Multiple ddPCR detection method for porcine intestinal coronavirus

Through microdrop digital PCR technology, specific primers and probes are designed to target the N-gene targets of pig intestinal coronaviruses, solving the accuracy and sensitivity problems of detecting various pig intestinal coronaviruses in the prior art, and achieving rapid, strong specificity and strong anti-interference detection effects, suitable for early infection and epidemiological risk assessment.

CN120442860APending Publication Date: 2025-08-08ZHEJIANG ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE +1

Patent Information

Application Number
CN202510705513.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-29
Publication Date
2025-08-08

AI Technical Summary

Technical Problem

The prior art is difficult to detect a variety of pig intestinal coronaviruses quickly and accurately, especially in low concentrations or complex samples, which are prone to missed or missed detection and difficult to distinguish mixed infections.

Method used

Using microdroplet digital PCR (ddPCR) technology, specific primers and probes were designed to target N gene targets of pig intestinal coronavirus SADS-CoV, PEDV, PDCoV and TGEV, nucleic acids were extracted through magnetic bead method for detection, and the concentration and annealing temperature of primers and probes were optimized, and multiple ddPCR detection methods were established.

Benefits of technology

It realizes rapid, sensitive and specific detection of pig intestinal coronavirus, can overcome the interference of complex sample matrix, improve the detection reliability of low-concentration samples, simplify operational steps, reduce costs, and is suitable for trace warning and epidemiological risk assessment of early infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120442860A_ABST
    Figure CN120442860A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological detection, relates to a multiple ddPCR detection method for porcine intestinal coronavirus, and in particular relates to a monitoring and quantitative detection method for samples with relatively low porcine intestinal coronavirus content or complex matrix, such as feeds, animal tissues and animal-derived products. The droplet digital PCR detection method for the porcine intestinal coronavirus established in the invention has the advantages of strong specificity, high sensitivity, good repeatability and strong anti-interference capability, can be used for absolute quantification of the copy concentration of the porcine acute diarrhea syndrome coronavirus (SADS-CoV), the porcine epidemic diarrhea virus (PEDV), the porcine delta coronavirus (PDCoV) and the porcine transmissible gastroenteritis virus (TGEV) in an actual sample, and can be used for the detection of the porcine intestinal coronavirus. The invention provides a novel and reliable technical method for trace early warning and monitoring of early-stage infection of four porcine intestinal coronavirus, differential diagnosis of other common viruses, research of propagation rules of the viruses, epidemiological risk assessment and other systematic applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biology detection technology, and specifically to a multiplex digital PCR (ddPCR) detection method for simultaneously detecting porcine acute diarrhea syndrome coronavirus (SADS-CoV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and porcine transmissible gastroenteritis virus (TGEV), and to a monitoring and quantitative detection method for samples with low porcine intestinal coronavirus content or complex matrices, such as feed, animal tissues and animal-derived products. Background Art

[0002] Porcine enteric coronaviruses, such as SADS-CoV, PEDV, PDCoV, and TGEV, are the primary pathogens causing porcine viral diarrhea syndrome (VDS), resulting in significant economic losses for the swine industry. These viruses can cause severe symptoms in piglets, such as acute diarrhea, vomiting, dehydration, and even death, with a high mortality rate. Furthermore, they frequently break out in multiple locations around the world, spread widely, and are prone to mutation and recombination, making prevention and control more challenging. Because these viruses exhibit similar clinical symptoms, accurate differentiation based on symptoms is difficult, necessitating precise detection methods for differential diagnosis.

[0003] Current clinically used pathogen detection methods have numerous drawbacks when it comes to detecting porcine enteric coronavirus. For example, traditional methods are cumbersome and time-consuming, failing to meet the demands of rapid diagnosis. Some methods also lack sensitivity and specificity, leading to missed or false positives and difficulty accurately detecting low-concentration virus samples. Furthermore, existing methods struggle to effectively distinguish and accurately detect samples infected with multiple viruses.

[0004] A Chinese invention patent (publication number: CN110257557B, publication date: October 13, 2023) discloses a multiplex RT-PCR primer set for detecting TGEV, PEDV, SADS-CoV, and PDCoV. The nucleotide sequences of the multiplex RT-PCR primer set for detecting TGEV, PEDV, SADS-CoV, and PDCoV are shown in SEQ ID NOs. 1 to 8. A kit containing the primer set is also provided. This primer set and kit utilize a one-time PCR reaction to rapidly differentiate and identify TGEV, PEDV, SADS-CoV, and PDCoV.

[0005] Currently, with the continuous advancement of molecular biology techniques, detection technologies are trending towards large-scale, precise testing. Digital PCR, a third-generation PCR technology, offers superior specificity, sensitivity, and reproducibility compared to RT-qPCR. It offers significant advantages in detecting extremely low nucleic acid concentrations and can achieve absolute quantification without the need for internal reference genes, significantly improving the accuracy and reliability of low-load viral detection. It is widely used in studies of disease incubation and early diagnosis, bacterial titration, nucleic acid molecular detection, and copy number variation. While conventional PCR and qPCR remain foundational diagnostic methods, ddPCR, with its high sensitivity and robust tolerance to complex sample matrices (such as those containing mixed infections or degraded nucleic acids), offers an effective complement to existing technologies. ddPCR also demonstrates significant potential in epidemiological surveillance, such as tracking viral load dynamics, assessing transmission risk thresholds, and providing technical support for the rapid identification of potential infection sources during cross-border quarantine. The integration of ddPCR technology can further enhance the prevention and control of porcine enteric coronaviruses, providing scientific tools for precise diagnosis, epidemic early warning, and biosafety strategy development. Summary of the Invention

[0006] This invention addresses the shortcomings of existing technologies by providing a porcine enteric coronavirus detection technology based on droplet digital PCR (ddPCR), capable of simultaneously and rapidly, sensitively, and specifically detecting multiple porcine enteric coronaviruses. This technology significantly improves the detection reliability of low-concentration samples (such as early infection or environmental samples) while effectively overcoming the effects of complex sample matrices (such as degraded nucleic acids or inhibitor interference) on test results, providing powerful technical support for the monitoring and control of porcine enteric coronavirus diseases.

[0007] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions: The use of porcine enteric coronavirus SADS-CoV N gene target, PEDV N gene target, PDCoV M gene target, and TGEVS gene target in the preparation of a multiplex ddPCR detection reagent for porcine enteric coronavirus, wherein the nucleotide sequences of the porcine enteric coronavirus SADS-CoV N gene target, PEDV N gene target, PDCoV M gene target, and TGEV S gene target are shown in SEQ ID NO. 1 to SEQ ID NO. 4. Primer sets and probes designed based on the porcine enteric coronavirus gene targets can provide a porcine enteric coronavirus droplet digital PCR detection method.

[0008] Furthermore, the present invention also provides a primer set and probe for the porcine enteric coronavirus SADS-CoV N gene target, PEDVN gene target, PDCoV M gene target and TGEV S gene target.

[0009] Preferably, the nucleotide sequence comprising the primer set and the probe (SEQ ID NO.5-SEQ ID NO.16) is as follows: SADS-CoV-F: CTCGGCTTACTCTAAACCC; SADS-CoV-R: CATCCACCATCTCAACCTC; SADS-CoV-P: FAM-AGTGTTCACTCCGGCACCTC-BHQ1; PEDV-F:GAACCTAACACACCTCCT; PEDV-R: CACGACCCTGGTTATTTC; PEDV-P: HEX-CAGAGGCAATAACCAGTCCCGT-BHQ1; PDCoV-F: GTACATGGAGGTGCATTC; PDCoV-R: GTGGCGGATTTCTAACTG; PDCoV-P: CY5-GGCTCCAATTCTCACACCAGTC-BHQ3; TGEV-F: GCAGATGAGGTTGTTGCT; TGEV-R: GCCAGCGACTTCTAATGTTG; TGEV-P: CY5.5-TGGTCTGGCACTGTCACATTGGT-BHQ3.

[0010] This primer set can quickly, accurately and efficiently detect and identify four pathogens, SADS-CoV, PEDV, PDCoV and TGEV, at one time with good specificity and high sensitivity.

[0011] Furthermore, the present invention also provides a kit comprising the primer set and probe for detecting SADS-CoV, PEDV, PDCoV and TGEV.

[0012] Preferably, the final concentrations of the primer sets and probes contained in the kit are as follows: SADS-CoV primer final concentration 500 nmol / L, PEDV primer final concentration 700 nmol / L, PDCoV primer final concentration 500 nmol / L, TGEV primer final concentration 600 nmol / L, and SADS-CoV, PEDV, PDCoV and TGEV probe final concentrations are all 250 nmol / L.

[0013] Preferably, the kit includes: 5.1 µL of primers and probes, 2.9 µL of ddH2O, 2.0 µL of template DNA, and 10.0 µL of ddPCR Supermix for Probes (no dUTP). The following amounts are used: 0.5 µL of SADS-CoV upstream primer, 0.5 µL of downstream primer, and 0.125 µL of probe; 0.7 µL of PEDV upstream primer, 0.7 µL of downstream primer, and 0.125 µL of probe; 0.5 µL of PDCoV upstream primer, 0.5 µL of downstream primer, and 0.125 µL of probe; and 0.6 µL of TGEV upstream primer, 0.6 µL of downstream primer, and 0.125 µL of probe.

[0014] Furthermore, the present invention also provides the use of the primer set and probe or the kit in non-disease diagnostic methods for porcine enteric coronaviruses, particularly in the detection of feed, animal tissues, and animal-derived products. These can efficiently and accurately detect and identify SADS-CoV, PEDV, PDCoV, and TGEV, and are of great significance for early diagnosis, prevention, and epidemiological investigation of these pathogenic infections.

[0015] Preferably, the kit adopts the ddPCR detection method, and the reaction conditions of ddPCR detection are: 50℃ 20 min; 95℃ 10 min; 94℃ 30 s, 57℃ 1 min, a total of 40 cycles; 98℃ 10 min; the heating and cooling rate during the reaction is 2℃ / s.

[0016] Furthermore, the present invention also provides a multiplex ddPCR detection method for porcine enteric coronavirus, which is not a disease diagnosis method and comprises the following steps: 1) Weigh 2-3 g of contaminated sample and homogenize with 1-2 mL of 10 mmol / L phosphate buffer (pH 7.2). Centrifuge the homogenized sample and collect the supernatant. 2) extracting nucleic acid from the supernatant using a magnetic bead method, and performing ddPCR detection on the extracted nucleic acid, using the primer set and probe for ddPCR detection.

[0017] The beneficial effects of the present invention are as follows: the porcine enteric coronavirus droplet digital PCR detection method established in the present invention has strong specificity, high sensitivity, good repeatability, and strong anti-interference ability. It can absolutely quantify the copy concentrations of porcine acute diarrhea syndrome coronavirus (SADS-CoV), porcine epidemic diarrhea virus (PEDV), porcine deltacoronavirus (PDCoV) and porcine transmissible gastroenteritis virus (TGEV) in actual samples, and adopts a droplet digital PCR detection method to simplify the operation steps, reduce operation errors and consumption, and save detection costs to a certain extent; the method of the present invention can meet the qualitative and quantitative detection requirements of the four porcine enteric coronaviruses SADS-CoV, PEDV, PDCoV and TGEV in samples, and provide a new and reliable technical method for systematic applications such as early trace warning monitoring of four porcine enteric coronavirus infections, differential diagnosis with other common viruses, study of their transmission patterns, and epidemiological risk assessment. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a schematic diagram of the optimization results of primer and probe concentrations for the ddPCR system. Figure 1 A in the middle is a 1D diagram for optimizing the concentration of primers and probes in the ddPCR system. Figure 1 Figure B is a 2D reaction diagram of four target viruses at the optimal concentration of primers and probes. Figure 1 Center C is a schematic diagram of the 3D reaction of four target viruses at the optimal concentration of primers and probes; it is used to illustrate that the optimized primer and probe concentrations can make the positive droplets have higher fluorescence values, the positive and negative droplets are concentrated, and the positive droplets of each virus are clearly divided into different zones.

[0019] Figure 2 This is the annealing temperature optimization diagram of the ddPCR system, which shows that the detection effect is best when the annealing temperature is 57°C.

[0020] Figure 3 This paper presents the anti-interference experimental results of multiple ddPCR. Figure 3 A in the middle is the anti-interference experiment result of SADS-CoV. Figure 3 B is the anti-interference test result of PEDV. Figure 3 C in the middle is the anti-interference experimental result of PDCoV. Figure 3 D in the middle is the anti-interference experimental result of TGEV.

[0021] Figure 4 Specificity detection results of multiplex ddPCR reactions.

[0022] Figure 5 The results of intra-batch and inter-batch reproducibility of multiplex ddPCR reactions are shown in Table 1. Figure 5 Middle A is the reproducibility result for SADS-CoV, the left picture is within the batch, and the right picture is between batches; Figure 5 Middle B is the repeatability result of PEDV, the left figure is within the batch, and the right figure is between batches; Figure 5 Middle C is the reproducibility result of PDCoV, the left picture is within the batch, and the right picture is between batches; Figure 5 D in the middle shows the repeatability results for TGEV, with the left figure showing the intra-batch results and the right figure showing the inter-batch results.

[0023] Figure 6 The standard curve results of ddPCR and qPCR. Figure 6 A in the middle is the standard curve result of ddPCR, Figure 6 Figure B shows the standard curve results of qPCR.

[0024] Figure 7 The LoD results of SWPV ddPCR were analyzed using the Probit model, which accurately displayed the LoD of different viruses and their 95% confidence intervals. Figure 7 A in the middle is the LoD result of ddPCR for SADS-CoV. Figure 7 Figure B is the LoD result of ddPCR for PEDV. Figure 7 Middle C is the LoD result of ddPCR for PDCoV, Figure 7 Middle D is the LoD result of ddPCR for TGEV.

[0025] Figure 8 Comparison of ddPCR and qPCR analysis results for 408 samples.

[0026] Figure 9 The graph shows the positive detection results of various pathogens in 408 samples by ddPCR and qPCR.

[0027] Figure 10 Schematic diagram of different results using different target primers and probes for SADS-COV.

[0028] Figure 11 Schematic diagram of different results using different target primers and probes for PEDV.

[0029] Figure 12 Schematic diagram of different results using different target primers and probes for PDCOV.

[0030] Figure 13 Schematic diagram of different results using different target primers and probes for TGEV. DETAILED DESCRIPTION

[0031] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts are within the scope of protection of the present invention.

[0032] Test Example 1 1. Materials and Methods 1.1 Virus The various viruses used in this study were purchased from related companies, donated by other institutions, or stored in laboratories. Primers and probes used for detection were designed using Primer3Plus based on the conserved sequences of the four viruses (derived from GenBank, specifically the SADS-CoV N gene (MT199592), PEDV N gene (AF353511.1), PDCoV M gene (KP757891), and TGEV S gene (HQ462571)). These primers and probes were synthesized by Sangon Biotech. The conserved nucleotide sequences of the four viruses are shown in SEQ ID NOs. 1 to 4.

[0033] 1.2 Standard plasmid construction and concentration determination Using the conserved gene sequences of each target virus in GenBank as templates, primers were used to amplify the corresponding fragments and construct positive plasmids. The copy number concentration of the plasmid was calculated using a specific formula, and the initial concentration was 1×10 8 The copied / reacted plasmid was serially diluted with nuclease-free water and stored for later use.

[0034] 1.3 Nucleic acid extraction and reverse transcription The nucleic acid of the sample and virus is extracted using the magnetic bead method, and then the extracted nucleic acid is reverse transcribed into cDNA using a reverse transcription kit and stored.

[0035] 1.4 Optimization of multiplex ddPCR detection method The concentration of each target virus was 10 3 The positive plasmid of the copy / reaction was used as a template and QX600 was used. TM The Droplet Digital PCR System optimizes primer and probe concentrations, analyzes test results from different combinations, and identifies the best match. It then optimizes the annealing temperature within a 53-60°C range and comprehensively analyzes various reaction system parameters to determine the optimal reaction conditions.

[0036] 1.5 Anti-interference analysis The diluted positive plasmids of four viruses, SADS-CoV, PEDV, PDCoV, and TGEV, were combined in a ratio of 1:1:1:1 to prepare mixed samples of different concentrations. Each group was tested three times to evaluate the anti-interference ability of the method.

[0037] 1.6 Specificity, reproducibility and sensitivity testing The specificity of the method was evaluated using cDNAs of four viruses, SADS-CoV, PEDV, PDCoV and TGEV, as well as DNA or cDNA of other common porcine viruses as templates: SADS-CoV, PEDV, PDCoV and TGEV positive plasmids were used as positive controls, and ASFV, CSFV, PCV2, PCV3, JEV, RV-A, RV-C, PBoV, SVDV, FMDV, PRRSV PRV, SIV, PPV and NC nucleic acids were used as negative controls, and the optimal reaction system was used for amplification.

[0038] The positive plasmids of the four viruses were diluted 10-fold in series and then tested by ddPCR. Multiple replicates were set up, and the intra- and inter-batch coefficients of variation (CV) were calculated to evaluate the repeatability.

[0039] ddPCR assays were performed using mixed positive plasmids at varying concentrations as templates, with 40 replicates at each concentration. Standard curves were plotted and compared with qPCR to assess amplification efficiency. Sensitivity tests were further performed using standard plasmids at specific concentrations to determine the limits of detection (LoD) and quantification (LoQ).

[0040] 1.7 Sample Testing The established multiplex ddPCR detection method was used to test 408 known negative and positive samples, quantify the virus concentration in the samples, and compare the results with qPCR detection to evaluate the accuracy and stability of this method in actual sample detection.

[0041] The specific steps of sample preparation and detection method are as follows: 1) Weigh 2-3 g of contaminated sample and homogenize with 1-2 mL of 10 mmol / L phosphate buffer (pH 7.2). Centrifuge the homogenized sample at 10,000 rpm for 5 minutes and collect the supernatant. 2) Extract nucleic acid from the supernatant using the magnetic bead method and perform ddPCR detection on the extracted nucleic acid.

[0042] 2. Results 2.1 Optimization of multiplex ddPCR reaction conditions contrast Figure 1 、 2The optimal reaction system was determined by ddPCR reaction under different primer and probe concentrations and annealing temperature conditions: 5.1 μL primers / probes, 2.9 μL ddH2O, 2.0 μL template DNA, 10.0 μL ddPCR Supermix for Probes (No dUTP), and a total of 20 μL; SADS-CoV primers 0.5 μL*2 (final concentration 500 nmol / L), probe 0.125 μL (final concentration 250 nmol / L); PEDV primers 0.7 μL*2 (final concentration 700 nmol), probe 0.125 μL (final concentration 250 nmol / L); PDCoV primers 0.5 μL*2 (final concentration 500 nmol / L), probe 0.125 μL (final concentration 250 nmol / L); TGEV primers 0.6 μL*2 (final concentration 600 nmol / L), probe 0.125 µL (final concentration 250 nmol / L).

[0043] The optimal reaction program was as follows: 50°C for 20 min; 95°C for 10 min; 94°C for 30 s, 57°C for 1 min, for a total of 40 cycles; 98°C for 10 min; and finally, storage at 4°C. The heating and cooling rate during the reaction was 2°C / s.

[0044] 2.2 Anti-interference analysis of ddPCR reaction The results are as follows Figure 3 As shown, this method proves that the concentrations of each virus do not affect each other's quantitative detection, and is not interfered with by other viruses in complex sample detection, and has high anti-interference ability.

[0045] 2.3 Verification of ddPCR reaction specificity ddPCR reaction detection was performed using SADS-CoV, PEDV, PDCoV, TGEV, ASFV, CSFV, PCV2, PCV3, JEV, RV-A, RV-C, PBoV, SVDV, FMDV, PRRSV PRV, SIV, PPV, and NC as templates, and the results were as follows: Figure 4 As shown in the figure, only SADS-CoV, PEDV, PDCoV and TGEV showed specific amplification, and no amplification signals were found for other viruses. This shows that the ddPCR detection method established in this study has strong specificity for SADS-CoV, PEDV, PDCoV and TGEV, and can accurately distinguish the target viruses and avoid false detection.

[0046] 2.4 Reproducibility of ddPCR reactions Put 10 1 -10 5The established ddPCR method was used to test the intra-assay reproducibility of the positive plasmids of the four viruses tested. The results showed that the intra-assay coefficient of variation (CV%) for the five concentrations of the four viruses was less than 11%, and the inter-assay coefficient of variation (CV%) for each concentration of the four viruses was less than 11%, indicating good reproducibility of the method.

[0047] 2.5 Sensitivity of ddPCR reactions Comparing the standard curve results of ddPCR and qPCR, the results are as follows Figure 6 As shown in the figure, the ddPCR test results have a high degree of fit with the theoretical curve, indicating good stability and amplification efficiency.

[0048] To further refine the ddPCR detection limit (LoD), sigmoid curves were analyzed using a probit regression model with a 99% probability of reproducibility. The ddPCR LoD for SADS-CoV was 2.72 copies / reaction (95% CI: 2.13-5.66 copies / reaction), the ddPCR LoD for PEDV was 3.00 copies / reaction (95% CI: 2.20-6.25 copies / reaction), the ddPCR LoD for PDCoV was 3.56 copies / reaction (95% CI: 2.75-6.00 copies / reaction), and the ddPCR LoD for TGEV was 3.19 copies / reaction (95% CI: 2.38-6.11 copies / reaction).

[0049] The sensitivity was evaluated by comparing the limit of detection (LoD) and limit of quantification (LoQ) of ddPCR and qPCR. The LoQ of ddPCR was 7.5 copies / reaction, and the LoD was less than 5 copies / reaction, which was one order of magnitude higher than the sensitivity of qPCR, indicating that this method can detect lower concentrations of virus and help detect early infection.

[0050] Table 1 Comparison of sensitivity between ddPCR and qPCR *: Concentration units are copies / reaction (system).

[0051] †: relative standard deviation.

[0052] 2.6 Sample test results The performance of the ddPCR reaction method was further validated using 408 clinical samples. Figure 8 The consistency of the virus concentration detection results in samples by ddPCR and qPCR is presented. Figure 9 The following is a graph showing the positive detection results of various pathogens in 408 samples by ddPCR and qPCR, which intuitively reflects the differences between the two methods in detecting positive samples. Figure 8 and Figure 9 It can be observed that the detection results of ddPCR for 408 samples are highly consistent with the known results, with a compliance rate of 97%-100% and a diagnostic specificity (DSp) of 99%-100%. It has more advantages than qPCR when detecting complex matrix samples and can stably quantify the number of viral copies in the samples.

[0053] Test Example 2 By selecting different target locations and designing different primer probes, experiments were conducted to demonstrate that the selected targets (SADS-CoV-N / PEDV-N / PDCoV-M / TGEV-S) of the present invention, when used in combination with primer-probes corresponding to SEQ ID NOs. 5-16, simultaneously meet the three major indicators of cluster resolution, detection limit, and channel compatibility, achieving unexpected technical effects.

[0054] 1. Experimental Design The optimal ddPCR system and cycling parameters (20 µL system, 57°C annealing) were used in Experiment 1. The templates used were a gradient dilution (10³–1 copies·µL⁻¹) of the positive plasmids from the four viruses, each tested separately.

[0055] 2. Target location, primers, and probes SADS-COV PEDV PDCOV TGEV 3. Summary of results (detailed data see Figure 10-13 ) Virus plan amplitudea κ <![CDATA[LoD 99 (copies)]]> Negative control amplification SADS-CoV A(N)·The present invention 13600±1100 14.9 2.9 0 / 60 B(N) 4900±540 4.2 20.6 3 / 60 C(M) — — <![CDATA[>10 4 ]]> — PEDV A(N)·The present invention 25300±1800 22.5 3.2 0 / 60 B(N) 8000±770 7.0 17.7 2 / 60 C(M) — — <![CDATA[>10 4 ]]> — PDCoV A(M)·The present invention 22800±1500 21.3 3.4 0 / 60 B(S) 7600±820 6.7 18.2 2 / 60 (cross) C(N) — — <![CDATA[>10 4 (Not detected)]]> — TGEV A(S)·The present invention 12900±970 15.8 3.1 0 / 60 B(S) 5200±630 4.8 23.4 1 / 60 C(N) — — <![CDATA[>10 4 ]]> — 4. Discussion 1) Cluster resolution advantage The target and primer / probe selected in this invention (Scheme A) produced positive droplets with an average amplitude greater than 12,000 a.u. (maximum ≈25 ka.u.), and κ>14. The positive / negative clusters were clearly separated, and four-fold partitioning without overlap was achieved in the QX600 two-color system (see Figure 10-13 ).

[0056] The S-gene, N-gene or M-gene fragments involved in comparative examples B and C had high GC content / complex secondary structure, resulting in a decrease in primer-probe efficiency; among them, group C almost did not form any positive clusters.

[0057] 2) Sensitivity and detection limit LoD of the present invention 99≤3.5 copies / reaction, an improvement of more than 1 order of magnitude compared to comparison B and at least 3 orders of magnitude compared to comparison C. The LoQ has steadily decreased from 7.5 copies / reaction to 5 copies / reaction, meeting the needs of monitoring early / latent infections and extremely low-copy viruses in feed.

[0058] 3) Specificity and cross-inhibition The triple comparison system showed false positives for PRCV and FCoV (2–3 / 60) at high template loading, demonstrating nonspecific matches with other α-CoV and δ-CoV sequences. BLASTn (2025-04) verified the present sequence as 100% specific for the target virus. In a quadruple mixed template assay (10 copies), the four signals from solution A did not interfere with each other, while combinations B and C exhibited 20%-38% quantitative deviation at the same concentration.

[0059] Through in silico structure prediction, multi-target trial-and-error, and three-level screening of negative / positive cluster statistical parameters, this study has for the first time determined the optimal combination of MSNN cross-distribution, enabling simultaneous detection of four porcine enteric coronaviruses in a single reaction tube, with the potential for expansion to eightfold (theoretically maintaining a kappa value greater than 6). Comparative data demonstrate that simply replacing any one target or using different fragments of the same gene significantly reduces sensitivity or introduces cross-signaling.

[0060] The above is a description of the embodiments of the present invention. The above description of the disclosed embodiments will enable professionals in the field to implement or use the present invention. Various modifications to these embodiments will be apparent to professionals in the field. The general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but should conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of porcine enteric coronavirus SADS-CoV N gene target, PEDV N gene target, PDCoV M gene target and TGEV S gene target in the preparation of porcine enteric coronavirus detection reagent, characterized in that, The nucleotide sequences of the porcine enteric coronavirus SADS-CoV N gene target, PEDV N gene target, PDCoV M gene target and TGEV S gene target are shown in SEQ ID NO.1-SEQ ID NO.

4.

2. A primer set and probe for detecting the porcine enteric coronavirus SADS-CoV N gene target, PEDV N gene target, PDCoV M gene target and TGEV S gene target according to claim 1.

3. The primer set and probe according to claim 2, characterized in that: The nucleotide sequence comprising the primer set and probe is as follows: SADS-CoV-F: CTCGGCTTACTCTAAACCC; SADS-CoV-R: CATCCACCATCTCAACCTC; SADS-CoV-P: FAM-AGTGTTCACTCCGGCACCTC-BHQ1; PEDV-F:GAACCTAACACACCTCCT; PEDV-R: CACGACCCTGGTTATTTC; PEDV-P: HEX-CAGAGGCAATAACCAGTCCCGT-BHQ1; PDCoV-F: GTACATGGAGGTGCATTC; PDCoV-R: GTGGCGGATTTCTAACTG; PDCoV-P: CY5-GGCTCCAATTCTCACACCAGTC-BHQ3; TGEV-F: GCAGATGAGGTTGTTGCT; TGEV-R: GCCAGCGACTTCTAATGTTG; TGEV-P: CY5.5-TGGTCTGGCACTGTCACATTGGT-BHQ3. A kit comprising the primer set and probe according to claim 2 or 3.

5. The kit according to claim 4, characterized in that The final concentration of SADS-CoV primers was 500 nmol / L, the final concentration of PEDV primers was 700 nmol / L, the final concentration of PDCoV primers was 500 nmol / L, and the final concentration of TGEV primers was 600 nmol / L. The final concentration of SADS-CoV, PEDV, PDCoV, and TGEV probes was 250 nmol / L.

6. The kit according to claim 4, wherein The kit includes: 5.1 µL of primers and probes, 2.9 µL of ddH2O, 2.0 µL of template DNA, and 10.0 µL of ddPCR Supermix for Probes (No dUTP).

7. The kit according to claim 6, characterized in that SADS-CoV primers 0.5 µL*2, probe 0.125 µL; PEDV primers 0.7 µL*2, probe 0.125 µL; PDCoV primers 0.5 µL*2, probe 0.125 µL; TGEV primers 0.6 µL*2, probe 0.125 µL.

8. Use of the primer set and probe according to claim 2 or 3 or the kit according to claim 3 or 4 or 5 or 6 in a non-disease diagnostic method for porcine enteric coronavirus, especially in the detection of feed, animal tissue and animal-derived products.

9. The use according to claim 8, characterized in that The kit uses the ddPCR detection method. The reaction conditions for ddPCR detection are: 50°C for 20 min; 95°C for 10 min; 94°C for 30 s, 57°C for 1 min, for a total of 40 cycles; 98°C for 10 min; the heating and cooling rate during the reaction is 2°C / s.

10. A multiplex ddPCR detection method for porcine enteric coronavirus, which is a non-disease diagnostic method, characterized in that: The method comprises the following steps: 1) Weigh 2-3 g of the sample to be tested and homogenize it by adding 1-2 mL of 10 mmol / L phosphate buffer solution (pH 7.2). Centrifuge the homogenized sample and collect the supernatant. 2) extracting nucleic acid from the supernatant by a magnetic bead method, and performing ddPCR detection on the extracted nucleic acid, wherein the primers and probes for ddPCR detection are the primer set and probe according to claim 2 or 3.

Citation Information

Patent Citations

  • A primer set for multiplex RT-PCR detection of TGEV, PEDV, SADS-CoV and PDCoV

    CN110257557B

Cited By

  • Colloidal carbon test strip based on nano antibody and application of colloidal carbon test strip in detection of porcine deltacoronavirus

    CN121114421A