments.

[0018] 1. Obtaining RIL Groups

[0019] Wheat varieties Kenong 9204 (longer coleoptile length) and Jing 411 (shorter coleoptile length) were selected for the experiment. Kenong 9204 was used as the female parent and Jing 411 as the male parent. Hybrid F1 was obtained by hybridization. F1 was self-pollinated to obtain F2. F2 was self-pollinated in successive generations to form an F6 generation RIL population containing 188 families.

[0020] 2. Hydroponic culture and phenotypic identification of RIL populations in different experimental environments

[0021] Thirty seeds with full grains were selected from each family of the RIL population and placed evenly.

[0022] Hydroponic cultivation was performed under alkali treatment (0.10 wt% NaHCO₃) and control conditions (deionized water) at 23°C with a 20-h / 4-h light / dark cycle. Coleoptile length (SHL) was measured on day 8. This experiment was repeated three times, with the three replicates under alkali treatment designated as Environment A1, Environment A2, and Environment A3.

[0023] Method for measuring coleoptile length: Use a ruler with an accuracy of 0.01 cm to measure the length of wheat seeds from the base of the coleoptile to the top of the coleoptile. Measure 10 plants for each line and take the average value.

[0024] 3. Detection results of major QTL for coleoptile length

[0025] A physical map was constructed using IciMapping v4.1 software. Six sets of coleoptile length phenotypic values ​​obtained under control and alkali treatment were organized according to the BIP module format of IciMapping v4.1, and additive QTL mapping was performed. 1000 permutation tests were performed with a 1 Mb permutation interval to detect LOD peaks under different environments, with an LOD threshold of 2.0.

[0026] QTL analysis was performed by combining a high-density genetic linkage map of 188 families in the RIL population with phenotypic data from six environments (three replicates under control conditions and three replicates under alkali treatment). The results were as follows:

[0027] (1) Under control conditions, no major QTL for coleoptile length was detected on wheat chromosomes;

[0028] (2) Under alkali treatment, a major QTL for coleoptile length, qSHL-1B, was detected on chromosome 1B of wheat. The confidence interval of the major QTL for coleoptile length, qSHL-1B, on chromosome 1B is as follows: Figure 1 The results of major QTL detection for coleoptile length in 188 families in the RIL population are shown in Table 1.

[0029] Table 1 Detection results of major QTL for coleoptile length in 188 families in the RIL population

[0030]

[0031] As shown in Table 1, the major QTL for coleoptile length, qSHL-1B, was stably detected in the three environments A1, A2, and A3 (i.e., three replicates of alkali treatment), with LOD values ​​of 3.20-3.60, explaining 6.65-7.85% of the phenotypic variation in coleoptile length. The allele from Jing 411 increased coleoptile length by 0.07-0.08 cm.

[0032] 4. Develop molecular markers and design corresponding primer pairs

[0033] An InDel molecular marker with polymorphism between parents was developed near the LOD predicted peak of the coleoptile length major QTL-qSHL-1B segment and was marked as KNchr1B-691.

[0034] The corresponding primer pairs were designed based on the molecular marker KNchr1B-691, wherein:

[0035] The nucleotide sequence of the upstream primer was: TCAGACACCGTATCCCCGA (SEQ ID NO: 1);

[0036] The nucleotide sequence of the downstream primer is: AGAGTGGGTTCAGCTTGACC (SEQ ID NO: 2).

[0037] Both the upstream primer and the downstream primer are single-stranded DNA molecules.

[0038] 5. Genotyping of RIL population using molecular marker KNchr1B-691

[0039] 1. Extract DNA from each strain of RIL population using the modified CTAB method

[0040] The method for extracting DNA from each strain of the RIL population using the modified CTAB method is as follows:

[0041] (1) Place a steel ball and 0.2 g of fresh wheat leaves in a 2.0 mL centrifuge tube, quickly place the tube in liquid nitrogen, and shake the tube to grind the wheat leaves into fine powder.

[0042] (2) Continue to add 0.8 mL of cetyltrimethylammonium bromide (CTAB) extract to the centrifuge tube, shake well, and place in a 65°C water bath for 60 min, inverting and shaking four times from time to time;

[0043] (3) Cool the centrifuge tube to room temperature, add an equal volume of chloroform-isoamyl alcohol (volume ratio 24:1), shake vigorously for 1 min to mix, and centrifuge at 8000 rpm for 10 min;

[0044] (4) Aspirate 600 μL of supernatant into another 1.5 mL centrifuge tube, add 0.8 times the volume of pre-chilled isopropanol (-20° pre-chilled) to precipitate the DNA, and centrifuge at 12000 rpm for 6 min;

[0045] (5) Pour off the supernatant and add an appropriate amount of 70% ethanol to wash the precipitate twice. Place the centrifuge tube tilted in a fume hood to dry. After the alcohol smell is gone, add 400 μL TE to dissolve it and store it in a -20℃ refrigerator for long-term storage.

[0046] 2. PCR amplification of DNA from RIL population

[0047] Wheat genomic DNA was used as a template and PCR amplification was performed using the above primer pair (SEQ ID NO: 1 and SEQ ID NO: 2). The PCR amplification system and PCR amplification procedure are as follows:

[0048] PCR amplification system (10 μL): 2 μL DNA template, 0.5 μL upstream primer, 0.5 μL downstream primer, 5 μL 2× TaqPCR premix reagent and 2 μL ddH2O.

[0049] PCR amplification program (normal program): pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 40 s, extension at 72°C for 40 s, 34 cycles; extension at 72°C for 5 min; end amplification and store at 12°C.

[0050] 3. Electrophoresis of PCR amplification products

[0051] The PCR amplification products were electrophoresed using a 6.0% non-denaturing polyacrylamide gel (preparation method: dissolve 5.85g acrylamide and 0.15g methylene acrylamide in 100mL distilled water) with 1×TBE as the electrophoresis buffer and a constant voltage of 147V for 2h.

[0052] The electrophoresis results of PCR amplification products of some families in the RIL population are shown in Figure 2 .

[0053] 4. Analyze the electrophoresis results

[0054] The size of the PCR amplification product of the wheat variety Kenong 9204 is 437 bp, and the nucleotide sequence is shown in SEQ ID NO: 3.

[0055] The size of the PCR amplification product of the wheat variety Jing 411 is 591 bp, and the nucleotide sequence is shown in SEQ ID NO: 4.

[0056] Among the 188 families in the RIL population, 92 had the same banding pattern as Kenong 9204, 75 had the same banding pattern as Jing 411, 13 were heterozygous, and 8 were missing.

[0057] VI. Association analysis between molecular marker KNchr1B-691 and coleoptile length

[0058] In three replicates under alkali treatment, the molecular marker KNchr1B-691 was used to genotype a total of 188 families in the RIL population, and the difference in coleoptile length between different genotypes was analyzed. The results of the single marker analysis of coleoptile length based on the molecular marker KNchr1B-691 in 188 families in three replicates are shown in Figure 3 .

[0059] Depend on Figure 3 It can be seen that under alkali treatment, compared with the allele from Kenong 9204 which reduced the coleoptile length, the allele from Jing 411 could significantly increase the coleoptile length. This result could be verified in three replicates under alkali treatment.

[0060] The above results prove that the molecular marker KNchr1B-691 is a molecular marker tightly linked to the coleoptile length under alkali stress in wheat, and this molecular marker can be effectively used in the molecular marker-assisted selection breeding program for wheat coleoptile length.

[0061] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. A molecular marker tightly linked to the major QTL for coleoptile length under alkali stress in wheat, qSHL-1B, characterized by: The molecular marker is KNchr1B-691, which is tightly linked to the major QTL-qSHL-1B for coleoptile length under alkaline stress located on wheat chromosome 1B. The nucleotide sequence is shown in SEQ ID NO: 4, with a sequence length of 591 bp. It can be amplified by the upstream primer shown in SEQ ID NO: 1 and the downstream primer shown in SEQ ID NO:

2. Both the upstream primer and the downstream primer are single-stranded DNA molecules.

2. Use of the molecular marker KNchr1B-691 tightly linked to the major effect QTL-qSHL-1B for coleoptile length under alkali stress in wheat according to claim 1 in identifying the coleoptile length trait under alkali stress in wheat.

3. Use of the molecular marker KNchr1B-691 tightly linked to the major effect QTL-qSHL-1B for coleoptile length under alkali stress in wheat according to claim 1 in breeding wheat with the major effect QTL-qSHL-1B for coleoptile length.

Citation Information

Patent Citations

  • TaROD1 gene for regulating and controlling disease resistance and application of TaROD1 gene in wheat breeding

    CN118910147A

  • Molecular marker closely linked with coleoptile length under wheat alkali stress and application of molecular marker

    CN120174148A