Application of exosome protein in preparation of products for cerebral infarction disease diagnosis, treatment and prognosis evaluation
By isolating exosomes from peripheral plasma of patients with cerebral infarction, and screening out proteins such as RL27A, SPTCS, CCT2, SEPP1, the correlation of exosome proteins in the pathological process of cerebral infarction was solved, and new methods for early diagnosis and treatment of cerebral infarction were achieved.
Patent Information
- Application Number
- CN202510585907.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art has failed to systematically study the correlation between exosome proteins and pathological processes such as immune response, neuroinflammation, differentiation of monocytes, chemotaxis and inflammatory responses of cerebral infarction, and lacks effective diagnostic and therapeutic methods.
By isolating exosomes from peripheral plasma of patients with cerebral infarction, multidimensional liquid chromatography is used to improve purity and yield, mass spectrometry is used to perform proteomic analysis, RL27A, SPTCS, CCT2, SEPP1 and other proteins are screened out, and their impact on monocyte differentiation, inflammatory response and chemotaxis ability is verified, and detection kits and therapeutic drugs are developed.
It provides biomarkers for early diagnosis, pathological staging and prognosis evaluation of cerebral infarction diseases, monitor exosomal protein changes to provide a basis for the evaluation of treatment effects, develop new therapeutic targets and drug delivery systems, and provide strategies for the intervention and treatment of cerebral infarction.
Smart Images

Figure CN120446495A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of bioinformatics, and in particular relates to the application of exosome proteins in the preparation of products for the diagnosis, treatment and prognosis evaluation of cerebral infarction. Background Art
[0002] Cardiovascular disease is the leading cause of death worldwide, with one-third of these deaths related to stroke. Over 13 million new cases of stroke are reported annually, affecting one in four adults over the age of 25. Beyond morbidity, stroke is the second leading cause of death and disability worldwide, killing 5.5 million people annually. Approximately 80% of strokes are caused by cerebral ischemia and are classified as ischemic stroke, also known as cerebral infarction (CI). Approximately two-thirds of ischemic strokes are caused by one of three pathological conditions: atherosclerosis, lipohyalinosis, and cardiac embolism with thrombotic material. The onset of cerebral infarction is associated with environmental, genetic, and patient-specific risk factors. Furthermore, activation of the immune system and the subsequent inflammatory cascade are also associated with an increased risk of cerebral infarction.
[0003] The concept of "neurovascular unit (NVU)" emphasizes the importance of the dynamic interactions and correlations between endothelial cells, vascular smooth muscle cells, astrocytes, microglia, neurons and related tissue matrix proteins to the progression of cerebral infarction. This concept places cerebral infarction in the context of a comprehensive tissue response. In this concept, all cells and matrix elements, not just neurons or blood vessels, are participants in tissue damage. At present, various cells and cytokines in the neurovascular unit have been widely studied, but the specific changes in the vascular microenvironment during cerebral infarction, such as metabolic components, exosomes, and proteins, have not been fully elucidated.
[0004] Monocytes are mononuclear phagocytes originating from the bone marrow and are one of the main components of the innate immune response. Human monocytes are usually divided into three subpopulations: classical subpopulations (CD14 ++ CD16 - ), non-classical subsets (CD14 + CD16 ++ ), and intermediate subsets (CD14 + CD16 + ). Current research shows that pro-inflammatory CCR2 +Monocytes can cross the blood-brain barrier and be recruited to the ischemic area under the chemotactic action of CX3CR1, monocyte chemoattractant protein-1 (MCP-1), and a series of other cytokines. Many studies have shown that blocking the infiltration of classical monocytes can improve the prognosis of cerebral infarction. Modulating monocyte polarization is considered a promising immunotherapy strategy for cerebral infarction, but more clinical studies are needed to confirm this, and the mechanism of monocyte differentiation during the course of cerebral infarction also needs further investigation. The changes in substances in the vascular microenvironment and how they affect the function and differentiation of monocytes during cerebral infarction have not yet been elucidated.
[0005] Exosomes, as important vehicles for intercellular communication, contain a rich array of biomolecules, including proteins, RNA, and lipids, and play a key role in the pathogenesis of many diseases. In recent years, a growing number of studies have demonstrated the role of exosomal proteins in neurological diseases such as cerebral infarction, which has garnered increasing attention. Cerebral infarction is a disease caused by localized blood flow obstruction, leading to brain tissue hypoxia, damage, and cell death, accompanied by complex immune responses and neuroinflammatory processes. The expression patterns of exosomal proteins vary significantly during the acute and recovery phases of cerebral infarction. However, systematic research on the mechanisms of action of exosomal proteins in neurological diseases such as cerebral infarction is currently lacking.
[0006] Chinese patent CN114015759B discloses biomarkers and their applications for assessing the prognosis or recurrence of acute ischemic stroke. By preparing ELISA reagents and RT-qPCR reagents for detecting these biomarkers and using them to detect the expression of the corresponding biomarkers in a subject's plasma proteins or plasma exosomes, the analysis or detection of acute ischemic stroke can be achieved. This not only predicts the risk of acute ischemic stroke in a subject but also monitors the occurrence of acute ischemic stroke in patients or subjects. This contributes to a better understanding of the pathophysiological mechanisms of acute ischemic stroke. The biomarkers described in this patent also include any one or more of the following proteins: F11R, TUBA8, ESD, YWHAZ, VCP, HRNR, CALML5, BST1, BPIFB1, SPINK5, ARSA, GM2A, HBB, TUBA4A, HBD, HBA2, FGC, ABCB9, and APTB. This patent primarily utilizes these proteins as predictive biomarkers for hemorrhagic transformation, for inflammation detection and prognosis in acute ischemic stroke. Although the patent also mentions that some proteins are associated with immune response and inflammation, it does not systematically examine their correlation with pathological processes such as immune response, neuroinflammation, monocyte differentiation, chemotaxis, and inflammatory response in cerebral infarction.
[0007] Chinese patent CN117946967A discloses the use of exosomes produced by human pluripotent stem cell-derived mesenchymal stem cells (MSSCs) in the treatment of stroke. Using these pluripotent stem cell-derived MSSCs as a purely biosynthetic method, concentrated active ingredient miRNAs can be incorporated into exosomes to suppress the expression of the membrane acid receptor Asic1 protein, which plays a key role in neuronal damage during stroke, thereby mitigating neuronal death mediated by activation of this ion channel protein. Also provided are methods for preparing exosomes, pharmaceutical compositions containing exosomes, and the use of exosomes in the preparation of drugs for treating stroke or enhancing the viability of brain tissue cells damaged by middle cerebral artery occlusion. However, the patent does not systematically examine the correlation between exosome proteins and pathological processes such as immune responses, neuroinflammation, monocyte differentiation, chemotaxis, and inflammatory responses in cerebral infarction.
[0008] Chinese patent CN116930512B discloses a biomarker for stroke recurrence risk analysis and its application. The biomarker is a Notch1 ligand. The Notch1 ligand includes one or both of DLL1 and Jagged1. With these biomarkers, a stroke recurrence risk analysis reagent or kit can be prepared to predict the risk of acute ischemic stroke recurrence in a subject, or to monitor the occurrence of acute ischemic stroke recurrence in a patient or subject. However, this patent also does not systematically study the correlation between exosomal proteins and pathological processes such as immune response, neuroinflammation, monocyte differentiation, chemotaxis and inflammatory response in cerebral infarction.
[0009] Chinese patent CN116660549A discloses a method for proteomic analysis of exosomes derived from the nervous system. The method involves first isolating the exosomes from the nervous system, then eluting, enzymatically hydrolyzing, and concentrating them to obtain peptide dry powder, which is then subjected to mass spectrometry detection. By optimizing the separation process and elution method of neural cell exosomes, the separation efficiency of neural cell-derived exosome proteins in blood samples is effectively improved. Proteomic analysis of exosomes is performed based on the optimized FASP method and mass spectrometry detection method, effectively increasing the number of proteins identified in exosomes. This patent primarily addresses the problems of low exosome protein separation efficiency and the small number of proteins identified by mass spectrometry in the prior art. It does not address how to obtain exosome-derived proteins that are related to pathological processes such as immune response, neuroinflammation, monocyte differentiation, chemotaxis, and inflammatory response in cerebral infarction. Summary of the Invention
[0010] The purpose of the present invention is to overcome the defects of the above-mentioned prior art and provide an application of exosome protein in the preparation of products for diagnosis, treatment and prognosis evaluation of cerebral infarction.
[0011] The purpose of the present invention can be achieved by the following technical solutions:
[0012] The present invention first provides the use of exosome proteins in preparing products for diagnosis, treatment and prognosis evaluation of cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
[0013] This study found that the expression of RL27A, SPTCS, CCT2, and SEPP1 in plasma exosomes of patients with acute cerebral infarction was significantly increased, but decreased in the recovery period. + Verification in monocytes revealed that they affect the differentiation, inflammatory and chemotactic functions of monocytes. The four proteins RL27A, SPTCS, CCT2 and SEPP1 can significantly promote the expression of monocyte markers CD14, integrin CD11b and chemokine receptor CCR2 in THP-1 cell lines at the same time.
[0014] In one embodiment of the present invention, there is further provided the use of a reagent for detecting the expression level of exosome proteins in the preparation of a product for diagnosing cerebral infarction, pathological staging, prognosis assessment, or monitoring treatment effects, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2, or SEPP1.
[0015] In one embodiment of the present invention, the product is a detection kit.
[0016] In one embodiment of the present invention, the detection kit uses peripheral plasma as a sample.
[0017] In one embodiment of the present invention, the detection kit further comprises a reagent for separating exosomes from peripheral plasma.
[0018] In one embodiment of the present invention, there is further provided the use of exosome proteins in preparing products for treating cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
[0019] In one embodiment of the present invention, the product is a therapeutic drug.
[0020] In one embodiment of the present invention, there is further provided the use of an agent or drug for regulating the expression level of exosome proteins in the preparation of a product for treating cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
[0021] In one embodiment of the present invention, the product is a therapeutic drug.
[0022] In one embodiment of the present invention, there is further provided the use of exosome proteins in the preparation of products for regulating the differentiation, inflammatory and chemotactic functions of monocytes in patients with cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
[0023] In one embodiment of the present invention, the use of exosome proteins in screening drugs for treating cerebral infarction is further provided, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
[0024] The above technical solution of the present invention is mainly obtained through the following research methods: first, exosomes are efficiently isolated from the peripheral plasma of patients with cerebral infarction; the isolated exosomes are subjected to proteomic analysis to screen for proteins (HRG, GNPTG, RL27A, SPTCS, PTBP1, CCT2, VWF, PLDX1, SEPP1) with significant differences in plasma exosomes between the acute and recovery phases of cerebral infarction; and then the effects of the screened exosome proteins on monocyte differentiation, inflammatory response, and chemotaxis are respectively verified.
[0025] The step of isolating exosomes uses multidimensional liquid chromatography technology. By optimizing conditions to eliminate lipoproteins and other interfering substances, the purity and yield of exosome samples can be improved.
[0026] Specifically, the present invention first uses multidimensional liquid chromatography to efficiently isolate exosomes from the peripheral plasma of patients with cerebral infarction. By optimizing the separation conditions, the purity and yield of the exosomes are ensured for subsequent proteomic analysis. This method effectively removes lipoproteins and other interfering substances, providing high-quality samples for the study of exosomal proteins.
[0027] Exosome proteomic analysis: Mass spectrometry was used to conduct a comprehensive proteomic analysis of the isolated exosomes, identifying proteins that differ significantly between plasma exosomes in the acute and recovery phases of cerebral infarction. These proteins may be closely associated with pathological processes such as immune responses, neuroinflammation, monocyte differentiation, chemotaxis, and inflammatory responses in cerebral infarction. Correlation analysis with clinical data further confirmed the role of these exosomal proteins in the pathogenesis of cerebral infarction.
[0028] Flow cytometry was used to analyze changes in peripheral blood mononuclear cells (PBMCs) in patients with cerebral infarction, primarily examining the distribution characteristics of T lymphocytes, B lymphocytes, dendritic cells, natural killer cells, classical monocytes, non-classical monocytes, and intermediate monocytes. Data obtained showed that compared to the acute phase, the proportion and number of classical monocytes in the peripheral blood of patients in the recovery phase decreased significantly, while the proportion of non-classical monocytes increased significantly. Exosomes and exosomal proteins were isolated and purified from the plasma of patients with cerebral infarction, and an in vitro human cell line model was established to verify this relationship.
[0029] The human monocytic cell line THP-1 was selected as a candidate cell line for this protocol. Its usability was first verified. Different concentrations of phorbol esters and / or lipopolysaccharides, interferon-γ, interleukin-4, and interleukin-13 were used to induce its differentiation into macrophages. The induction efficiency was tested to confirm its differentiation potential. Cells at different differentiation states were stimulated with lipopolysaccharide to verify their responsiveness to the stimulation. Once the differentiation potential and responsiveness were verified, the cells were treated with purified exosomes or proteins to detect changes in the THP-1 cells at the gene and protein levels.
[0030] This application uses in vitro purification of healthy human peripheral blood CD14 + The specific method is to collect peripheral blood mononuclear cells from healthy people and purify CD14 by magnetic bead sorting. + Monocytes are cultured; the candidate proteins are treated therewith, and changes in protein levels are verified by flow cytometry.
[0031] Based on the above scheme, the differentially expressed proteins finally screened included RL27A, SPTCS, CCT2, and SEPP1. These proteins increased significantly in the acute phase of cerebral infarction and decreased significantly in the recovery phase. In addition, the expression of proteins in THP-1 cells and CD14 cells in peripheral blood of healthy subjects was further investigated. + The monocyte model verified the regulatory effects of the above-mentioned exosomal proteins on monocyte differentiation, gene expression and protein level changes.
[0032] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0033] This study found that some exosomal proteins increased significantly during the acute phase of cerebral infarction and decreased significantly during the recovery phase. The transport and delivery of these proteins in exosomes may be closely related to the immune response, monocyte differentiation, inflammatory response, and chemotaxis after cerebral infarction.
[0034] This study found that four exosomal proteins, RL27A, SPTCS, CCT2 and SEPP1, have significant effects on the differentiation, inflammation and chemotaxis of monocytes in the acute phase of cerebral infarction, and may be key regulatory factors in the occurrence and recovery of cerebral infarction.
[0035] Further analysis of the mechanism of action of these exosomal proteins in cerebral infarction can provide new ideas for the early diagnosis, pathological staging, prognosis and targeted treatment of cerebral infarction.
[0036] The exosome proteins obtained based on the present invention can serve as new biomarkers for the early diagnosis, pathological staging, and prognostic assessment of cerebral infarction. Monitoring changes in exosome proteins can provide an important basis for disease management and treatment efficacy assessment in patients with cerebral infarction. In addition, the functional validation results of specific exosome proteins provide theoretical support for the development of new therapeutic targets and drug delivery systems, potentially offering new strategies for the intervention and treatment of cerebral infarction. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 The specific operational procedures for the application of exosome proteins in the pathogenesis of cerebral infarction are provided.
[0038] Figure 2 Figures 2 and 3 illustrate flow cytometric analysis of peripheral blood mononuclear cells in patients with cerebral infarction using the present invention: A. Gating strategy for monocytes in flow cytometry; B. The left figure shows the proportion of the three types of monocytes to the total number of monocytes, and the right figure shows the number of the three types of monocytes; C. The figures show the proportion and number of T lymphocytes, B lymphocytes, NK cells, and dendritic cells, respectively.
[0039] Figure 3 In the present invention, qPCR was used to verify the effects of exosomes on THP-1 at the gene level, including adhesion-related genes, inflammation-related genes, chemotaxis-related genes, and differentiation-related genes.
[0040] Figure 4 In the present invention, flow cytometry was used to verify the effects of nine exosomal proteins on THP-1 at the protein level, including the expression of CD14, CD16, CD11b and CCR2.
[0041] Figure 5 The present invention uses flow cytometry to verify the protein level of four candidate proteins on healthy human CD14 + Effects on monocytes, including expression of CD14 and CD16. DETAILED DESCRIPTION
[0042] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.
[0043] The specific process of application of exosome proteins in the pathogenesis of cerebral infarction provided in the following examples is referenced to Figure 1 .
[0044] Example 1
[0045] To explore the composition of peripheral blood immune cells in clinical patients with cerebral infarction:
[0046] First, blood samples were collected from 54 patients in the acute phase of cerebral infarction and 38 patients in the recovery phase of cerebral infarction at Zhongshan Hospital via the cubital vein. Peripheral blood mononuclear cells (PBMCs) were isolated from the whole blood using density gradient centrifugation. The following steps were used:
[0047] Add Ficoll-paque PREMIUM (1.077 ± 0.01 g / mL) to a 15 mL centrifuge tube. Add the appropriate volume of whole blood at a ratio of 2:1 (blood:Ficoll-paque PREMIUM). Gently add blood to ensure it floats on top of the Ficoll. Set the acceleration to the slowest setting and centrifuge at 3000 rpm for 30 minutes at room temperature.
[0048] After centrifugation, the layers are as follows: plasma, PBMC, Ficoll-paque PREMIUM, and red blood cells. Carefully aspirate the PBMC layer, add PBS and mix well. Centrifuge at 1500 rpm for 5 minutes. Repeat this step twice to ensure no residual extract.
[0049] Remove the supernatant, leaving the PBMCs at the bottom of the tube, add 2 mL of PBS to resuspend, and count the cells;
[0050] After counting, PBMCs were transferred to a U-shaped 96-well plate and subjected to flow cytometry staining. The specific steps are as follows:
[0051] PBMCs were incubated with anti-human CD16 / CD32 monoclonal antibodies at 0.125 μg / sample diluted in PBS and incubated at 4°C for 20 minutes to block the Fc region of the antibody and eliminate nonspecific interference. After 20 minutes, phosphate buffer was added to wash away unbound antibodies.
[0052] Dilute APC-Cy7-conjugated CD45 monoclonal antibody, BV786-conjugated anti-CD19 monoclonal antibody, PerCP-cy5.5-conjugated CD3 monoclonal antibody, BV711-conjugated CD56 monoclonal antibody, BV421-conjugated CD1c monoclonal antibody, BV605-conjugated CD14 monoclonal antibody, FITC-conjugated CD16 monoclonal antibody, AF700-conjugated CD4 monoclonal antibody, and BV510-conjugated CD8 monoclonal antibody at 1:200, incubate at 4°C for 20 minutes, and wash away any unbound antibodies.
[0053] After resuspending the cells in 200 μL, sample data were collected on a BD FACSymphony™ A1 flow cytometer. Flow cytometric analysis was performed using FlowJo software (see below for gating strategies). After exporting the data, statistical analysis was performed using Graphpad Prism software, and significance was analyzed using a two-way ANOVA (*p < 0.05, **p < 0.01).
[0054] Figure 2 A is the monocyte gating strategy; monocytes are divided into three groups using CD14 and CD16: CD14 ++ CD16 - Classical monocytes (cell populations that highly express CD14 but do not express or express low levels of CD16), CD14 + CD16 + Intermediate monocytes (cell population expressing both CD14 and CD16), and CD14 - CD16 ++ Non-classical monocytes (cell populations that highly express CD16 but lack or low CD14 expression). It is generally believed that classical monocytes contribute to the host's pro-inflammatory defense mechanisms, intermediate monocytes are associated with antigen presentation, and non-classical monocytes play a role in vascular patrol and surveillance.
[0055] The result is as follows Figure 2 B, Compared with patients in the recovery period, patients in the acute phase had pro-inflammatory CD14 ++ CD16 + The proportion and absolute number of classical monocytes were significantly higher than those in patients in the recovery phase. - CD16 ++ The proportion of non-classical monocytes was significantly lower than that of patients in the recovery phase. This data indicates that the increase of classical monocytes in patients with acute cerebral infarction may aggravate the inflammatory response of patients with cerebral infarction and lead to the worsening of the course of cerebral infarction.
[0056] Many studies have reported on how monocytes function during cerebral infarction, and studies have shown that inhibiting monocyte infiltration can be used as an intervention for cerebral infarction; however, the changes in substances in the vascular microenvironment and how these substances affect the function and differentiation of monocytes during cerebral infarction have not been elucidated.
[0057] Example 2
[0058] To investigate whether exosomes produced by the plasma of patients in the acute phase of cerebral infarction cause changes in THP-1 mRNA in human monocytes:
[0059] First, verify whether the in vitro human monocytic cell line can be used as an in vitro model. The specific steps are as follows:
[0060] Different concentrations of phorbol ester (100 ng / mL, 50 ng / mL, 25 ng / mL) were used to induce THP-1 cells to differentiate into macrophages (M0), and the induction efficiency of THP-1 was detected;
[0061] After inducing THP-1 to M0, lipopolysaccharide (100 ng / mL), interferon-γ (20 ng / mL), or interleukin-4 (20 ng / mL), or interleukin-13 (20 ng / mL) were added in the presence of phorbol ester to polarize them toward type 1 macrophages and type 2 macrophages, respectively. The cells were collected and their polarization efficiency was verified at the gene and protein levels using qPCR and flow cytometry, respectively. qPCR mainly selected genes such as CD14, CD16, CCR2, CCL2, CD68, CX3CR1, CSF1R, CD11c, and HLA-DMA, while flow cytometry mainly selected marker proteins such as CD14, CD16, MHCII, CCR2, and CD11b.
[0062] The THP-1 cell line and M0 cells induced by phorbol ester were stimulated with lipopolysaccharide. After stimulation, qPCR was used to verify the response of THP-1 to lipopolysaccharide (LPS) stimulation, mainly selecting inflammatory factors such as IL-1β, IL-6, TNF-α, and IL-8 for verification;
[0063] After the differentiation potential and responsiveness of THP-1 to stimulation are verified, the role of candidate proteins will be studied. The specific steps are as follows:
[0064] THP-1 cells were cultured in T25 flasks with 10 mL of RPMI-1640, 10% fetal bovine serum, 1% penicillin-streptomycin, and 0.05 mM β-mercaptoethanol. When THP-1 cells were in the logarithmic growth phase, 1.5 × 105 cells were seeded into 48-well plates.
[0065] Plasma exosomes from healthy individuals and patients in the acute or recovering stages of cerebral infarction were added to a 300 μL cell culture system. Exosomes were quantified using bovine serum albumin (BSA) protein, resulting in a final exosome concentration of approximately 0.3 μg / μL. Cells were cultured for 12 hours, harvested, and RNA extracted for concentration and purity. Reverse transcription was then performed to generate cDNA for real-time quantitative PCR, primarily to investigate whether exosomes affect monocyte adhesion, chemotaxis, inflammation, and differentiation. Primer sequences for different genes are shown in Table 1, and the RT-qPCR amplification system is shown in Table 2.
[0066] Table 1 Primer sequences
[0067] Genes Forward(5’-3’) Reverses(5’-3’) β-ACTIN CATTGCTGACAGGATGCAGAAGG TGCTGGAAGGTGGACAGTGAGG CD40 CCTGTTTGCCATCCTCTTGGTG AGCAGTGTTGGAGCCAGGAAGA PSGL1 GAACCTGTCCACGGATTCAGCA GTCAGTCGAGTTGTCTGTGCCT ITGA5 GCCGATTCACATCGCTCTCAAC GTCTTCTCCACAGTCCAGCAAG ITGB1 GGATTCTCCAGAAGGTGGTTTCG TGCCACCAAGTTTCCCATCTCC MMP2 AGCGAGTGGATGCCGCCTTTAA CATTCCAGGCATCTGCGATGAG MMP9 GCCACTACTGTGCCTTTGAGTC CCCTCAGAGAATCGCCAGTACT F3 CAGAGTTCACACCTTACCTGGAG GTTGTTCCTTCTGACTAAAGTCCG F5 GCCAGACCTTGCTGGAAAATGG CCAACCTCTGTGTTTAGGAGCC IL-1β CCACAGACCTTCCAGGAGAATG GTGCAGTTCAGTGATCGTACAGG TNF-α TCCTTCCTGATCGTGGCA TGAAGAGGACCTGGGAGTAGAT IL-18 GATAGCCAGCCTAGAGGTATGG CCTTGATGTTATCAGGAGGATTCA IL-12 TGCCTTCACCACTCCCAAAACC CAATCTCTTCAGAAGTGCAAGGG NLRP3 GGACTGAAGCACCTGTTGTGCA TCCTGAGTCTCCCAAGGCATTC IL-8 ACACTGCGCCAACACAGAAATTA TTTGCTTGAAGTTTCACTGGCATC CCL2 AGAATCACCAGCAGCAAGTGTCC TCCTGAACCCACTTCTGCTTGG CCR2 CAGGTGACAGAGACTCTTGGGA GGCAATCCTACAGCCAAGAGCT CCL5 CCTGCTGCTTTGCCTACATTGC ACACACTTGGCGGTTCTTTCGG CCR5 TCTCTTCTGGGCTCCCTACAAC CCAAGAGTCTCTGTCACCTGCA CD11b GGAACGCCATTGTCTGCTTTCG ATGCTGAGGTCATCCTGGCAGA CD14 CTGGAACAGGTGCCTAAAGGAC GTCCAGTGTCAGGTTATCCACC CD16 GGTGACTTGTCCACTCCAGTGT ACCATTGAGGCTCCAGGAACAC CD68 CGAGCATCATTCTTTCACCAGCT ATGAGAGGCAGCAAGATGGACC NF-κB GCAGCACTACTTCTTGACCACC TCTGCTCCTGAGCATTGACGTC CX3CR1 CACAAAGGAGCAGGCATGGAAG CAGGTTCTCTGTAGACACAAGGC CD11c GATGCTCAGAGATACTTCACGGC CCACACCATCACTTCTGCGTTC CSF1R GCTGCCTTACAACGAGAAGTGG CATCCTCCTTGCCCAGACCAAA CD62L TCACAGTGTGCCTTCAGCTGCT TCTGGTGCTGATAGAGGCTCAC HLA-DMA GTTCTGCGAGTGGATGATCCAG TGTTGGGCTTGCCAAACTCCAG
[0068] Specifically, the forward primers and reverse primers of β-ACTIN, CD40, PSGL1, ITGA5, ITGB1, MMP2, MMP9, F3, F5, IL-1β, TNF-α, IL-18, IL-12, NLRP3, IL-8, CCL2, CCR2, CCL5, CCR5, CD11b, CD14, CD16, CD68, NF-κB, CX3CR1, CD11c, CSF1R, CD62L, and HLA-DMA are shown as SEQ ID NO.1 to SEQ ID NO.58, respectively.
[0069] Table 2 RT-qPCR amplification system
[0070] SYBR Green Master Mix(No Rox) 5μL Water Nuclease-Free 3μL Primer F 200nM Primer R 200nM cDNA 1μL
[0071] The results are as follows Figure 3 As shown, compared with the healthy control group, the expression of inflammatory cytokines IL-1β, TNF-α and chemokines and their receptors IL-8, CCL2, CCL5 and CCR5 were significantly upregulated in THP-1 cells treated with plasma exosomes from patients in the acute phase of cerebral infarction, while the gene expression levels of these factors after treatment with exosomes from the recovery phase were not significantly different from those in the healthy control group. In addition, compared with cells treated with exosomes from patients in the acute phase of cerebral infarction, the adhesion-related gene ITGA5 was significantly downregulated in cells treated with plasma exosomes from patients in the recovery phase.
[0072] The results showed that during cerebral infarction, the patient's plasma exosomes enhanced the chemotaxis of monocytes and secreted more chemokines, causing monocytes to migrate to tissues during cerebral infarction and differentiate into pro-inflammatory monocytes.
[0073] Example 3
[0074] To investigate whether purified exosomal proteins cause changes in THP-1 protein levels in human monocytes.
[0075] Based on the THP-1 cell system established in Example 2, and the nine exosome proteins that were previously screened using proteomics and significantly increased in the acute phase of cerebral infarction (see Table 3 for the names of exosome proteins), this section verified the effects of purified exosome proteins on the THP-1 monocytic cell line.
[0076] Table 3 Exosome protein names
[0077] Abbreviation Full name Entry HRG Histidine-rich glycoprotein P04196 GNPTG N-acetylglucosamine-1-phosphotransferase subunit Q9UJJ9 RL27A Large ribosomal subunit protein uL15 P46776 SPTCS Spatacsin Q96JI7 VWF Von Willebrand factor P04275 PLDX1 Plexin domain-containing protein 1 Q8IUK5 CCT2 T-complex protein 1subunit beta P78371 PTBP1 Polypyrimidine tract-binding protein 1 P26599 SEPP1 Selenoprotein P1 P49908
[0078] The specific steps are as follows:
[0079] The above 9 proteins were dissolved in phosphate buffer as stock solutions and stored at −80°C;
[0080] When THP-1 was in the logarithmic growth phase, cells were plated and cultured in RPMI-1640 medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. A blank control group was set up, that is, no treatment was performed except for the culture medium, FBS, and double antibody. The remaining groups were treated with the above 9 proteins (1 μg / mL) for 48 hours, and the cells were collected; anti-human CD16 / CD32 monoclonal antibody was diluted at a ratio of 1:200 and incubated at 4°C for 20 minutes to block the antibody Fc segment and eliminate nonspecific interference. After 20 minutes, phosphate buffer was added to wash away unbound antibodies;
[0081] Dilute BV605-conjugated CD14 monoclonal antibody, BV650-conjugated anti-CD16 monoclonal antibody, APC-conjugated CCR2 monoclonal antibody, and BV711-conjugated CD11b monoclonal antibody at 1:200, incubate at 4°C for 20 minutes, and wash away unbound antibodies.
[0082] After resuspending the cells in a volume of 200 μL, sample data were collected on a BD FACSymphony™ A1 flow cytometer and analyzed using FlowJo software.
[0083] The results are as follows Figure 4 As shown, compared with the blank control group, the expression of monocyte marker CD14 in THP-1 cells was significantly increased after treatment with purified proteins RL27A, SPTCS, PLDX1, CCT2, PTBP1, and SEPP1; the expression of integrin CD11b in THP-1 cells was significantly increased after treatment with purified proteins GNPTG, RL27A, SPTCS, CCT2, and SEPP1; the expression of chemokine receptor CCR2 in THP-1 cells was significantly increased after treatment with purified proteins HRG, VWF, PLDX1, PTBP1, and SEPP1.
[0084] These results highlight that the screened exosomal proteins significantly affect different surface markers of THP-1 cells, suggesting that these proteins may regulate monocyte chemotaxis, activation, and differentiation through different pathways;
[0085] The above results show that the four proteins RL27A, SPTCS, CCT2, and SEPP1 can significantly promote the expression of monocyte markers CD14, integrin CD11b, and chemokine receptor CCR2 in the THP-1 cell line at the same time. Therefore, the verification of exosomal proteins that affect patient monocytes in the acute phase of cerebral infarction will focus on these four proteins.
[0086] Example 4
[0087] To investigate the effects of candidate proteins on human peripheral blood mononuclear cells.
[0088] Four exoproteins with significant effects on monocytic cell lines were screened from the THP-1 cell line: RL27A, SPTCS, CCT2, and SEPP1. Given that cell lines cannot fully mimic in vivo cell states, monocytes were purified from human peripheral blood and treated with the candidate proteins to verify their functions.
[0089] First, human monocytes were purified as follows:
[0090] Whole blood was collected from healthy subjects, and human peripheral blood mononuclear cells were extracted according to the method in Example 1;
[0091] Extracted PBMCs were incubated on ice for 30 minutes with an anti-human CD14 monoclonal antibody conjugated to superparamagnetic microparticles (purchased from Miltenyi Biotec GmbH (Gladbach, Germany)) to allow CD14-positive monocytes to bind to the antibody magnetic beads. The separation column was placed in a magnetic field separator, and the incubated cell suspension was added. The separation column was then rinsed with buffer to retain the labeled cells in the separation column while washing away the unbound cells.
[0092] The cells in the sorting column were collected, unbound magnetic beads were washed away, and the purity of CD14-positive cells was greater than 95% by flow cytometry. The purified cells were seeded into 96-well plates and cultured in RPMI-1640 medium, 10% fetal bovine serum, and 1% penicillin-streptomycin. A blank control group and an experimental group were set up. The blank control group received no treatment, while the experimental groups were cultured with the candidate proteins RL27A, SPTCS, CCT2, and SEPP1 at a final concentration of 1 μg / mL for 48 hours.
[0093] After 48 hours, the cells were digested with trypsin in a 37°C incubator for 5 minutes and collected;
[0094] Anti-human CD16 / CD32 monoclonal antibody was diluted 1:200 and incubated at 4°C for 20 minutes to block the Fc region of the antibody and eliminate nonspecific interference. After 20 minutes, phosphate buffer was added to wash away unbound antibody.
[0095] Dilute BV605-conjugated CD14 monoclonal antibody and BV650-conjugated anti-CD16 monoclonal antibody at 1:200, incubate at 4°C for 20 minutes, and wash away the bound antibodies;
[0096] After resuspending the cells in a volume of 200 μL, sample data were collected on a BD FACSymphony™ A1 flow cytometer and analyzed using FlowJo software.
[0097] The results are as follows Figure 5 As shown, compared with the blank control group, after treatment with purified proteins RL27A, SPTCS, and CCT2, CD14 +The expression of monocyte marker CD14 increased significantly, while the expression of CD16 decreased. The changes of these two markers were consistent with the changes of monocytes in the acute and recovery phases of cerebral infarction patients, that is, the expression of CD14 in acute phase patients was significantly increased. ++ CD16 + The number of inflammatory classical monocytes increased significantly compared with the patients in the recovery period, and CD14 - CD16 ++ The number of non-classical monocytes decreased significantly compared with that of patients in the recovery period.
[0098] Combining the above methods and data, we can first determine the changes in peripheral blood monocytes in patients with cerebral infarction during the acute and recovery phases; then screen out 9 exosome proteins that are significantly increased in plasma exosomes of patients with cerebral infarction during the acute phase but decreased during the recovery phase. + Validation in monocytes revealed that these proteins affect monocyte differentiation, inflammatory and chemotactic functions, with four exosomal proteins, RL27A, SPTCS, CCT2, and SEPP1, having the most significant effects. This provides new insights into the pathogenesis of cerebral infarction and potential drug targets.
[0099] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.
Claims
1. Use of a reagent for detecting exosome protein expression levels in the preparation of a product for diagnosing cerebral infarction, pathological staging, prognosis assessment, or monitoring treatment effects, characterized in that: The exosomal protein is selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
2. The use according to claim 1, characterized in that The product is a detection kit.
3. The use according to claim 2, characterized in that The detection kit uses peripheral plasma as a sample.
4. The use according to claim 3, characterized in that The detection kit also includes a reagent for separating exosomes from peripheral plasma.
5. The use of exosome proteins in the preparation of products for diagnosis, treatment and prognosis assessment of cerebral infarction, characterized in that: The exosomal protein is selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
6. The use according to claim 5, characterized in that The use of exosome proteins in the preparation of products for treating cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
7. The use according to claim 6, characterized in that The product described is a therapeutic drug.
8. The use according to claim 5, characterized in that The invention relates to the use of exosome proteins in the preparation of products for regulating the differentiation, inflammatory and chemotactic functions of monocytes in patients with cerebral infarction, wherein the exosome proteins are selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
9. Use of an agent or drug for regulating the expression level of exosome proteins in the preparation of a product for treating cerebral infarction, characterized in that: The exosomal protein is selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
10. Application of exosome proteins in screening drugs for treating cerebral infarction, characterized in that: The exosomal protein is selected from one or a combination of RL27A, SPTCS, CCT2 or SEPP1.
Citation Information
Patent Citations
Biomarkers for prognostic or recurrence warning assessment of acute ischemic stroke and their applications
CN114015759B
Proteomics analysis method of nervous system-derived exosome
CN116660549A
A biomarker for stroke recurrence risk analysis and its application
CN116930512B
Application of exosome generated by human pluripotent stem cell-derived mesenchymal stem cells in treatment of cerebral apoplexy
CN117946967A