Antibodies against hematologic cancer

Abstract

The present invention relates to an antibody or a functional fragment thereof that recognizes HLA-DR, a chimeric antigen receptor that holds the antibody or the functional fragment thereof, and an immune cell that expresses the chimeric antigen receptor. A multispecific antibody containing the antibody or a functional fragment thereof and an antigen recognition site for an immune cell; or a pharmaceutical composition containing these antibodies or the like.

Description

Technical Field

[0001] The present invention relates to antibodies against blood cancers. More specifically, it relates to antibodies or functional fragments thereof that recognize HLA-DR. Furthermore, the present invention relates to chimeric antigen receptors that retain such antibodies or functional fragments thereof, or immune cells that express such chimeric antigen receptors. Furthermore, the present invention relates to multispecific antibodies comprising such antibodies or functional fragments thereof and antigen recognition sites for immune cells. Furthermore, the present invention relates to pharmaceutical compositions containing such antibodies and the like. Background Art

[0002] Acute myeloid leukemia (AML) is a representative type of blood cancer. When chemotherapy fails to cure AML, allogeneic hematopoietic stem cell transplantation is used, and while many patients have been cured, many others remain uncured. Immunotherapy using chimeric antigen receptor T (CAR-T) cells is a promising strategy for curing these patients.

[0003] CD19 CAR-T cells have shown significant effects on relapsed / refractory B-cell leukemia and malignant lymphoma (Non-Patent Documents 1 and 2). However, CAR-T cells that are effective for AML do not yet exist. Although CAR-T cells for AML have been developed using CD33, CD123, etc. as targets, their expression is observed in a portion of normal blood cells, resulting in problems such as strong blood toxicity (Non-Patent Documents 3 and 4).

[0004] Therefore, efforts are underway worldwide to identify AML-specific cell surface antigens useful for CAR-T therapy. However, despite extensive efforts using comprehensive approaches such as transcriptome and proteome analysis, no promising targets have been identified (Non-Patent Document 5).

[0005] Prior art literature

[0006] Non-patent literature

[0007] Non-Patent Literature 1: Schuster SJ, Bishop MR, Tam CS, Waller EK, Borchmann P, McGuirk JP, et al. Tisagenlecleucel in Adult Relapsed or Refractory Diffuse Large B-Cell Lymphoma. N Engl J Med. 2019; 380(1): 45-56.

[0008] Non-Patent Document 2: Park JH, Riviere I, Gonen M, Wang X, Senechal B, Curran KJ, et al. Long-Term Follow-up of CD19 CAR Therapy in Acute Lymphoblastic Leukemia. N Engl J Med. 2018;378(5):449-59.

[0009] Non-Patent Document 3: Wang, Q.S., Y. Wang, H.Y. Lv, Q.W. Han, H. Fan, B. Guo, L.L. Wang, and W.D. Han. 2015. Treatment of CD33-directed chimeric antigen receptor-modified T cells in one patient with relapsed and refractory acute myeloid leukemia. Mol Ther 23:184-191.

[0010] Non-Patent Document 4: Loff, S., J. Dietrich, J.E. Meyer, J. Riewaldt, J. Spehr, M. von Bonin, C. Grunder, M. Swayampakula, K. Franke, A. Feldmann, M. Bachmann, G. Ehninger, A. Ehninger, and M. Cartellieri. 2020. Rapidly Switchable Universal CAR-T Cells for Treatment of CD123-Positive Leukemia. Mol Ther Oncolytics 17:408-420.

[0011] Non-patent literature 5: Perna F, Berman SH, Soni RK, Mansilla-Soto J, Eyquem J, Hamieh M, et al. Integrating Proteomics and Transcriptomics for SystematicCombinatorial Chimeric Antigen Receptor Therapy of AML. Cancer Cell. 2017; 32(4): 506-19 e5.

[0012] Non-patent document 6: Hasegawa K, Ikeda S, Yaga M, Watanabe K, Urakawa R, Iehara A, et al. Selective targeting of multiple myeloma cells with a monoclonalantibody recognizing the ubiquitous protein CD98 heavy chain. Sci TranslMed. 2022; 14(632): eaax7706.

[0013] Non-patent literature 7: Hosen N, Matsunaga Y, Hasegawa K, Matsuno H, Nakamura Y, Makita M, et al. The activated conformation of integrin beta7 is a novelmultiple myeloma-specific target for CAR T cell therapy. Nat Med. 2017; 23(12): 1436-43. Summary of the Invention

[0014] Problems to be solved by the invention

[0015] The present invention has been made in view of the problems existing in the above-mentioned prior art, and its purpose is to identify cell surface antigens that are specific to blood cancers such as AML, and to provide antibodies or functional fragments thereof that recognize these antigens, as well as effective means for immunotherapy against blood cancers using these antibodies.

[0016] Methods used to solve problems

[0017] The present inventors have previously discovered that even if a protein itself is not cancer-specific, cancer-specific epitopes formed by post-translational changes in the protein may become targets for immunotherapy (Non-Patent Documents 6 and 7).

[0018] Therefore, to achieve the above-mentioned purpose, the present inventors aim to produce a variety of antibodies that bind to AML cells and identify AML-specific antibodies from them, identify their recognition antigens, and use this strategy to isolate AML-specific antibodies and develop CAR-T cells based on them.

[0019] Specifically, approximately 14,000 hybridomas were first established that secrete monoclonal antibodies (mAbs) that bind to bone marrow (BM) cells from AML patients or various AML cell lines. From these mAbs, 1,078 mAbs that do not bind to cells other than B cells in peripheral blood mononuclear cells (PBMCs) from healthy donors were selected. Furthermore, BM cells from AML patients were stained with these candidate mAbs, ultimately identifying 32 clones of mAbs that specifically bind to AML.

[0020] Next, we used one of these clones, KG2032, to identify the antigen recognized by the antibody, using the loss of binding to lymphoma cells (Daudi cells) that had undergone comprehensive gene knockout using the CRISPR-Cas9 system as an indicator. The results revealed that the antigen recognized by KG2032 was HLA-DR. Furthermore, it was discovered that eight of the 32 clones, distinct from KG2032, also recognized HLA-DR.

[0021] Furthermore, since HLA-DR is a highly polymorphic molecule, we investigated which allele of HLA-DR KG2032 could recognize. 0405, 0410, 0701, 0803, 0901, 1201 or 1454 chronic myeloid leukemia cell line (K562 cells), on the other hand, KG2032 does not bind to HLA-DRB1 expression 0101, 0301, 0403, 0404, 0802, 1101, 1301, 1302, 1403, 1405, 1406, 1501 or 1502 of K562 cells.

[0022] It was also found that KG2032 does not bind to some monocytes and T cells expressing HLA-DR.

[0023] In addition, the amino acid sequence of the variable region of KG2032 was determined, and a chimeric antigen receptor fused with CD28 and CD3ζ, or CD8α, 4-1BB and CD3ζ in this region was designed. Then, T cells (CAR-T cells) expressing the chimeric antigen receptor were prepared and co-cultured with a cell line (KG1a cell) from human acute myeloid leukemia. It was found that the above-mentioned CAR-T cells produced cytokines such as IFN-γ and IL-2, and also showed cell killing activity. It was further found that the result of administering the above-mentioned CAR-T cells to mice transplanted with KG1a cells was a significant anti-tumor effect.

[0024] Furthermore, a vector for co-expressing a chimeric antigen receptor fused with CD28 and CD3ζ in the variable region of KG2032 and IL-15 was prepared. Then, NK cells (CAR-NK cells) expressing the chimeric antigen receptor were prepared and co-cultured with a cell line (KG1a cells) from human acute myeloid leukemia. It was found that the above-mentioned CAR-NK cells showed cell killing activity. It was also found that the result of administering the above-mentioned CAR-NK cells to mice transplanted with KG1a cells was a significant anti-tumor effect.

[0025] Based on these results, the inventors discovered that the following utilization modes (1) and (2) can be achieved by using an HLA-DR-recognizing antibody such as KG2032 in the treatment of hematological cancer, thereby completing the present invention.

[0026] (1) It is believed that by using anti-HLA-DR antibodies, in patients with AML who have relapsed after HLA-DR-mismatched allogeneic transplantation, when the HLA-DR type of the recipient (leukemia patient) is positive for the anti-HLA-DR antibody and the HLA-DR type of the donor is negative for the anti-HLA-DR antibody, CAR-T cells derived from the anti-HLA-DR antibody produced by T cells from the transplanted patient himself or the donor will specifically attack the leukemia of the recipient.

[0027] (2) It is believed that by using anti-HLA-DR antibodies that bind only to a portion of normal blood cells, such as B cells, and only to a portion of hematopoietic stem cells, which are the source of all blood cells, even if conventional autologous CAR-T cells of AML patients with HLA-DR type who are positive for the anti-HLA-DR antibodies are used for treatment, leukemia cells will be eliminated, while normal hematopoiesis will be maintained by the anti-HLA-DR antibody-negative cells, thus achieving therapeutic efficacy.

[0028] That is, the present invention provides the following aspects.

[0029] [1] A composition for treating blood cancer, comprising an antibody that recognizes HLA-DR or a functional fragment thereof.

[0030] [2] A composition for administration to a blood cancer patient transplanted with hematopoietic stem cells, comprising an antibody recognizing HLA-DR or a functional fragment thereof,

[0031] The donor of the hematopoietic stem cells and the patient have different HLA-DR allele types.

[0032] The antibody or functional fragment thereof binds to the HLA-DR of the patient and does not bind to the HLA-DR of the donor.

[0033] [3] The composition according to [1] or [2], wherein the antibody or a functional fragment thereof recognizes HLA-DRB.

[0034] [4] The composition according to [1] or [2], wherein the antibody or a functional fragment thereof recognizes HLA-DRB1.

[0035] [5] The composition according to [1] or [2], wherein the antibody or its functional fragment is a member selected from the group consisting of HLA-DRB1 0405, HLA-DRB1 0410, HLA-DRB1 0701, HLA-DRB1 0803, HLA-DRB1 0901, HLA-DRB1 1201、HLA-DRB1 1454、HLA-DRB1 0101, HLA-DRB1 0301, HLA-DRB1 0403, HLA-DRB1 0404, HLA-DRB1 0802, HLA-DRB1 1101、HLA-DRB1 1301、HLA-DRB1 1302, HLA-DRB1 1403, HLA-DRB1 1405, HLA-DRB1 1406, HLA-DRB1 1501 and HLA-DRB1 The 1502 group consists of at least one HLA-DRB1 allele type.

[0036] [6] The composition according to [1] or [2], wherein the antibody or functional fragment thereof binds to an HLA-DRB1 allele in which the amino acid at position 86 is other than aspartic acid, and does not bind to an HLA-DRB1 allele in which the amino acid at position 86 is aspartic acid.

[0037] [7] The composition according to [1] or [2], wherein the antibody or its functional fragment is a member selected from the group consisting of HLA-DRB1 0405, HLA-DRB1 0410, HLA-DRB1 0701, HLA-DRB1 0803, HLA-DRB1 0901, HLA-DRB1 1201 and HLA-DRB1 1454, and does not bind to at least one HLA-DRB1 allele selected from the group consisting of HLA-DRB1 0101, HLA-DRB1 0301, HLA-DRB1 0403, HLA-DRB1 0404, HLA-DRB1 0802, HLA-DRB1 1101、HLA-DRB1 1301、HLA-DRB1 1302, HLA-DRB1 1403, HLA-DRB1 1405, HLA-DRB1 1406, HLA-DRB1 1501 and HLA-DRB1 The 1502 group consists of at least one HLA-DRB1 allele type.

[0038] [8] The composition according to any one of [1] to [7], comprising immune cells expressing a chimeric antigen receptor that retains the antibody or a functional fragment thereof.

[0039] [9] The composition according to [8], wherein the immune cells are prepared from cells derived from a donor of the hematopoietic stem cells.

[0040]

[10] The composition according to [9], wherein the cells derived from the donor of the hematopoietic stem cells are pluripotent stem cells.

[0041]

[11] The composition according to any one of [1] to [7], comprising a multispecific antibody that retains the above-mentioned antibody or a functional fragment thereof and an antigen recognition site for immune cells.

[0042]

[12] The composition according to any one of [1] to [7], wherein the antibody or functional fragment thereof does not bind to a portion of normal blood cells.

[0043]

[13] The composition according to any one of [1] to [7], wherein the antibody or functional fragment thereof does not bind to monocytes.

[0044]

[14] The composition according to

[13] , comprising immune cells expressing a chimeric antigen receptor that retains the above-mentioned antibody or a functional fragment thereof.

[0045]

[15] The composition according to

[13] , comprising a multispecific antibody comprising the above-mentioned antibody or a functional fragment thereof and an antigen recognition site for immune cells.

[0046]

[16] An antibody or a functional fragment thereof that recognizes HLA-DR, which binds to a region of the HLA-DRB1 sequence comprising amino acids 74 to 89 in which the amino acid at position 86 is an amino acid other than aspartic acid, and does not bind to a region of the HLA-DRB1 sequence comprising amino acids 74 to 89 in which the amino acid at position 86 is aspartic acid.

[0047]

[17] An antibody or a functional fragment thereof that recognizes HLA-DR, having any of the following characteristics (a) to (i):

[0048] (a) having heavy chain variable regions comprising complementarity determining regions 1 to 3 comprising the amino acid sequences set forth in SEQ ID NOs: 1 to 3, respectively, and light chain variable regions comprising complementarity determining regions 1 to 3 comprising the amino acid sequences set forth in SEQ ID NOs: 5 to 7, respectively;

[0049] (b) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 34 to 36, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 38 to 40, respectively;

[0050] (c) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 42 to 44, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 46 to 48, respectively;

[0051] (d) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 50 to 52, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 54 to 56, respectively;

[0052] (e) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 58 to 60, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively;

[0053] (f) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 66 to 68, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively;

[0054] (g) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 70 to 72, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively;

[0055] (h) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 74 to 76, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively;

[0056] (i) A heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 66 to 68, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62, 78, and 64, respectively.

[0057]

[18] A chimeric antigen receptor that retains the antibody or functional fragment thereof described in

[16] or

[17] .

[0058]

[19] An immune cell expressing a chimeric antigen receptor that retains the antibody or functional fragment thereof described in

[16] or

[17] .

[0059]

[20] The immune cell according to

[19] , wherein the antibody or functional fragment thereof according to

[16] or

[17] does not bind.

[0060]

[21] The immune cell according to

[19] or

[20] , which is at least one cell selected from the group consisting of T cells, NK cells, and NKT cells.

[0061]

[22] A pharmaceutical composition comprising the antibody or functional fragment thereof described in

[16] or

[17] or the immune cell described in any one of

[19] to

[21] .

[0062]

[23] The pharmaceutical composition according to

[22] , which is used for treating blood cancer.

[0063]

[24] The pharmaceutical composition according to

[23] , wherein the immune cells are prepared from cells derived from a person other than the hematological cancer patient to be treated.

[0064]

[25] The pharmaceutical composition according to

[23] , wherein the immune cells are prepared from cells collected from a patient with blood cancer who is the treatment target.

[0065]

[26] A method for producing the pharmaceutical composition of

[23] , comprising the steps of: modifying immune cells to which the antibody or functional fragment thereof of

[16] or

[17] does not bind, so that the cells express the chimeric antigen receptor of

[18] .

[0066]

[27] The method according to

[26] , wherein the immune cells are cells from a person different from the blood cancer patient to be treated.

[0067]

[28] The method according to

[26] , wherein the immune cells are cells collected from a blood cancer patient who is the treatment target.

[0068]

[29] The method according to any one of

[26] to

[28] , wherein the immune cell is at least one cell selected from the group consisting of T cells, NK cells, and NKT cells.

[0069] Effects of the Invention

[0070] According to the present invention, the above-mentioned diseases can be treated by targeting HLA-DR, a blood cancer-specific cell surface antigen, and using antibodies or functional fragments thereof that recognize the antigen, or chimeric antigen receptors that retain the same.

[0071] In particular, the antibodies can exhibit allele specificity for HLA-DR. Therefore, in patients with hematological cancer who have relapsed after HLA-DR-mismatched allogeneic transplantation, if the recipient (hematological cancer patient) has HLA-DR that is positive for the antibodies of the present invention and the donor has HLA-DR that is not bound by the antibodies of the present invention, CAR-T cells derived from the antibodies of the present invention, produced from donor-derived cells containing pluripotent stem cells, can specifically attack the recipient's hematological cancer.

[0072] In addition, in conventional treatment using autologous CAR-T cells, etc., for patients with blood cancer who have positive HLA-DR to which the antibodies of the present invention bind, even when the antibodies of the present invention are used, blood cancer cells are eliminated, and normal hematopoiesis is maintained using negative cells to which the antibodies of the present invention do not bind, thereby enabling treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1A This figure shows the results of flow cytometric analysis of the binding of KG2032 to healthy human peripheral blood. In the figure, T represents T cells, B represents B cells, Mo represents monocytes, and Neu represents neutrophils.

[0074] Figure 1B This figure shows the results of flow cytometric analysis of the binding of KG2032 to AML samples. Case numbers (unique patient numbers: UPN) 1 to 14 represent leukemia cells derived from each AML patient.

[0075] Figure 2A This is a diagram showing an overview of the steps for identifying antigens recognized by KG2032 using a CRISPR guide RNA (gRNA) library.

[0076] Figure 2B The results show that KG2032 was analyzed by flow cytometry. Figure 2A More specifically, the results of the binding of Cas9 to Daudi cells were shown. Figure 2A The cell fractions with decreased KG2032 binding were sorted after the gRNA library shown. The results of KG2032 binding analysis of cells before and after sorting are shown.

[0077] Figure 2C This is a graph showing the frequencies of gRNA introduced into cells after and before sorting, plotted above.

[0078] Figure 2D The graph shows the results of flow cytometric analysis of the binding of KG2032 or a conventional anti-HLA-DR antibody (L243) to Daudi cells in which the HLA-DR molecule was knocked out.

[0079] Figure 2E The graph shows the results of flow cytometric analysis of the binding of KG2053, KG1982, KG19122, KG19130, KG19214, KG19833, aAML191870, or aAML191872 to HLA-DR knockout Daudi cells.

[0080] Figure 3 This figure shows the results of flow cytometric analysis of the binding of KG2032 or L243 to K562 cells expressing various HLA-DRB1 molecules.

[0081] Figure 4A The graph shows the results of flow cytometric analysis of the binding of KG2032 or L243 to various peripheral blood fractions of a healthy person (donor 1) with KG2032-negative HLA-DRB1 (0403 / 0802) or various peripheral blood fractions of a healthy person (donor 2) with KG2032-positive HLA-DRB1 (0403 / 0901).

[0082] Figure 4B This figure shows the results of flow cytometric analysis of the binding of KG2032 to bone marrow cells of AML patients with KG2032-positive HLA-DRB1.

[0083] Figure 4C This figure shows the results of flow cytometric analysis of the binding of KG2032 to various fractions of healthy human bone marrow cells having KG2032-positive HLA-DRB1.

[0084] Figure 5A This is a diagram showing an overview of how KG2032 is used in the treatment of AML.

[0085] Figure 5B This figure outlines another use of KG2032 in the treatment of AML.

[0086] Figure 6 It shows the DRB1 1454 (KG2032 positive) and DRB1 A diagram showing the results of comparing the amino acid sequences of KG2032 and KG1502 (negative). In the diagram, regions 1 to 5 respectively indicate regions with many differences in the amino acid sequences.

[0087] Figure 7A It is shown that HLA-DRB1 1454 (KG2032 positive) and HLA-DRB1 Figure 1 is a schematic diagram of a chimeric protein formed by partial fusion of 1502 (KG2032 negative).

[0088] Figure 7B The graph shows the results of flow cytometric analysis of the binding of KG2032 or L243 to K562 cells expressing the above-mentioned various chimeric proteins.

[0089] Figure 7CThis figure shows the results of comparing the amino acid sequences of region 3 between molecules that bind to KG2032 and molecules that do not bind when various HLA-DRB1 molecules are expressed in K562 cells.

[0090] Figure 7D It is shown that K562 cells express DRB1 A graph showing the results of comparing the binding of KG2032 or L243 to mutants in which the amino acid serine (S) at position 86 of 0405 (KG2032 positive) was substituted with aspartic acid (D).

[0091] Figure 8A This is a diagram showing an overview of a chimeric antigen receptor (KG2032-CAR) containing the variable region of KG2032.

[0092] Figure 8B This is a graph showing the analysis results of the introduction rate of KG2032-CAR.

[0093] Figure 8C This is a graph showing the proliferation rate of T cells expressing KG2032-CAR (KG2032-CAR-T cells). In the figure, "Control" represents T cells that have not undergone gene transfer.

[0094] Figure 8D This is a graph showing the results of analyzing cytokine production after co-culturing KG2032-CAR-T cells with the leukemia cell line KG1a (KG2032 positive) or THP-1 (KG2032 negative) for 24 hours.

[0095] Figure 8E This is a graph showing the results of analyzing the cytotoxic activity of KG2032-CAR-T cells after co-culturing with the leukemia cell line KG1a or THP-1 for 4 hours.

[0096] Figure 8F This is a graph showing the analysis results of the proliferation of KG2032-CAR-T cells when dasatinib was added and when it was not added. Figure 8F The following figures show the use of Figure 8A "BBζ" is shown as the result of KG2032-CAR-T.

[0097] Figure 8G Graphs showing the results of flow cytometric analysis of the expression of T cell exhaustion markers (PD-1, LAG-3, TIM-3) in KG2032-CAR-T cells with and without the addition of dasatinib.

[0098] Figure 8HThis is a graph showing the results of analyzing IL-2 production in co-culture of KG2032-CAR-T cells and KG1a cells with and without the addition of dasatinib.

[0099] Figure 8I The graph shows the results of analyzing the effects of KG2032-CAR-T cell administration by detecting bioluminescence using an in vivo imaging system (IVIS) in a xenograft model obtained by transplanting luciferase-expressing KG1a cells into NOG mice.

[0100] Figure 8J This graph shows the results of analyzing the effects of KG2032-CAR-T cell administration in a xenograft model created by transplanting luciferase-expressing KG1a cells into NOG mice. This graph shows the transition of luminescence intensity detected by IVIS.

[0101] Figure 9A This is a diagram showing an overview of the steps for producing KG2032 CAR-T2A-IL-15 and NK cells introduced with this CAR.

[0102] Figure 9B The graph shows the analysis results of the proliferation of KG2032 CAR-T2A-IL-15-transfected NK cells (KG2032 CAR-NK) or control (non-transfected (NT)) NK cells in in vitro culture.

[0103] Figure 9C This figure shows the results of flow cytometry analysis of the expression of CD56, CD3, and KG2032 CAR in KG2032 CAR-NK.

[0104] Figure 9D This graph shows the results of flow cytometry measurement of CD107a degranulation when KG2032 CAR-NK or control NK cells were co-cultured with target cells.

[0105] Figure 9E Is to show the use of 51 A graph showing the results of a Cr release assay measuring the cytotoxic activity of KG2032 CAR-NK cells or control NK cells when co-cultured with target cells.

[0106] Figure 9F Graph showing the timing of transplantation of KG1a AML cells (KG1a-luc) and administration of KG2032 CAR-NK into immunodeficient mice.

[0107] Figure 9G This is a graph showing the survival rate of KG1a-transplanted mice administered with KG2032 CAR-NK.

[0108] Figure 9H The graph shows the results of detecting and analyzing bioluminescence in mice injected with KG2032 CAR-NK or control NK cells (n=4 for each group).

[0109] Figure 10A This figure shows the timing of transplanting bone marrow cells from AML patients and administering modified KG2032 CAR-T cells to immunodeficient mice.

[0110] Figure 10B This figure shows the results of flow cytometric analysis of bone marrow cells from mice injected with modified KG2032 CAR-T cells or control T cells. The analysis shows a cell population pre-gated as mouse CD45-negative cells.

[0111] Figure 10C Figure 3 shows the expression of human CD45 in bone marrow cells and mouse CD45-negative cells 31 days after AML cell transplantation. + human CD3 - human CD34 + Scatter plot of the proportion of AML cells. DETAILED DESCRIPTION

[0112] Anti-HLA-DR antibodies

[0113] The present invention relates to antibodies or functional fragments thereof that recognize HLA-DR, a member of the class II major histocompatibility complex (MHC). In the present invention, "recognizing HLA-DR" means binding to at least one allele of HLA-DR, and also includes binding to at least one allele of HLA-DR and not binding to at least one other allele.

[0114] Examples of HLA-DR alleles include HLA-DR1, HLA-DR2, HLA-DR3, HLA-DR4, HLA-DR5, HLA-DR6, HLA-DR7, HLA-DR8, HLA-DR9, HLA-DR10, HLA-DR11, HLA-DR12, HLA-DR13, HLA-DR14, HLA-DR15, HLA-DR52, and HLA-DR53. Furthermore, HLA-DR is, for example, a complex of an α chain and a β chain. More specifically, HLA-DRAs such as HLA-DRA1 are included as α chains. Examples of β chains include HLA-DRBs such as HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5. Furthermore, examples of HLA-DRB1 include HLA-DRB1. 0405 (SEQ ID NO: 11), HLA-DRB1 0410 (SEQ ID NO: 12), HLA-DRB1 0701 (SEQ ID NO: 13), HLA-DRB1 0803 (SEQ ID NO: 14), HLA-DRB1 0901 (SEQ ID NO: 15), HLA-DRB1 1201 (SEQ ID NO: 16), HLA-DRB1 1454 (SEQ ID NO: 17), HLA-DRB1 0101 (SEQ ID NO: 18), HLA-DRB1 0301 (SEQ ID NO: 19), HLA-DRB1 0403 (SEQ ID NO: 20), HLA-DRB1 0404 (SEQ ID NO: 21), HLA-DRB1 0802 (SEQ ID NO: 22), HLA-DRB1 1101 (SEQ ID NO: 23), HLA-DRB1 1301 (SEQ ID NO: 24), HLA-DRB1 1302 (SEQ ID NO: 25), HLA-DRB1 1403 (SEQ ID NO: 26), HLA-DRB1 1405 (SEQ ID NO: 27), HLA-DRB1 1406 (SEQ ID NO: 28), HLA-DRB1 1501 (SEQ ID NO: 29), HLA-DRB1 1502 (serial number: 30).

[0115] Examples of the antibodies of the present invention include antibodies that bind to HLA-DRB1 alleles containing an amino acid other than aspartic acid at position 86. Furthermore, the antibodies may not bind to HLA-DRB1 alleles containing aspartic acid at position 86. The "amino acid other than aspartic acid" at position 86 is preferably serine, valine, or alanine.

[0116] As a more specific example, there can be mentioned a gene selected from the group consisting of HLA-DRB1 0405 (SEQ ID NO: 11), HLA-DRB1 0410 (SEQ ID NO: 12), HLA-DRB1 0701 (SEQ ID NO: 13), HLA-DRB1 0803 (SEQ ID NO: 14), HLA-DRB1 0901 (SEQ ID NO: 15), HLA-DRB1 1201 (SEQ ID NO: 16) and HLA-DRB1 1454 (SEQ ID NO: 17) or more. 0101 (SEQ ID NO: 18), HLA-DRB1 0301 (SEQ ID NO: 19), HLA-DRB1 0403 (SEQ ID NO: 20), HLA-DRB1 0404 (SEQ ID NO: 21), HLA-DRB1 0802 (SEQ ID NO: 22), HLA-DRB1 1101 (SEQ ID NO: 23), HLA-DRB1 1301 (SEQ ID NO: 24), HLA-DRB1 1302 (SEQ ID NO: 25), HLA-DRB1 1403 (SEQ ID NO: 26), HLA-DRB1 1405 (SEQ ID NO: 27), HLA-DRB1 1406 (SEQ ID NO: 28), HLA-DRB1 1501 (SEQ ID NO: 29) and HLA-DRB1 The present invention also provides antibodies that bind to at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13) HLA-DR selected from the group consisting of SEQ ID NO: 1502 (SEQ ID NO: 30). Furthermore, as shown in the Examples below, the antibodies of the present invention can recognize a region encompassing amino acids 74 to 89 of HLA-DRB1. Furthermore, the antibodies of the present invention may not bind to a portion of monocytes or T cells.

[0117] It should be noted that the presence or absence of the binding property of the antibody can be analyzed by immunological methods by those skilled in the art. For example, as shown in the examples described below, in antigen analysis using flow cytometry, when the peak from the test antibody is offset to the side with stronger fluorescence intensity compared to the peak from its isotype control antibody, it can be determined that the test antibody is (substantially) bound to the antigen. On the other hand, when no such offset is confirmed, it can be determined that the test antibody is (substantially) not bound to the antigen.

[0118] In addition, the binding properties of the antibodies of the present invention are measured by K D(dissociation constant) is preferably 10 -7 Below, more preferably 10 -8 Below. K D Calculated from ka (association rate constant) and kd (dissociation rate constant) (K D = kd / ka). Ka and kd are rate constants in the binding and dissociation reaction between two molecules, and can be determined, for example, by surface plasmon resonance (SPR) measurement. SPR measurement of the binding between an antibody and an antigen is well known, and those skilled in the art can determine the ka and kd of the antibody based on the known techniques, and further calculate K D .

[0119] The "antibody" in the present invention includes all classes and subclasses of immunoglobulins. "Antibodies" include polyclonal antibodies and monoclonal antibodies. "Polyclonal antibodies" are antibody preparations containing different antibodies against different epitopes. In addition, "monoclonal antibodies" refer to antibodies obtained from a substantially uniform group of antibodies. In contrast to polyclonal antibodies, monoclonal antibodies recognize a single determinant on an antigen. The antibodies of the present invention are preferably monoclonal antibodies. The antibodies of the present invention are antibodies separated and / or recovered (i.e., isolated) from components of the natural environment.

[0120] The antibody of the present invention may have at least one cell-killing activity selected from ADCC activity and CDC activity, or may have both ADCC activity and CDC activity.

[0121] In the present invention, "ADCC activity (antibody-dependent cellular cytotoxicity)" refers to the activity in which, when an antibody binds to a cell-surface antigen on a target cell, the antibody's Fc region further binds to effector cells (immune cells such as NK cells and monocytes), activating these cells and subsequently releasing factors to kill the target cell. On the other hand, "CDC activity (complement-dependent cellular cytotoxicity)" refers to the activity in which, when an antibody binds to a target cell, it activates the complement system, resulting in the lysis of the target cell.

[0122] The antibodies of the present invention may also have anti-tumor activity. In the present invention, "anti-tumor activity" refers to at least one of the activity of inhibiting cancer cell proliferation, inducing cancer cell death, and inhibiting cancer cell metastasis. Anti-tumor activity can be evaluated, for example, by analysis using a tumor-bearing model as shown in the examples described below. In addition, even if it is not an in vivo system, when tumor cells are cultured in the presence or absence of the test antibody and the number of tumor cells in the former is reduced compared to the latter, the antibody can be judged to have anti-tumor activity.

[0123] The antibodies of the present invention are not particularly limited in terms of origin, type, shape, etc. as long as they can recognize HLA-DR. Specifically, they include non-human animal antibodies (e.g., mouse antibodies, rabbit antibodies, rat antibodies, camel antibodies), human antibodies, chimeric antibodies, and humanized antibodies.

[0124] Examples of the "non-human animal-derived antibodies" of the present invention include KG2032, KG2053, KG1982, KG19130, KG19214, KG19833, aAML191870, aAML191872, and KG19122 shown in the Examples described below. More specifically, examples include antibodies that retain a variable region containing the following amino acid sequence.

[0125] (a) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 8.

[0126] (b) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 41.

[0127] (c) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 45 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 49.

[0128] (d) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 53 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 57.

[0129] (e) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 61 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0130] (f) An antibody having a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 69 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0131] (g) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 73 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0132] (h) An antibody having a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 77 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0133] (i) An antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 69 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 79.

[0134] Furthermore, as examples, there are also the following antibodies that recognize HLA-DR and retain the complementarity determining regions (CDRs).

[0135] (a) An antibody that retains heavy chain CDRs 1 to 3 determined by a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 4 and light chain CDRs 1 to 3 determined by a light chain variable region comprising the amino acid sequence of SEQ ID NO: 8.

[0136] (b) An antibody that retains heavy chain CDRs 1 to 3 determined by a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 37 and light chain CDRs 1 to 3 determined by a light chain variable region comprising the amino acid sequence of SEQ ID NO: 41.

[0137] (c) An antibody that retains heavy chain CDRs 1 to 3 determined by the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 45 and light chain CDRs 1 to 3 determined by the light chain variable region comprising the amino acid sequence of SEQ ID NO: 49.

[0138] (d) An antibody that retains heavy chain CDRs 1 to 3 determined by the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 53 and light chain CDRs 1 to 3 determined by the light chain variable region comprising the amino acid sequence of SEQ ID NO: 57.

[0139] (e) An antibody that retains heavy chain CDRs 1 to 3 determined by the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 61 and light chain CDRs 1 to 3 determined by the light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0140] (f) An antibody that retains heavy chain CDRs 1 to 3 determined by the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 69 and light chain CDRs 1 to 3 determined by the light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0141] (g) An antibody that retains heavy chain CDRs 1 to 3 determined by a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 73 and light chain CDRs 1 to 3 determined by a light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0142] (h) An antibody that retains heavy chain CDRs 1 to 3 determined by the heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 77 and light chain CDRs 1 to 3 determined by the light chain variable region comprising the amino acid sequence of SEQ ID NO: 65.

[0143] (i) An antibody that retains heavy chain CDRs 1 to 3 determined by a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 69 and light chain CDRs 1 to 3 determined by a light chain variable region comprising the amino acid sequence of SEQ ID NO: 79.

[0144] It should be noted that the method for determining CDRs based on the amino acid sequence of the variable region of the antibody is not particularly limited, and examples thereof include well-known numbering schemes such as Kabat, Chothia, IMGT, and Aho. More specifically, as examples determined by Kabat, the following antibodies that recognize HLA-DR and retain CDRs can be cited.

[0145] (a) An antibody that retains the amino acid sequences described in SEQ ID NOs: 1 to 3 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 5 to 7 as light chain CDRs 1 to 3, respectively.

[0146] (b) An antibody that retains the amino acid sequences described in SEQ ID NOs: 34 to 36 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 38 to 40 as light chain CDRs 1 to 3, respectively.

[0147] (c) An antibody that retains the amino acid sequences described in SEQ ID NOs: 42 to 44 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 46 to 48 as light chain CDRs 1 to 3, respectively.

[0148] (d) An antibody that retains the amino acid sequences described in SEQ ID NOs: 50 to 52 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 54 to 56 as light chain CDRs 1 to 3, respectively.

[0149] (e) An antibody that retains the amino acid sequences described in SEQ ID NOs: 58 to 60 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 62 to 64 as light chain CDRs 1 to 3, respectively.

[0150] (f) An antibody that retains the amino acid sequences described in SEQ ID NOs: 66 to 68 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 62 to 64 as light chain CDRs 1 to 3, respectively.

[0151] (g) An antibody that retains the amino acid sequences described in SEQ ID NOs: 70 to 72 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 62 to 64 as light chain CDRs 1 to 3, respectively.

[0152] (h) An antibody that retains the amino acid sequences described in SEQ ID NOs: 74 to 76 as heavy chain CDRs 1 to 3, respectively, and retains the amino acid sequences described in SEQ ID NOs: 62 to 64 as light chain CDRs 1 to 3, respectively.

[0153] (i) An antibody that retains the amino acid sequences described in SEQ ID NOs: 66 to 68 as heavy chain CDRs 1 to 3, and retains the amino acid sequences described in SEQ ID NOs: 62, 78, and 64 as light chain CDRs 1 to 3, respectively.

[0154] In addition, the present invention not only includes such variable region and / or the antibody of CDR that maintenance is made up of specific amino acid sequence, and includes the antibody that does not make desired activity (reactivity to antigen etc.) reduce and its amino acid sequence has been modified.Such amino acid sequence mutants can be made by, for example, introducing mutation into DNA encoding the above-mentioned variable region etc., or made by peptide synthesis.As such modification, for example, replacement, deletion, addition and / or insertion of the residue in the amino acid sequence of antibody are included.Regarding the transformation site of the amino acid sequence of antibody, as long as there is the activity equal to the antibody before transformation, then it can be the constant region of heavy chain or light chain of antibody, and can also be variable region (framework region (FR) and CDR) in addition.It is generally believed that the transformation of amino acid beyond CDR is relatively small on the impact of reactivity with antigen, and therefore usually implements transformation in FR. However, methods for modifying the amino acids of CDRs and screening for antibodies with improved affinity for antigens are currently known (PNAS, 102: 8466-8471 (2005), Protein Engineering, Design & Selection, 21: 485-493 (2008), International Publication No. 2002 / 051870, J. Biol. Chem., 280: 24880-24887 (2005), Protein Engineering, Design & Selection, 21: 345-351 (2008), MAbs. Mar-Apr; 6(2): 437-45 (2014)). Furthermore, currently, it is also possible to model antibodies with improved affinity for antigens using integrated computational chemistry systems (e.g., Molecular Operating Environment, manufactured by CCG, Canada) (e.g., see http: / / www.rsi.co.jp / kagaku / cs / ccg / products / application / protein.html). Furthermore, as described in Protein Eng Des Sel. 2010 Aug; 23(8): 643-51, examples are known in which CDR1 of the heavy chain variable region and CDR3 of the light chain variable region are not associated with affinity for antigens. Similarly, Molecular Immunology 44: 1075-1084 (2007) reported that CDR2 of the light chain variable region is not associated with affinity for antigens in most antibodies. Therefore, in terms of antibody affinity for antigens, equivalent activity can be achieved even without requiring all CDR1 to 3 of each of the heavy and light chain variable regions.In fact, examples of maintaining affinity for antigens by retaining at least one CDR of the original antibody are reported in Biochem Biophys Res Commun. 2003 Jul 18; 307(1): 198-205, J Mol Biol. 2004 Jul 9; 340(3): 525-42, and J Mol Biol. 2003 Aug 29; 331(5): 1109-20.

[0155] In addition, with respect to the antibodies of the present invention, the number of amino acids modified in the variable region is preferably within 10 amino acids, more preferably within 5 amino acids, and even more preferably within 3 amino acids (e.g., within 2 amino acids or 1 amino acid). Furthermore, from the perspective of having little effect on antigen binding, the modifications are preferably all performed outside the CDRs, i.e., in the FRs. In addition, the number of amino acids modified in the CDRs is preferably within 5 amino acids, more preferably within 3 amino acids (e.g., within 2 amino acids or 1 amino acid).

[0156] Amino acid modification is preferably conservative substitution. In the present invention, "conservative substitution" refers to substitution with other similar amino acid residues (having chemically identical side chains). The group of amino acid residues with chemically identical amino acid side chains is well known in the art to which the present invention belongs. For example, it can be classified by acidic amino acids (aspartic acid and glutamic acid), basic amino acids (lysine / arginine / histidine), amino acids with hydrocarbon chains in neutral amino acids (glycine / alanine / valine / leucine / isoleucine / proline), amino acids with hydroxyl groups (serine / threonine), sulfur-containing amino acids (cysteine / methionine), amino acids with amide groups (asparagine / glutamine), amino acids with imino groups (proline), amino acids with aromatic groups (phenylalanine / tyrosine / tryptophan).

[0157] In addition, with respect to the amino acid sequence after modification, antibodies that maintain a variable region containing an amino acid sequence having 80% or more homology or identity at the amino acid sequence level with the variable region composed of the above-mentioned specific amino acid sequence are also included in the antibodies of the present invention as long as they have the same activity as the antibody before modification. As for the homology or identity, it is sufficient to be at least 80%, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more (for example, 96% or more, 97% or more, 98% or more, 99% or more). It should be noted that from the perspective of having little effect on the binding to the antigen, the modification in the variable region of the antibody is preferably performed outside the CDR, that is, in the FR. In addition, "identity" refers to the ratio of sites where the type of amino acid is the same between the compared amino acid sequences, and "homology" refers to the ratio obtained by adding the ratio of sites where similar amino acids are the same. Sequence homology or identity can be determined using the BLASTP (amino acid level) program (Altschul et al. J. Mol. Biol., 215: 403-410, 1990). This program is based on the BLAST algorithm proposed by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 87: 2264-2268, 1990, Proc. Natl. Acad. Sci. USA, 90: 5873-5877, 1993). When analyzing amino acid sequences using BLASTP, the parameters are set to, for example, score = 50 and wordlength = 3. In addition, when analyzing amino acid sequences using the Gapped BLAST program, the analysis can be performed as described by Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997). When using the BLAST and Gapped BLAST programs, the default parameters of each program are used. The specific methods of these analysis methods are well known.

[0158] In addition, "having equivalent activity" means, for example, that the antigen binding ability is equivalent to that of the target antibody (e.g., KG2032, KG2053, KG1982, KG19130, KG19214, KG19833, aAML 191870, aAML 191872, KG19122) (e.g., 70% or more, preferably 80% or more, more preferably 90% or more).

[0159] In addition, the modification of the antibodies of the present invention can be, for example, modification of the post-translational processing of the antibody, such as changing the number or position of glycosylation sites. Thus, for example, the ADCC activity of the antibody can be improved. The glycosylation of the antibody is typically N-bound or O-bound. The glycosylation of the antibody is highly dependent on the host cell used to express the antibody. The modification of the glycosylation pattern can be carried out by known methods such as the introduction or deletion of specific enzymes related to sugar production (Japanese Patent Application Publication No. 2008-113663, U.S. Patent No. 5047335, U.S. Patent No. 5510261, U.S. Patent No. 5278299, International Publication No. 99 / 54342). Furthermore, in the present invention, deamidated amino acids or amino acids adjacent to deamidated amino acids can be replaced with other amino acids to enhance the stability of the antibody, thereby inhibiting deamidation. In addition, glutamic acid can be replaced with other amino acids to enhance the stability of the antibody. The present invention also provides such stabilized antibodies.

[0160] In the present invention, "chimeric antibody" refers to an antibody formed by linking the variable region of a certain antibody to the constant region of another type of antibody. Chimeric antibodies can be obtained, for example, by immunizing mice with an antigen, excising the variable portion (variable region) of the antibody that binds to the antigen from the mouse monoclonal antibody gene, combining it with the antibody constant portion (constant region) gene from human bone marrow, integrating it into an expression vector, and introducing it into a host to produce it (e.g., Japanese Patent Application Laid-Open No. 8-280387, U.S. Patent No. 4,816,397, U.S. Patent No. 4,816,567, U.S. Patent No. 5,807,715).

[0161] As the constant region of a chimeric antibody, a constant region of a human antibody is generally used. For example, for the heavy chain, Cγ1, Cγ2, Cγ3, Cγ4, Cμ, Cδ, Cα1, Cα2, and Cε can be used as constant regions. In addition, for the light chain, Cκ and Cλ can be used as constant regions. The amino acid sequences of these constant regions and the base sequences encoding them are well known. In addition, in order to improve the stability of the antibody itself or the stability of antibody production, one or more amino acids in the constant region of a human antibody can be substituted, deleted, added, and / or inserted.

[0162] In the present invention, "humanized antibody" refers to an antibody formed by transplanting the gene sequence of the CDR of a non-human animal antibody (CDR grafting) into a human antibody gene, and its production method is a known method such as overlap extension PCR (e.g., European Patent Application Publication No. 239400, European Patent Application Publication No. 125023, International Publication No. 90 / 07861, International Publication No. 96 / 02576). The variable region of an antibody is usually composed of three CDRs sandwiched between four FRs. CDR is the region that essentially determines the binding specificity of the antibody. The amino acid sequence of CDR is rich in diversity. On the other hand, the amino acid sequence constituting FR mostly shows high homology or consistency between antibodies with different binding specificities. Therefore, it is generally believed that the binding specificity of a certain antibody can be transplanted to other antibodies by transplanting CDR. In addition, from the viewpoint of maintaining the function of CDR, when non-human CDR is transplanted into human FR, human FR with high homology or consistency with the non-human animal FR is selected. That is, the amino acids within the CDR not only recognize the antigen but also coordinate with the amino acids of the FR located near the CDR, thereby also participating in the maintenance of the CDR loop structure. Therefore, it is preferable to utilize human FRs composed of amino acid sequences that have high homology or identity with the amino acid sequences of the FRs adjacent to the CDR to be transplanted.

[0163] For example, a search system specifically for antibodies available on the Internet (http: / / www.bioinf.org.uk / abysis / ) can be used to search for known human FRs with high homology or consistency with non-human animal FRs. In order to achieve consistency with the human FR sequence obtained in this way, mutations can be introduced into sequences other than the CDRs of the non-human antibody. Alternatively, when a gene (cDNA) encoding the amino acid sequence of the human FR obtained by the search is available, non-human CDRs can be introduced into this sequence. The introduction of mutations can be performed using techniques known in the art such as nucleic acid synthesis and site-directed mutagenesis.

[0164] By qualitatively or quantitatively measuring and evaluating the antigen-binding activity of the humanized antibodies thus prepared, it is possible to appropriately select human antibody FRs that, when linked via the CDRs, allow the CDRs to form a good antigen-binding site. Furthermore, as needed, amino acid residues in the FRs can be substituted so that the CDRs of the humanized antibody form a suitable antigen-binding site, according to the methods described in Sato, K. et al., Cancer Res, 1993, 53, 851-856, etc., and then measuring and evaluating the antigen-binding activity of the mutant antibodies with the amino acid substitutions, thereby selecting mutant FR sequences with desired properties.

[0165] Furthermore, the antibodies of the present invention may also take the form of antibodies that compete for HLA-DR binding with antibodies that possess variable regions or CDRs containing the aforementioned specific amino acid sequences or modified versions thereof. In other words, they may also take the form of antibodies that bind to epitopes to which antibodies that possess variable regions or CDRs containing the aforementioned specific amino acid sequences or modified versions thereof exhibit binding activity.

[0166] In the present invention, "epitope" refers to an antigenic determinant present in an antigen, that is, a site on the antigen to which the antigen-binding domain in an antibody binds. Therefore, the epitope in the present invention can be a polypeptide consisting of a plurality of consecutive amino acids in the primary sequence of amino acids (linear epitope), or it can be a polypeptide formed by the proximity of non-adjacent amino acids in the primary sequence of amino acids through a three-dimensional structure such as the folding of a peptide or protein (discontinuous epitope, structural epitope). In addition, the epitope is typically composed of at least 3 (e.g., 4), and most commonly at least 5 (e.g., 6 to 20, 7 to 15, 8 to 10) amino acids.

[0167] In addition, when obtaining antibodies, those skilled in the art can determine the peptide region (epitope) on the antigen to which the antibody is reactive and produce various antibodies that bind to the peptide region. Furthermore, whether two antibodies bind to the same or sterically overlapping epitopes can be determined by competition assays.

[0168] In the present invention, a "functional fragment" of an antibody refers to a portion (partial fragment) of an antibody that recognizes HLA-DR. Specific examples include Fab, Fab', F(ab')2, variable region fragment (Fv), disulfide-bonded Fv, single-chain variable region fragment (single-chain Fv, scFv), sc(Fv)2, and polymers thereof.

[0169] Here, "Fab" refers to a monovalent antigen-binding fragment of an immunoglobulin composed of one light chain and a portion of a heavy chain. It can be obtained by papain digestion of the antibody or by recombinant methods. "Fab'" contains one or more cysteines from the hinge region of the antibody and differs from Fab by the addition of a small number of residues to the carboxyl terminus of the heavy chain CH1 domain. "F(ab')2" refers to a bivalent antigen-binding fragment of an immunoglobulin composed of two light chains and portions of two heavy chains.

[0170] A "variable region fragment (Fv)" is the smallest antibody fragment with a complete antigen recognition and binding site. Fv is a dimer composed of the heavy and light chain variable regions, firmly linked by non-covalent bonds. A "single-chain variable region fragment" (single-chain Fv, scFv) contains the heavy and light chain variable regions of an antibody, within a single polypeptide chain. "sc(Fv)2" is a fragment formed by combining two heavy and light chain variable regions, bound together by a linker or other means.

[0171] The antibodies of the present invention can be produced by the hybridoma method, and can also be produced by the recombinant DNA method. As a representative method of the hybridoma method, the method of Kohler and Milstein (Kohler & Milstein, Nature, 256: 495 (1975)) can be cited. The antibody-producing cells used in the cell fusion step of this method are spleen cells, lymph node cells, peripheral blood leukocytes, etc. of animals (such as mice, rats, hamsters, rabbits, monkeys, goats) immunized with antigens (HLA-DR, partial peptides thereof, proteins formed by fusion of these with Fc proteins, etc., or cells expressing these). Antibody-producing cells obtained by allowing antigens to act on the above-mentioned cells or lymphocytes previously isolated from non-immunized animals in a culture medium can also be used. As myeloma cells, various well-known cell strains can be used. As for antibody-producing cells and myeloma cells, as long as they can be fused, they can be cells originating from different animal species, preferably cells originating from the same animal species. Hybridomas can be produced, for example, by cell fusion between spleen cells obtained from mice immunized with an antigen and mouse myeloma cells, followed by screening to obtain hybridomas that produce monoclonal antibodies that recognize HLA-DR. Monoclonal antibodies that recognize HLA-DR can be obtained by culturing the hybridomas and then obtaining them from the ascites of a mammal to which the hybridomas have been administered.

[0172] The recombinant DNA method is a method in which DNA encoding the above-mentioned antibody of the present invention is cloned from a hybridoma, B cell, etc., integrated into a suitable vector, and introduced into a host cell (e.g., mammalian cell lines such as HEK cells, Escherichia coli, yeast cells, insect cells, plant cells, etc.) to produce the antibody of the present invention as a recombinant antibody (e.g., P.J. Delves, Antibody Production: Essential Techniques, 1997; WILEY, P. Shepherd and C. Dean, Monoclonal Antibodies, 2000; Vandamme A. M. et al., Eur. J. Biochem. 192: 767-775 (1990)). Regarding expression of the DNA encoding the antibody of the present invention, the DNA encoding the heavy chain or light chain can be separately incorporated into an expression vector and then transformed into the host cell, or the DNA encoding the heavy and light chains can be incorporated into a single expression vector and then transformed into the host cell (see International Publication No. 94 / 11523). By culturing the host cells and isolating / purifying the antibodies from the host cells or the culture medium, the antibodies of the present invention can be obtained in a substantially pure and uniform form. The antibodies can be isolated / purified using methods commonly used for the purification of polypeptides. If transgenic animals (cows, goats, sheep, pigs, etc.) incorporating antibody genes are produced using transgenic animal production technology, monoclonal antibodies derived from the antibody genes can also be obtained in large quantities from the milk of the transgenic animals.

[0173] The present invention also provides a DNA encoding the antibody of the present invention, a vector containing the DNA, a host cell harboring the DNA, and a method for producing the antibody comprising the steps of culturing the host cell and recovering the antibody.

[0174] Chimeric Antigen Receptor

[0175] As shown in the examples described below, the target of the antibody of the present invention, HLA-DR, is a blood cancer-specific cell surface antigen. In addition, the variable region of the antibody of the present invention is useful for chimeric antigen receptors (CARs) and T cells expressing them (so-called CAR-T). Therefore, the present invention can also take the form of a CAR containing an antibody or its variable region that binds to HLA-DR, a transmembrane region, and an intracellular signaling region.

[0176] In the present invention, "Chimeric Antigen Receptor (CAR)" refers to a chimeric protein in which an HLA-DR binding region as an extracellular region, a transmembrane region, and an intracellular signaling region are arranged in order from the N-terminal side and these regions are directly or indirectly linked.

[0177] In the present invention, the "region that binds to HLA-DR (antigen-binding region)" can be, for example, the above-mentioned antibody or a functional fragment thereof, and scFv is generally used for CAR.

[0178] As mentioned above, "scFv" is a structure formed by connecting the light chain variable region and heavy chain variable region of a monoclonal antibody (immunoglobulin) via a linker, maintaining antigen binding ability. The order of the N-terminal end of the scFv can be light chain variable region, linker, heavy chain variable region, or heavy chain variable region, linker, light chain variable region.

[0179] As a "linker" in scFv, for example, a peptide linker can be used. The length of the linker is not particularly limited. For example, a linker with 5 to 25 amino acids can be used. The length of the linker is preferably 8 to 25 amino acids, more preferably 15 to 20 amino acids. Preferred examples of peptide linkers include peptide linkers containing glycine, or glycine and serine (GGS linker, GS linker, GGG linker, Whitlow / 218 linker, etc.). The glycine and serine amino acids constituting these linkers are themselves small in size and have the advantage of not being easy to form a higher-order structure in the linker.

[0180] The monoclonal antibody serving as the basis of scFv is not particularly limited, and examples thereof include the aforementioned non-human animal-derived antibodies, human antibodies, and humanized antibodies. Preferred examples are also as described above.

[0181] In the present invention, the "transmembrane region" is not particularly limited as long as it has the function of crossing the cell membrane and can retain the CAR in the cell membrane. Proteins that are sources of polypeptides responsible for the transmembrane region include, for example, CD28, CD3ζ, CD3ε, 4-1BB, CD45, CD4, CD5, CD8α, CD8β, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, GITR, and T cell receptor α and β chains.

[0182] In the present invention, “intracellular signaling region” is the region in which CAR is configured within the cell when it is configured on the cell membrane, and is the region in which the signal necessary for immune cells to perform effector functions, i.e., the signal necessary for immune cell activation (so-called primary signal) is transmitted when the antigen binding region is combined with the antigen (HLA-DR). As such an intracellular signaling region, it is generally included that has only an intracellular signaling region (first generation CAR) of an activation signaling domain such as a T cell receptor (TCR) and a CD3 complex, an intracellular signaling region (second generation CAR) having a costimulatory signaling domain (such as the intracellular domain of CD28 or 4-1BB) from a costimulatory molecule in addition to the activation signaling domain, and an intracellular signaling region (third generation CAR) having multiple costimulatory signaling domains (such as the intracellular domain of CD28 and 4-1BB) in addition to the activation signaling domain. In addition, intracellular signaling regions including the CD79A intracellular region and the CD40 intracellular region can also be mentioned (see Mol Ther 2021 Sep 1; 29(9): 2677-2690).

[0183] As described above, the "intracellular signaling region" can be any region capable of transmitting the primary signal, and activation signaling domains of proteins involved in the signaling can be used. It is known that immunoreceptor tyrosine-based activation motifs (ITAMs) are involved in primary signaling. Examples of proteins with ITAMs include CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, CD66d, DAP10, and DAP12.

[0184] In the present invention, the number of intracellular signaling regions contained in the CAR is not limited to one, and may contain two or more intracellular signaling regions (for example, 1 to 5, 1 to 3, or 1 or 2 signaling factors). In this case, the two or more intracellular signaling regions contained may be the same or different.

[0185] The CAR of the present invention may contain other domains in addition to the above-mentioned antigen binding region, transmembrane region and intracellular signaling region. Examples of other domains include, but are not limited to, costimulatory transmission regions, spacer sequences, signal peptides, and the like.

[0186] The costimulatory molecules expressed on known T cells are bound by the ligand specific to each costimulatory molecule expressed on antigen presenting cells, and costimulatory signals are delivered into the cell to assist the activation of T cells (secondary signal transmission). In the present invention, " costimulatory transmission region" refers to the intracellular domain involved in the costimulatory signal transmission of such costimulatory molecules. As examples of costimulatory molecules, CD28, 4-1BB (CD137), OX40 (CD134), ICOS, CD2, CD4, CD5, CD8 α, CD8 β, CD154, etc. can be listed. The CAR of the present invention can contain the costimulatory transmission region of these costimulatory molecules.

[0187] The number of costimulatory signaling regions that the CAR of the present invention may contain is not limited to one, and may be two or more. The CAR of the present invention may contain, for example, 1 to 5, 1 to 3, or 1 or 2 costimulatory signaling regions. When the CAR of the present invention contains two or more costimulatory signaling domains, the regions may be the same or different.

[0188] In the present invention, a "spacer" refers to a sequence connecting various regions, etc., and is not particularly limited as long as it does not inhibit the functions of the various regions. In addition, the number of amino acids is also not particularly limited, but is generally 1 to 500 amino acids, preferably 5 to 300 amino acids, and more preferably 10 to 100 amino acids.

[0189] The sequence of the spacer is not particularly limited. For example, the hinge or a portion thereof, a portion of the hinge and CH2 of IgG, preferably human IgG (e.g., subtype IgG1 or IgG4), or a portion of a factor for a transmembrane domain (e.g., CD28) can be used as a spacer. It should be noted that by utilizing the hinge or a portion thereof, it is expected that a spacer with high flexibility can be formed.

[0190] In the present invention, " signal peptide " refers to a peptide for promoting the secretion of CAR or for indicating the positioning to the cell membrane, also referred to as a leader sequence. The signal peptide can usually be directly or indirectly bound to the N-terminus of the antigen binding region. In addition, the signal peptide can also be arbitrarily cut off from the antigen binding region in cell processing and CAR positioning to the cell membrane. As an example of the signal peptide, immunoglobulin (IgK etc.), human GM-CSF receptor, α chain and β chain of T cell receptor, CD8α, CD8β, CD3ζ, CD28, CD3ε, CD45, CD4, CD5, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, ICOS, CD154, GITR etc. signal peptides can be listed.

[0191] Above, examples of the various regions in the CAR of the present invention are described, but the specific amino acid sequences related to these regions can be appropriately obtained by those skilled in the art by searching databases such as the well-known literature, NCBI (http: / / www.ncbi.nlm.nih.gov / guide / ). Furthermore, specific sequences are also disclosed in the sequence table of the present application. In addition, it is not limited to such typical amino acid sequences (for example, NCBI reference sequences). As long as the region of the present invention maintains the function undertaken by the region, it can also contain modified bodies and homologs for these typical amino acid sequences. In addition, the modified bodies and homologs generally have high homology or consistency relative to the typical amino acid sequence. High homology or consistency is generally more than 60%, preferably more than 70%, more preferably more than 80%, and further preferably more than 90% (for example, more than 95%, more than 96%, more than 97%, more than 98%, more than 99%).

[0192] In addition, the CAR of the present invention may be a molecule composed of a single polypeptide or a molecule composed of a complex of two or more polypeptides. In addition, the CAR of the present invention may be a molecule composed of a polypeptide or a complex thereof, or a molecule in which other substances (e.g., fluorescent substances, radioactive substances, inorganic particles, etc.) are linked to a polypeptide or a complex thereof.

[0193] The CAR of the present invention may be chemically modified. The C-terminus of the polypeptide constituting the CAR of the present invention may be any of a carboxyl group (-COOH), a carboxylate (-COO-), an amide (-CONH2), or an ester (-COOR). Here, as R in the ester, for example, C1-6 alkyl groups such as methyl, ethyl, n-propyl, isopropyl, and n-butyl; C3-8 cycloalkyl groups such as cyclopentyl and cyclohexyl; C6-12 aryl groups such as phenyl and α-naphthyl; phenyl-C1-2 alkyl groups such as benzyl and phenethyl; C7-14 arylalkyl groups such as α-naphthyl-C1-2 alkyl groups such as α-naphthylmethyl; pivaloyloxymethyl, etc. The carboxyl group (or carboxylate) of the polypeptide constituting the CAR of the present invention other than the C-terminus may be amidated or esterified. As the ester in this case, for example, the ester at the C-terminus mentioned above can be used. Furthermore, the polypeptide constituting the CAR of the present invention also includes a polypeptide in which the amino group of the N-terminal amino acid residue is protected by a protecting group (e.g., a C1-6 acyl group such as a formyl group or an acetyl group, etc.), a polypeptide in which the N-terminal glutamine residue generated by cleavage in vivo is pyroglutamated, and a polypeptide in which the substituents on the side chains of the amino acids in the molecule (e.g., -OH, -SH, amino, imidazole, indolyl, guanidino, etc.) are protected by a suitable protecting group (e.g., a C1-6 acyl group such as a formyl group or an acetyl group, etc.).

[0194] In addition, the CAR of the present invention may have other functional proteins. As other functional proteins, there is no particular limitation and they can be appropriately selected according to the function that the CAR of the present invention is intended to impart. For example, as functional proteins used to facilitate the purification and detection of CAR, Myc tags, His tags, HA tags, FLAG tags (registered trademark, Sigma-Aldrich), fluorescent protein tags (GFP, etc.) and the like can be listed.

[0195] The chimeric antigen receptor of the present invention may also be in the form of a pharmaceutically acceptable salt with an acid or base. The salt is not particularly limited as long as it is a pharmaceutically acceptable salt, and either an acidic salt or a basic salt may be used. For example, examples of acidic salts include inorganic acid salts such as hydrochlorides, hydrobromides, sulfates, nitrates, and phosphates; organic acid salts such as acetates, propionates, tartrates, fumarates, maleates, malates, citrates, methanesulfonates, and p-toluenesulfonates; and amino acid salts such as aspartate and glutamate. Furthermore, examples of basic salts include alkali metal salts such as sodium salts and potassium salts; and alkaline earth metal salts such as calcium salts and magnesium salts. The chimeric antigen receptor of the present invention may be in the form of a solvate. The solvent is not particularly limited as long as it is a pharmaceutically acceptable solvent, and examples include water, ethanol, glycerol, and acetic acid.

[0196] It should be noted that to date, there have been several reports on experimental and clinical studies using CAR (e.g., Rossig C, et al. Mol Ther 10:5-18, 2004; Dotti G, et al. Hum Gene Ther 20:1229-1239, 2009; Ngo MC, et al. Hum Mol Genet 20(R1):R93-99, 2011; Ahmed N, et al. Mol Ther 17:1779-1787, 2009; Pule MA, et al. Nat Med 14:1264-1270, 2008; Louis CU, et al. Blood 118:6050-6056, 2011; Kochenderfer JN, et al. Blood 116:4099-4102, 2010; Kochenderfer JN, et al. et al. Blood 119:2709-2720, 2012; Porter DL, et al. N Engl J Med 365:725-733, 2011; Kalos M, et al. Sci Transl Med 3:95ra73, 2011; Brentjens RJ, et al. Blood 118:4817-4828, 2011; Brentjens RJ, et al. Sci Transl Med 5:177ra38, 2013). The CAR of the present invention can be constructed with reference to these reports. In addition, specific sequences and the like are also shown in the Examples described below, and thus these can also be used as reference to construct the CAR of the present invention.

[0197] <Nucleotides encoding chimeric antigen receptor>

[0198] The present invention provides a polynucleotide encoding the CAR of the present invention. Information about the nucleotide sequence encoding the antigen-binding region such as scFv can be obtained, for example, by analyzing the nucleotide sequence of a hybridoma that produces the monoclonal antibody that forms the basis thereof.

[0199] In addition, regarding the specific nucleotide sequences of each region in the CAR of the present invention other than the encoding antigen-binding region, those skilled in the art can retrieve the known literature, NCBI (http: / / www.ncbi.nlm.nih.gov / guide / ) and other databases and obtain them appropriately. Furthermore, the nucleotide sequences encoding the above-mentioned regions, etc. are not limited to the known ones, as long as they are the nucleotide sequences encoding the above-mentioned regions, etc. can be used. Due to the degeneracy of gene coding, there are multiple codons corresponding to one amino acid. Therefore, there are multiple nucleotide sequences encoding the same amino acid sequence. As long as the nucleotide sequence of the polynucleotide of the present invention encodes the CAR of the present invention, it can be any one of the multiple nucleotide sequences generated by the degeneracy of gene coding. Furthermore, in order to optimize the expression in cells expressing CAR, the codons selected for encoding amino acids in the nucleotide sequences encoding the various regions in the CAR of the present invention can be modified.

[0200] Furthermore, those skilled in the art can prepare polynucleotides encoding each region, etc., based on such nucleotide sequence information using chemical synthesis methods (phosphoramidite method, etc.), methods utilizing PCR amplification, and other known techniques. Furthermore, polynucleotides encoding each region, etc. obtained in this way can be directly linked or linked via a spacer to obtain a polynucleotide encoding the CAR of the present invention. It should be noted that the connection of polynucleotides encoding each region, etc., as shown in the examples described below, can be achieved using known methods such as overlap extension PCR.

[0201] <Vector containing a polynucleotide encoding a chimeric antigen receptor>

[0202] The present invention provides a vector containing the above-mentioned polynucleotide. The vector of the present invention may be linear or circular, and examples thereof include viral vectors, plasmid vectors, episomal vectors, artificial chromosome vectors, and transposon vectors.

[0203] Examples of viral vectors include retroviral vectors such as lentivirus, Sendai virus vectors, adenoviral vectors, adeno-associated virus vectors, herpes virus vectors, vaccinia virus vectors, poxvirus vectors, poliovirus vectors, Sindbis virus vectors, rhabdovirus vectors, paramyxovirus vectors, and orthomyxovirus vectors.

[0204] Examples of the plasmid vector include plasmid vectors for animal cell expression, such as pcDNA3.1, pA1-11, pXT1, pRc / CMV, pRc / RSV, and pcDNAI / Neo.

[0205] An additional vector is a vector that can replicate autonomously outside the chromosome. The specific means of using an additional vector is well known (with reference to Yu et al., Science, 2009, 324, 797-801 pages). As an additional vector, for example, a vector containing a sequence required for autonomous replication from EBV, SV40, etc. as a vector element can be enumerated. As the vector element required for autonomous replication, specifically a gene for a protein that controls replication by binding to the replication origin and encoding the replication origin, for example, for EBV, the replication origin oriP and EBNA-1 genes can be enumerated, and for SV40, the replication origin ori and SV40LT genes can be enumerated.

[0206] Examples of artificial chromosome vectors include YAC (Yeast artificial chromosome) vectors, BAC (Bacterial artificial chromosome) vectors, and PAC (P1-derived artificial chromosome) vectors.

[0207] Among these vectors, retroviral vectors are preferred from the viewpoints that genes can be easily and efficiently introduced even into slowly growing cells and that stable expression strains can be easily established.

[0208] In addition to the above-mentioned CAR-encoding polynucleotide, the vector of the present invention may also contain expression control sequences such as promoters, enhancers, poly A addition signals, terminators, replication origins, nucleotide sequences encoding proteins that bind to the replication origin and control replication, nucleotides encoding other proteins, etc.

[0209] By operably configuring the above-mentioned polynucleotide encoding CAR and the nucleotide encoding other proteins described below downstream of the promoter, each polynucleotide can be efficiently transcribed. Examples of the "promoter" include CMV (cytomegalovirus) promoter, SRα promoter, SV40 early promoter, retroviral LTR, RSV (Rous sarcoma virus) promoter, HSV-TK (herpes simplex virus thymidine kinase) promoter, EF1α promoter, metallothionein promoter, heat shock promoter, etc.

[0210] As "nucleotides encoding other proteins", marker genes such as fluorescent protein genes, reporter genes, and drug resistance genes, genes encoding molecules involved in T cell activation such as cytokines, etc. can be listed. Furthermore, EGFR (truncated EGFR, tEGFR) without an intracellular domain as shown in the examples described below can also be listed. In addition, by using DNA encoding, for example, IRES, 2A peptide sequences (such as 2A peptide (T2A) from Thosea asigna), the above-mentioned other proteins can be expressed in a polycistronic together with the above-mentioned CAR.

[0211] Furthermore, in order to appropriately induce apoptosis of the administered CAR-expressing cells in the body of a subject (such as a hematological cancer patient) to whom CAR-expressing cells are administered, the vector of the present invention may contain a suicide gene as a "nucleotide encoding another protein." Examples of suicide genes include herpes simplex virus thymidine kinase (HSV-TK) and inducible caspase 9 (iCasp9). In addition, as agents that activate the functions of these genes, for HSV-TK, ganciclovir can be mentioned, and for iCasp9, AP1903, a dimerization-inducing compound (chemical induction of dimerization: CID), can be mentioned (see Cooper LJ. et al., Cytotherapy. 2006; 8(2): 105-17, Jensen MC et al., Biol Blood Marrow Transplant. 2010 Sep; 16(9): 1245-56, Jones BS., Front Pharmacol. 2014 Nov 27; 5: 254., Minagawa ... K., Pharmaceuticals (Basel). 2015 May 8; 8(2): pp. 230-49, Bole-Richard E., Front Pharmacol. 2015 Aug 25; 6: 174).

[0212] <Cells expressing chimeric antigen receptor>

[0213] The present invention provides cells expressing the CAR of the present invention. The cells of the present invention can be obtained by introducing a polynucleotide or vector encoding the CAR of the present invention into the cells.

[0214] The "cells" introduced into the polynucleotides or vectors of the present invention are preferably cells from mammals, and for example, cells from humans or cells from non-human mammals such as rodents (mice, rats, etc.), cattle, sheep, horses, dogs, pigs, monkeys, etc. can be used. The type of cells is not particularly limited, and cells collected from body fluids such as blood and bone marrow fluid, tissues such as spleen, thymus, lymph nodes, tumors, cancerous ascites, etc. can be used. As a preferred example, immune cells can be listed as CAR expression cells.

[0215] Examples of "immune cells" include CD4-positive CD8-negative T cells, CD4-negative CD8-positive T cells, T cells, αβ-T cells, γδ-T cells, NK cells, and NKT cells. These immune cells include those prepared from pluripotent stem cells such as iPS cells. Furthermore, as described above, various cell populations may be used as long as they contain lymphocytes or precursor cells. Examples of immune cells include PBMCs (peripheral blood mononuclear cells) collected from peripheral blood.

[0216] CAR expression cells can be activated before the polynucleotide of the present invention is introduced. For example, anti-CD3 antibodies and anti-CD28 antibodies can be used to stimulate and activate CAR expression cells. More specifically, stimulation based on anti-CD3 antibodies and anti-CD28 antibodies can be applied by culturing in a culture container (e.g., a culture dish) coated with anti-CD3 antibodies and anti-CD28 antibodies. Magnetic beads coated with anti-CD3 antibodies and anti-CD28 antibodies (e.g., Dynabeads T-Activator CD3 / CD28 provided by VERITAS) can also be used for the stimulation.

[0217] Furthermore, as shown in the Examples described below, in order to prevent exhaustion of the cells of the present invention, a tyrosine kinase inhibitor may be added to the culture medium during the production of the cells. Examples of such tyrosine kinase inhibitors include dasatinib.

[0218] In order to improve the survival rate / proliferation rate of cells, a culture medium to which T cell growth factors have been added can be used during the activation process. As T cell growth factors, IL-2, IL-15, IL-7, etc. can be used. T cell growth factors such as IL-2, IL-15, IL-7 can be prepared according to conventional methods. In addition, commercially available products can also be utilized. The use of T cell growth factors of animal species other than humans is not excluded, but human T cell growth factors (which can also be recombinant) are generally used.

[0219] Typically, for its application (administration to a subject), the cells after the polynucleotide of the present invention is introduced are proliferated. For example, a culture solution supplemented with T cell growth factor is used to culture the polynucleotide-introduced cells of the present invention (subcultured as needed). In addition to this culture, the same treatment (reactivation) as in the case of activation of CAR expression cells can also be performed.

[0220] It should be noted that, while serum-supplemented culture media (human serum, fetal bovine serum, etc.) can be used for culturing the cells of the present invention, the use of serum-free culture media allows for the production of cells that have the advantages of being safer for clinical use and less susceptible to variations in culture efficiency due to differences in serum batches. When serum is used, autologous serum, i.e., serum collected from a subject to whom the cells of the present invention are administered, is preferably used.

[0221] In addition, the cells of the present invention may also be cells in which the function of proteins (immune checkpoint substances, etc.) that suppress excessive immune responses is suppressed. Examples of such proteins include Programmed Death 1 (PD-1), PD-L1, PD-L2, CTLA-4, TIM-3, CEACAM (CEACAM-1, CEACAM-3, CEACAM-5, etc.), LAG-3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, and GAL9.

[0222] Furthermore, in order to facilitate allogeneic transplantation, the cells of the present invention may be cells in which the functions of endogenous proteins such as TCR and HLA are suppressed.

[0223] As a method for inhibiting the function of a protein, a knockout method targeting a gene encoding the above-mentioned protein, a method using a dsRNA (double-stranded RNA, such as siRNA) complementary to the transcription product of the above-mentioned gene, a method using an antisense RNA complementary to the transcription product, and a method using an RNA having a ribozyme activity that specifically cleaves the above-mentioned transcription product can be cited. In addition, a method for transforming a target gene using a site-specific nuclease (such as a DNA double-stranded cleavage enzyme such as zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), CRISPR-Cas9) is also suitable for inhibiting the function of the above-mentioned substance.

[0224] Examples of methods for introducing the polynucleotide or vector of the present invention into cells include lipofection, microinjection, calcium phosphate method, DEAE-dextran method, electroporation, and gene gun method. Furthermore, when the vector of the present invention is a retroviral vector, appropriate packaging cells can be selected based on the LTR sequence and packaging signal sequence of the vector, and retroviral particles can be prepared using these packaging cells. Examples of packaging cells include PG13, PA317, GP+E-86, GP+envAm-12, and Psi-Crip. Furthermore, 293 cells and 293T cells, which have high transfection efficiency, can also be used as packaging cells.

[0225] In addition, after the polynucleotide or vector of the present invention is introduced into cells, the expression of CAR in the cells can be confirmed by known methods such as flow cytometry, RT-PCR, Northern blotting, Western blotting, ELISA, and fluorescent immunostaining.

[0226] Multispecific antibodies

[0227] As shown in the Examples below, HLA-DR, the target of the antibodies of the present invention, is a blood cancer-specific cell surface antigen. Therefore, if immune cells could be induced to kill blood cancer cells using this antigen as a marker, this would be beneficial for the treatment of such diseases. Multispecific antibodies are an example of a method for achieving such immunotherapy.

[0228] A "multispecific antibody" refers to a monoclonal antibody that has binding specificities for at least two different antigens and retains multiple antigen recognition sites.

[0229] In the present invention, the multispecific antibody retains the above-mentioned antibody of the present invention or its functional fragment and an antigen recognition site for immune cells. The immune cells are not particularly limited, but as exemplified in the above-mentioned "Cells Expressing Chimeric Antigen Receptors", effector cells are preferred from the perspective of being able to kill target cells such as blood cancer cells. Examples of effector cells include NK (natural killer) cells, monocytes, macrophages, and eosinophils. In addition, examples of antigens that can be recognized by the multispecific antibodies of the present invention in these cells include stimulatory or inhibitory receptors present on the surface of these cells. More specifically, CD3, CD16, B7-H4, BTLA, CD4, CD8, CD25, CD27, CD28, CD32, CD56, CD137, CTLA-4, GITR, HVEM, ICOS, LAG-3, NKG2D, OX40, PD-1, TIGIT, TIM-3, VISTA, 4-1BB, NK-expressing KIR, B7-1, B7-2, B7H3, PD-L1, PD-L2, TNFSF9, etc. can be exemplified.

[0230] Preferred embodiments of the multispecific antibodies of the present invention include bispecific antibodies (Bispecific Antibody), more specifically, BsDb (bispecific diabody), scBsDb (single-chain bispecific diabody), scBsTaFv (single-chain bispecific tandem variable domains), DNL-(Fab)3 (Dock-and-lock trivalent Fab), sdAb (single-domain antibody), BssdAb (double single-chain complex antibody), Knobs-into-holes BsAb IgG, Ig-scFv fusion type, bispecific antibody-Fc fusion type, and dual variable region antibody (DVD-IgG).

[0231] In addition, the bispecific antibody can be appropriately prepared using known methods by those skilled in the art. As the known methods, for example, a method (quadroma method) can be enumerated in which a hybridoma producing an antibody that recognizes HLA-DR and a hybridoma producing an antibody that recognizes immune cells are further fused to produce the antibody. In addition, a method in which the functional fragments (such as Fab) of these different antibodies are chemically cross-linked can be enumerated. Further, a method in which the DNA encoding the functional fragments of these different antibodies is fused by a joint, the DNA construct obtained is introduced into a host cell and produced by the cell can be enumerated. Other examples include Knob-into-Hole (Genentech), Triomab / Quadroma (Trion Pharma / Fresenius Biotech), CrossMAb (Roche), electrostatic-matched (Amgen), LUZ-Y (Genentech), Strand Exchange Engineered Domain body (SEEDbody) (EMD Serono), Biclonic (Merus) Duo Body (Genmab A / S), and other methods for promoting heterodimerization of different antibodies or functional fragments thereof; the controlled Fab-ARM exchange method (CFAF method) described in International Publication No. 2008 / 119353 and International Publication No. 2011 / 131746; and Chengbin Wu et al., Generation and Characterization of a Dual Variable Domain Immunoglobulin (DVD-Ig TM ) The method described in Molecule, Springer Nature Experiments, 2010.

[0232] Antibody-drug conjugates

[0233] As shown in the Examples below, HLA-DR, the target of the antibodies of the present invention, is a blood cancer-specific cell surface antigen. Therefore, the present invention can also take the form of an antibody-drug conjugate (ADC) in which the antibodies of the present invention (particularly humanized antibodies) or their functional fragments are conjugated to a drug.

[0234] In the ADC of the present invention, the "drug" that can be bound to the antibody is not particularly limited, and examples thereof include cytotoxic substances known in the art. Examples of "cytotoxic substances" include anticancer agents such as irinotecan (CPT-11), irinotecan metabolite SN-38 (10-hydroxy-7-ethylcamptothecin), doxorubicin, paclitaxel, 5-fluorouracil, nimustine, ranimustine, temozolomide and other alkylating agents, gemcitabine, hydroxyurea and other metabolic antagonists, etoposide, vincristine and other plant alkaloids, mitomycin, bleomycin and other anticancer antibiotics, cisplatin and other platinum preparations, sorafenib, erlotinib and other molecular targeted agents, methotrexate, cytarabine, 6-thioguanine, 6-mercaptopurine, cyclophosphamide, ifosfamide, busulfan, MMAE (monomethyl auristatin E), DM1 (maytansine), and calicheamicin. Examples of the cell-killing substance include radioactive isotopes, such as 32 P. 14 C. 125 I. 3 H. 131 I. 186 Re、 188 Re、 10 B. 111 In, 90 Y. As a cytotoxic substance, it can be a photosensitive substance that enables the cytotoxic activity to function. More specifically, it can be a substance that is activated by light irradiation and thus changes itself into a form that exhibits cytotoxicity (cytotoxicity). It can also be a substance that produces a cytotoxic substance (cytotoxic substance). Examples include chlorins, chlorin e6, porfimer sodium, talaporfin sodium, verteporfin, and their precursors and derivatives. In addition, as a cytotoxic substance, toxic peptides can be listed, such as ribosome-inactivating proteins (RIPs) such as saporin, ricin, and Shiga toxin.

[0235] In addition, the binding of the antibody to the cell-killing substance can also be carried out by methods known in the art, and can be either direct binding or indirect binding. For example, as a direct binding, covalent binding can be used. As an indirect binding, binding via a linker can be used. Conventional techniques for linkers are described in, for example, Hermanson, G.T. Bioconjugate Techniques, Academic Press, 1996; Harris, J.M. and Zalipsky, S. eds., Poly (ethylene glycol), Chemistry and Biological Applications, ACS Symposium Series, 1997; Veronese, F. and Harris, J.M. eds., Peptide and protein PEGylation. Advanced Drug Delivery Review 54 (4), 2002. In addition, the linker can be a linear linker (a bivalent linker) or a branched linker (a trivalent or higher linker).

[0236] <Pharmaceutical Composition>

[0237] The present invention also provides pharmaceutical compositions (e.g., anticancer agents) containing the antibodies of the present invention or their variable regions, or antibody constructs retaining the same (such as the chimeric antigen receptor-expressing cells, multispecific antibodies, and antibody-drug conjugates (ADCs) described above, hereinafter also referred to as "the antibodies of the present invention, etc.") as active ingredients, as well as methods for treating diseases (e.g., blood cancers such as acute myeloid leukemia) comprising the step of administering a therapeutically effective amount of the antibodies of the present invention, etc. to a subject.

[0238] The "diseases" targeted by the present invention are not particularly limited as long as they are associated with cells that retain HLA-DR as a specific surface antigen. Examples include blood cancers, more specifically acute myeloid leukemia and its related diseases (myelodysplastic syndrome (MDS), acute lymphoblastic leukemia (ALL), B-cell malignant lymphoma, multiple myeloma, etc.). "Hematological cancers" can be primary, recurrent, secondary, or metastatic. "Acute myeloid leukemia (AML)" refers to a diverse group of blood tumors characterized by the clonal, autonomous proliferation of immature myeloid cells with impaired differentiation / maturation ability. It is also a myeloid blood cell cancer characterized by the rapid proliferation of abnormal leukemic cells in the bone marrow and the accompanying significant suppression of normal hematopoietic function, presenting with symptoms such as leukopenia, anemia, and thrombocytopenia.

[0239] In addition to containing the antibody of the present invention, the "pharmaceutical composition" of the present invention may contain other pharmacologically acceptable ingredients. As such other ingredients, for example, carriers, emulsifiers, wetting agents, pH buffers, culture media, excipients, disintegrants, buffers, isotonic agents, suspending agents, solubilizers, pain-relieving agents, stabilizers, preservatives, and preservatives can be listed. More specifically, as other pharmacologically acceptable ingredients, in the case of liquid preparations such as injections, aqueous solutions (physiological saline, water for injection, phosphate buffer, aqueous glucose solutions, aqueous glycerol solutions, etc.), aluminum hydroxide, etc. can be listed as examples. In addition, in the case of freeze-dried preparations, sugars (mannitol, lactose, sucrose, etc.), albumin, etc. can be listed as examples, but are not limited to these. Furthermore, the pharmaceutical composition of the present invention can be in the form of a kit that can be mixed before administering the above-mentioned ingredients. In addition, when used as an injection, it can be in the form of a syringe.

[0240] The pharmaceutical composition of the present invention may contain only the antibody of the present invention, etc. as an active ingredient, or may contain the antibody, etc. and at least one other anticancer agent. In addition, the antibody of the present invention, etc. can be administered together with other anticancer agents, thereby enhancing the anti-tumor effect. Other anticancer agents used for this purpose can be administered to the subject simultaneously, separately or continuously with the antibody of the present invention, etc., or can be administered with varying dosing intervals. Examples of such "anticancer agents" include venetoclax, azacitidine, dasatinib, cytarabine (Ara-C, Cytosar-U), enoxacin, quizartinib (AC220), sorafenib (BAY 43-906), lestaurinib (CEP-701), midostaurin (PKC412), carboplatin, carmustine, chlorambucil, dacarbazine, ifosfamide, lomustine, nitrogen mustard, procarbazine, pentostatin, (2'-deoxycoformycin), etoposide, teniposide, topotecan, vinblastine, vincristine, paclitaxel, dexamethasone, methylprednisolone, prednisone, all-trans retinoic acid, arsenic trioxide, interferon alpha, rituximab (rituximab(registered trademark)), gemtuzumab ozogamicin , imatinib mesylate, Cytosar-U, melphalan, busulfan (Marylan (registered trademark)), thiotepa, bleomycin, platinum (cisplatin), cyclophosphamide, Cytoxan (registered trademark), daunorubicin, doxorubicin, idarubicin, mitoxantrone, 5-azacytidine, cladribine, fludarabine, hydroxyurea, 6-mercaptopurine, methotrexate, 6-thioguanine, immune checkpoint inhibitors (anti-PD-1 antibodies, etc.) or any combination thereof, as long as they are agents with anti-tumor activity. In addition, the pharmaceutical composition of the present invention, the antibody of the present invention, etc. are not limited to chemotherapy using the above-mentioned anticancer agents, and can also be used in combination with other cancer treatment methods such as radiotherapy and cancer immunotherapy.

[0241] Furthermore, in the case of a pharmaceutical composition containing the cells of the present invention, other components may include dimethyl sulfoxide (DMSO), serum albumin, etc. to protect the cells, and antibiotics, etc. to prevent bacterial contamination. Furthermore, T cell activating factors such as cytokines, growth factors, and steroids, vitamins, immunostimulants, and immune checkpoint inhibitors may be included for the purpose of activating, inducing proliferation or differentiation of cells, and the cells of the present invention may be used in combination with these other components.

[0242] The method of administration of the pharmaceutical composition varies depending on the type of substance being administered, the form of the composition, the age, weight, sex, health status, etc. of the subject, and can be administered by any route of administration, such as parenteral administration (e.g., intravenous administration, arterial administration, topical administration), or oral administration. A preferred method of administration is parenteral administration, more preferably intravenous administration. Alternatively, local administration may be performed instead of systemic administration. Examples of local administration include direct injection into target tissues (such as bone marrow).

[0243] The dosage of the pharmaceutical composition can vary according to the age, weight, sex, health status, degree of symptom development and the ingredients of the pharmaceutical composition administered. In addition, the dosage schedule can also be appropriately adjusted according to these conditions. In addition to single administration, multiple administrations can also be performed continuously or regularly. Generally, in the case of intravenous administration of antibodies, the dosage is 0.1 to 1000 mg per kg of body weight per day for adults, preferably 1 to 100 mg. In addition, in the case of administering ADCs, the dosage is 0.001 to 1000 mg per kg of body weight per day for adults, preferably 0.01 to 100 mg. As the number of administrations of these antibodies or ADCs, for example, it can be administered once or multiple administrations at intervals of once a day to once a year (e.g., every week, every 10 to 30 days, every month, every 3 to 6 months, every six months, every year).

[0244] In addition, the dosage of cells (e.g., cells expressing chimeric antigen receptors) in the therapeutic method of the present invention may be, for example, 1×10 cells per kg of body weight in a single administration for an adult. 3 ~1×10 10 (preferably 1×10 4 ~1×10 9 , more preferably 1×10 5 ~1×10 8The dosing interval can be, for example, every week, every 10 to 30 days, every month, every 3 to 6 months, or every year. Furthermore, the cells of the present invention can autonomously proliferate in the body of the subject, so administration may be limited to a single dose. Furthermore, the number of cells of the present invention in the body can be monitored after administration, and the dosing period can be determined based on the results.

[0245] In the present invention, examples of "subjects" to whom the antibodies of the present invention are administered include, for example, individuals suffering from hematologic malignancies, individuals at risk of recurrence of hematologic malignancies, or individuals whose hematologic malignancies have relapsed. Furthermore, in the present invention, "treatment" includes alleviating characteristic symptoms or accompanying symptoms of hematologic malignancies (alleviating symptoms), preventing or delaying symptom progression, and improving abnormalities in clinical test values such as an increase in hematologic malignancies. Furthermore, it also includes preventing, delaying, or reducing the risk of hematologic malignancy recurrence.

[0246] In particular, the antibodies of the present invention can show allele specificity for HLA-DR. Therefore, in patients with blood cancer who have relapsed after HLA-DR-mismatched allogeneic transplantation, when the HLA-DR type of the recipient (blood cancer patient, etc.) is a positive type that is bound by the antibodies of the present invention, and the HLA-DR type of the donor is a negative type that is not bound by the antibodies of the present invention, CAR-T cells prepared from cells derived from the transplanted patient or the donor can specifically attack the recipient's blood cancer.

[0247] Furthermore, the antibodies of the present invention bind only to a portion of normal blood cells, such as B cells, and do not bind to monocytes, and furthermore, bind only to a portion of all hematopoietic stem cells, which are the source of all blood cells. Therefore, even when conventional autologous CAR-T cells, etc., are used for treatment of patients with blood cancer who have HLA-DR-positive cells, to which the antibodies of the present invention bind, the blood cancer cells are eliminated, and normal hematopoiesis is maintained by using negative cells, to which the antibodies of the present invention do not bind, thereby enabling treatment.

[0248] Example

[0249] The present invention will be described in more detail below based on examples, but the present invention is not limited to the following examples. These examples were carried out using the following materials and methods.

[0250] (Patient specimen)

[0251] After obtaining consent, bone marrow from patients with acute myeloid leukemia (AML) was collected from the iliac crest. Mononuclear cells were isolated using FicollPaque (GE Healthcare) and used for analysis.

[0252] (Production of anti-AML monoclonal antibodies)

[0253] AML cell lines (KG1a, THP-1, U937, HL60, MOLM-13) were injected into the plantar of 6-week-old BALB / c mice (CLEA Japan) for immunization. Lymphocytes collected from the popliteal lymph nodes after immunization 4 times were fused with SP2 / 0 mouse myeloma cells using PEG1500 (Roche Applied Science) and then inoculated into 96-well plates with HAT culture medium to screen for hybridomas. In order to identify hybridomas that produce monoclonal antibodies that bind to AML cells and do not bind to normal blood cells, the AML cell lines were first reacted with the monoclonal antibodies in the supernatant of each hybridoma, and then reacted with PE-labeled anti-mouse IgG antibodies (BioLegend 405307) and analyzed by flow cytometry. Peripheral blood mononuclear cells (PBMCs) from healthy individuals were then stained in the same manner, and after screening for hybridomas that produce monoclonal antibodies that do not bind to normal blood cells, the cells and supernatant were stored for subsequent analysis.

[0254] (Flow cytometry analysis)

[0255] Single cell suspensions were stained with fluorescently labeled antibodies. Anti-CD34-APC (8G12, BD Biosciences), anti-CD38-FITC (HIT2, Biolegend), anti-CD3-Cy7PE (UCHT1, BioLegend), anti-CD19-Cy7APC (HIB19, BioLegend), anti-CD14-BV510 (M5E2, Biolegend), anti-HLA-DR-APC (L243, Biolegend), anti-CD11c-FI TC (Bu15, Biolegend), anti-CD19-PE (HIB19, Biolegend), anti-CD279-BV510 (EH12.2H7, Biolegend), anti-CD223-FITC (11C3C65, Biolegend), anti-CD366-PE (F38-2E2, Biolegend), goat anti-mouse IgG-PE (405307, BioLegend), goat anti-mouse F(ab')2-Alexa Fluor 647 (115-605-072, Jackson ImmunoResearch), biotin-conjugated anti-EGFR antibody (Erbitux), and streptavidin-PE (405204, Biolegend). KG2032 (mouse IgG2a) was purified using Protein G Sepharose 4 Fast Flow (GE Healthcare) and used for staining at a concentration of 10 μg / ml. Analysis and cell sorting were performed using FACSCanto II or FACS Aria II (BD Bioscience). Data were analyzed using FlowJo software. For analysis using activated T cells, PBMC from healthy individuals were isolated at 1×10 6 The cells were stimulated in the presence of 3 μg / ml PHA for 3 days.

[0256] (Identification of KG2032 antigens using CRISPR gRNA library)

[0257] First, clones of Daudi cells expressing the Cas9 protein were obtained. Specifically, Daudi cells were infected with a lentiviral vector expressing Cas9, and 10 μg / ml of blasticidin was added for 4 days. After screening for cells that had been transfected with the vector, single cells were sorted in a 96-well plate. After these cells were amplified, the Cas9 reporter gene was introduced (see Tzelepis K et al., Cell Rep. 2016; 17(4): 1193-205.), and clones with good knockout efficiency were selected.

[0258] Then, the clones of Daudi cells expressing Cas9 protein were infected with a human genome-wide knockout CRISPR library (provided by Yusa Laboratory, Kyoto University) with an efficiency of about 30%. After that, 0.5 μg / ml of puromycin was added for 3 days to select cells that had been introduced with the CRISPR library. The cells were further multiplied and 2×10 8 5×10 cells were stained with KG2032, and 5×10 cells were sorted from the 5% fraction that bound KG2032 weakly (KG2032low). 6 DNA was extracted from the sorted cells using DNeasy Blood & Tissue Kits (QIAGEN) and analyzed by NGS. 7 DNA was also extracted from 10 cells using the Blood & Cell Culture DNA Maxi Kit (QIAGEN) as a control.

[0259] (Production of knockout cells)

[0260] Guide RNA (gRNA) for knockout of HLA-DR was synthesized using the GeneArt Precision gRNA Synthesis Kit (Thermo Fisher Scientific). The following two gRNAs were produced:

[0261] gRNA sequence (1): GTGCGCTTCGACAGCGACGT (SEQ ID NO: 31),

[0262] gRNA sequence (2): GACGGAGCGGGTGCGGTTCC (SEQ ID NO: 32).

[0263] 2 × 10 5 Each Daudi cell was transfected with 1 μg of TrueCut Cas9 Protein v2 (Thermo Fisher Scientific) and 200 ng of the prepared gRNA. Nine days later, cells were stained with anti-HLA-DR-APC, and HLA-DR knockout cells were sorted for analysis.

[0264] (Identification of the KG2032 Epitope)

[0265] HLA-DRB1 production by overlapping PCR 1454 (KG2032 positive) and HLA-DRB1 The chimeras were constructed by introducing genes into K562 cells using a retroviral vector, and two days later, they were stained with KG2032 and L243, and the presence of binding was analyzed by flow cytometry.

[0266] (Construction and production of chimeric antigen receptor (CAR) 1)

[0267] The cDNA encoding the variable portion of KG2032 was obtained by 5' RACE using the SMARTer RACE 5' / 3' Kit (Takara), and the sequence was identified. Figure 8A As shown, the light chain (VL) and heavy chain (VH) were fused with the help of a linker sequence using overlapping PCR. Furthermore, overlapping PCR was used to fuse them with CD28 and CD3ζ or with CD8α, 4-1BB and CD3ζ ( Figure 8A The KG2032-CAR expression vector (also referred to as "KG2032-CD28-CD3ζ-CAR" and "KG2032-BBz-CAR") was prepared by inserting the "28ζ" and "BBζ" sequences shown in the figure into a retroviral vector. To enable measurement of transfection efficiency using an anti-EGFR antibody, the sequence of the EGFR with a defective intracellular region was added to the KG2032-CAR expression vector in the form of a T2A sequence linked to the CD3ζ sequence.

[0268] (Production of CAR-T cells)

[0269] Each KG2032 CAR expression vector was introduced into 293T cells together with the Gag-pol vector and the VSV-G vector using Lipofectamine 2000 (Invitrogen). The supernatant was collected 48 hours and 72 hours later to prepare the viral vector. PBMCs from healthy individuals were stimulated with anti-CD3 antibodies (OKT3, eBioscience) and anti-CD28 antibodies (CD28.2, eBioscience) to prepare activated T cells, which were then infected with the supernatant containing the virus. The CAR-introduced T cells were then cultured for 6 days in a medium supplemented with 100 IU / ml of IL-2. When dasatinib was added, it was added at a concentration of 1 μM on days 4-6. On day 6, the efficiency of CAR introduction was analyzed using goat anti-mouse F(ab')2-Alexa Fluor 647 (115-605-072, Jackson ImmunoResearch) or a biotin-conjugated anti-EGFR antibody.

[0270] (Assay 1 for cytokine production)

[0271] The cytokine production of KG2032 CAR-T cells or control T cells was measured using a human IFN-gamma Quantikine ELISA kit / human IL-2 Quantikine ELISA kit (R&D Systems). Specifically, 1×10 effector cells and 1×10 target cells were placed in the same cytokine pool. 5 The cells were co-cultured in a 96-well plate, and the supernatant after 16 to 24 hours was diluted to fall within the range of the standard curve and measured.

[0272] (Determination of cell killing activity 1)

[0273] pass 51 Cr release assay was used to determine the tumor cell killing ability of T cells. 5 25 μCi of 51 Cr sodium chromate solution (PerkinElmer) was incubated at 37°C for 1.5 hours, and 1×10 4 The target cells and effector cells were co-cultured at various effector cell / target cell ratios. After 4 hours, the released 5-mercaptoethanol into the supernatant was counted using a gamma counter. 51 Cr was counted. 1×10 labeled cells were cultured in 1% Triton X-100 or culture medium. 4 cells, measuring total or spontaneous release 51 Cr. Cell killing activity was measured by [(specific 51 Cr release-spontaneous 51 Cr release) / (total 51 Cr release-spontaneous 51 Cr release)]×100 was used to calculate.

[0274] (Xenograft Mouse Model 1)

[0275] Luciferase gene was introduced into KG1a cells using lentiviral vector to produce KG1a-luc / venus. Female NOD / SCID / IL-2Rγcnull (NOG) mice (CLEA, Japan) aged 6-8 weeks were irradiated with 1.2 Gy of radiation and then injected with 4×10 6 luciferase-expressing KG1a cells (KG1a-luc / venus). Five days later, VivoGlo luciferin (Promega, 150 mg / kg body weight) was intraperitoneally administered, and images were taken using an in vivo imaging system (IVIS) and analyzed using LivingImage software (PerkinElmer). The next day, 1-2 × 10 6 CAR-T cells or control T cells were added and then imaged using IVIS every week.

[0276] (Construction and production of chimeric antigen receptor (CAR) 2)

[0277] The cDNAs for the variable regions of the light and heavy chains of KG2032 were fused to the cDNAs for CD28 and CD3ζ using overlapping PCR. Furthermore, the T2A-IL-15 cDNA was also fused to the KG2032 CAR using overlapping PCR.

[0278] (Production of CAR NK cells)

[0279] Flow cytometry was used to measure the reactivity of KG2032 to CD19+ B cells, thereby identifying umbilical cord blood (CB) with KG2032-non-reactive HLA. T cells were removed using CD3 MicroBeads (Miltenyi Biotec). CB monocytes depleted of T cells were stimulated with K562-mb15-41BBL cells irradiated with 100 Gy and cultured in the presence of 20 IU / mL of IL-2. One week later, a retrovirus expressing the KG2032 CAR-T2A-IL-15 cDNA was introduced into NK cells from CB using RetroNectin. The cells were then restimulated with K562-mb15-41BBL cells irradiated with 100 Gy, cultured for a further week, and used for subsequent experiments.

[0280] (Determination of cell killing activity 2)

[0281] pass 51 Cr release assay was used to determine the tumor cell killing ability of NK cells. 5 Target cells were incubated at 37°C with 25 μCi of [ 51 Cr] sodium chromate (PerkinElmer) for 1.5 hours. 4 The cells were incubated with effector cells for 4 hours, and the supernatant was counted using a gamma counter. 51 Cr release was counted. 1×10 4 The total number of labeled targets was determined by incubating them in 1% Triton X-100 or culture medium. 51 Cr release and spontaneous 51 Cr release. Cell killing activity was measured by [(specific 51 Cr release-spontaneous 51 Cr release) / (total 51 Cr release-spontaneous 51 Cr release)]×100 was used to calculate.

[0282] (CD107a degranulation assay)

[0283] KG2032 CAR NK cells or control NK cells (2.5×10 5 cells) and KG1a AML cells or bone marrow cells of AML patients (5×10 4 Cells were co-cultured in 96-well plates at an effector cell:target cell ratio of 5:1. Anti-CD107a Alexa Fluor 647 (1:50) and monensin (BD Biosciences, 1:1500) were added at the start of the culture. After 5 hours of culture, the cells were stained with anti-CD56-PE and analyzed by flow cytometry. It should be noted that the HLA-DR allele type of the AML patient was DRB1. 08:02 / 12:01.

[0284] (Xenograft Mouse Model 2)

[0285] KG1a AML cells were intravenously transplanted into NOD / SCID / IL-2Rγnull (NOG) mice (In VivoScience) to establish a seeding AML model. 6-8 week old female NOG mice (irradiated with 1.0-2.4 Gy 4-24 hours before transplantation) were intravenously injected with 1×10 6 In experiments using KG2032 CAR NK cells, 1.0-1.4×10 cells were injected on days 1 and 3 after AML cell transplantation. 6 KG2032 CAR NK cells or control NK cells were used. Tumor growth in mice was measured by measuring fluorescence upon administration of luciferin using IVIS.

[0286] (Production of modified KG2032 CAR-T cells)

[0287] The KG2032 CAR cDNA was constructed by fusing the variable region cDNAs of the light and heavy chains of KG2032 with CD8α, 4-1BB, and CD3ζ cDNAs using overlapping PCR. A mutation replacing tyrosine with phenylalanine within the CD3ζ ITAM motif in the KG2032 CAR sequence was introduced using the PrimeSTAR Mutagenesis Basic Kit (Takara).

[0288] (Preparation of single-cell suspension of intestinal mucosal epithelial cells)

[0289] In order to prepare a single cell suspension of intestinal mucosal epithelial cells, the mucosa was cut into 3 mm thickness, washed 3 times with phosphate buffered saline (PBS) (Nacalai Tesque), and incubated at 37 ° C for 30 minutes in HBSS (Nacalai Tesque) containing 10mM EDTA. The epithelial cells were then shaken, peeled off, and recovered. After centrifugation at 400g for 5 minutes, the cells were suspended in TrypLE Express (Thermo Fisher Scientific) containing 500U / mL DNase I and incubated at 37 ° C for 30 minutes to obtain a single cell suspension. The DNA of the intestinal epithelial cells was extracted using DNeasy Blood & Tissue Kit (QIAGEN). HLA-DRB1 typing was performed by the HLA Research Institute (Kyoto, Japan).

[0290] (Assay 2 for cytokine production)

[0291] The modified KG2032 CAR-T cells or control T cells were mixed with intestinal epithelial cells or leukemia cells at 1×10 5 The cells were co-cultured for 16 hours, and the cytokine secretion into the culture supernatant was measured using ELISA kits (IFN-γ and IL-2; R&D Systems).

[0292] (Determination of cell killing activity 3)

[0293] pass 51 Cr release assay was used to determine the cell killing activity of modified KG2032 CAR-T cells. 5 Target cells were incubated at 37°C with 25 μCi of [ 51 Cr] sodium chromate (PerkinElmer) for 1.5 hours. 4 The cells were incubated with effector cells for 4 hours, and the supernatant was counted using a gamma counter. 51 Cr release was counted by incubating 1×10 4 marker targets, thereby determining the total 51 Cr release and spontaneous 51 Cr release. Cell killing activity was measured by ([specific 51 Cr release-spontaneous 51 Cr release] / [total 51 Cr release-spontaneous 51 Cr release])×100 was used to calculate.

[0294] (Xenograft Mouse Model 3)

[0295] KG1a AML cells were intravenously transplanted into NOD / SCID / IL-2Rγnull (NOG) mice (In VivoScience) to establish a seeding AML model. 6-8 week old female NOG mice (irradiated with 1.0-2.4 Gy 4-24 hours before transplantation) were intravenously injected with 1-4 × 10 6 luciferase-expressing KG1a cells. On day 5, mice were intraperitoneally injected with VivoGlo luciferin (Promega, 150 mg / kg body weight). Tumor growth was measured by observing the fluorescence emitted by the tumor using an in vivo imaging system (IVIS) equipped with Living Image software (PerkinElmer). 1.1-2.2×10 6 modified KG2032 CAR-T cells or control T cells.

[0296] (Xenograft Mouse Model 4)

[0297] DNA from AML cells was extracted using the DNeasy Blood & Tissue Kit (QIAGEN). HLA-DRB1 typing was performed by the HLA Institute (Kyoto, Japan), and AML cells with KG2032-reactive HLA-DRB1 were used in the experiment. BM cells from AML patients were transplanted into the bone marrow of NOG mice. 4×10 AML cells, from which CD3-positive T cells had been removed, were irradiated to female NOG mice aged 6 to 8 weeks with 1.2 Gy of radiation 4 to 24 hours before transplantation. 5 Six days later, mice were injected intravenously with 2×10 6 One month after infusion, BM cells were stained with anti-human CD45-Cy7APC (2D1, BioLegend), anti-human CD34-APC (8G12, BD Biosciences), anti-human CD3-PE (HIT3a, BioLegend), anti-mouse Ter119-PerCPCy5.5 (Ter-119, BioLegend), and anti-mouse CD45-Cy7PE (30-F11, BioLegend) and analyzed by flow cytometry.

[0298] The results of experiments performed using the above-mentioned materials and methods are shown below.

[0299] (Identification of AML-specific monoclonal antibody KG2032)

[0300] To obtain AML-specific monoclonal antibodies (mAbs), approximately 14,000 hybridomas secreting mAbs that bind to various AML cell lines and cells were first established from bone marrow (BM) cells of AML patients.

[0301] These mAbs were then screened for 1,078 mAbs that did not bind to cells other than B cells in peripheral blood mononuclear cells (PBMCs) from healthy donors. Furthermore, BM cells from AML patients were stained with these candidate mAbs, ultimately identifying the clone KG2032 as a mAb that specifically binds to AML.

[0302] About KG2032, such as Figure 1A As shown in , no binding was confirmed in certain PBMCs from healthy donors used in the screening. Figure 1B As shown, KG2032 bound to nearly all leukemic cells in 7 of 14 AML patients.

[0303] (Identification of the Antigen Recognized by KG2032)

[0304] Try to pass Figure 2A The steps shown below identify the antigen recognized by KG2032. First, a human genome-wide knockout CRISPR library was introduced into Daudi cells expressing Cas9 protein. The cells into which the library was introduced were concentrated using puromycin. These cells were further multiplied and 2×10 8 The cells were stained with KG2032 and 5×10 6 KG2032low5% fraction ( Figure 2B ).

[0305] Next-generation sequencing (NGS) was used to analyze the sequences of gRNAs introduced into KG2032low cells before and after sorting. As a result, HLA-DRA, HLA-DRB1, CIITA, and CD74 ( Figure 2C The latter two are believed to be molecules necessary for HLA-DR expression on the cell surface, suggesting that KG2032 recognizes HLA-DR. Therefore, the binding of KG2032 to HLA-DR-deficient Daudi cells was analyzed, and the results were as follows: Figure 2D As shown in Figure 2, no such binding was observed, indicating that the antigen recognized by KG2032 is HLA-DR. Figure 2E As shown, it was found that the antigen recognized by 8 clones different from KG2032 among the 32 clones was also HLA-DR.

[0306] The amino acid sequences of the variable regions of the anti-HLA-DR antibodies of the present invention are shown in the following Tables 1 and 2. Furthermore, the amino acid sequences of the CDRs determined from these variable regions by Kabat are shown in Tables 3 and 4.

[0307] [Table 1]

[0308]

[0309] [Table 2]

[0310]

[0311]

[0312]

[0313] (HLA-DRB1 allele specificity recognized by KG2032)

[0314] HLA-DRB1 is a highly polymorphic molecule, so we investigated which allele of HLA-DRB1 is recognized. Figure 3 As shown, KG2032 expressed HLA-DRB1 0404, 0405, 0410, 0803, 0901 or 1454. On the other hand, KG2032 did not bind to K562 cells expressing HLA-DRB1. 0101, 0403, 0802, 1101 or 1502 K562 cells.

[0315] Furthermore, if Figure 4A As shown, KG2032 did not bind to any PBMC cells from a donor with the KG2032-negative HLA-DRB1 gene (0403 / 0802). Furthermore, staining of peripheral blood from a donor with the KG2032-positive HLA-DRB1 gene (0901) revealed that while binding to B cells and activated T cells was observed, the binding was extremely weak compared to the existing anti-HLA-DR antibody L243.

[0316] Furthermore, if Figure 4A As shown in FIG, KG2032 does not bind to a portion of monocytes and T cells that express HLA-DR, which are bound to L243. Figure 4B As shown, binding of KG2032 to leukemia cells was observed in AML patients with KG2032-positive HLA-DRB1 genes.

[0317] The results of staining bone marrow cells from donors with KG2032-positive HLA-DRB1 genes 0410 and 0803 showed that although binding to hematopoietic stem cells (CD34+CD38-) and hematopoietic progenitor cells (CD34+CD38+) was observed, the binding was extremely weak compared to the existing anti-HLA-DR antibody L243. Figure 4C As shown, KG2032 binds only to a very small portion of hematopoietic stem cells that express HLA-DR, which are bound to L243.

[0318] Based on these results, the following examples (1) and (2) of using KG2032 are considered for the treatment of AML.

[0319] (1) In patients with AML who have relapsed after HLA-DR mismatched allogeneic transplantation, if the recipient (leukemia patient) has a KG2032-positive HLA-DR and the donor has a KG2032-negative HLA-DR, it is believed that KG2032-derived CAR-T cells produced from T cells derived from the transplanted patient or the donor specifically attack the recipient's leukemia. Figure 5A ).

[0320] (2) It is believed that KG2032 binds only to a portion of cells such as B cells in normal blood cells, and only to a portion of hematopoietic stem cells that are the source of all blood cells. Therefore, even if conventional autologous CAR-T cells of AML patients with KG2032-positive HLA-DRB1 type are used for treatment, leukemia cells are eliminated and normal hematopoiesis is maintained by KG2032-negative cells, thus establishing the therapeutic effect. ( Figure 5B ).

[0321] (Identification of the epitope recognized by KG2032)

[0322] To identify the epitope recognized by KG2032, HLA-DRB1 1454 (KG2032 positive) and HLA-DRB1 1502 (KG2032 negative) amino acid sequence ( Figure 6 ). Furthermore, overlapping PCR was used to produce Figure 7A Expression of HLA-DRB1 is shown 1454 and HLA-DRB1 1502 chimeric protein expression vector. Then they were introduced into K562 cells by reverse transcription. After 2 days, they were stained with KG2032 and L243 and analyzed by flow cytometry for binding. The results were as follows. Figure 7B As shown, Figure 6Region 3 (AA74-89) is shown to be required for the binding of KG2032.

[0323] Furthermore, the amino acid sequences of region 3 of HLA-DRB1 to which KG2032 binds and HLA-DRB1 to which it does not bind were compared. Figure 7C As shown, it was found that the amino acid at position 86 in HLA-DR to which KG2032 did not bind was often aspartic acid (D), whereas the amino acid at position 86 in HLA-DR to which KG2032 bound was serine (S), valine (V), or alanine (A).

[0324] Therefore, K562 cells were made to express HLA-DRB1 that binds KG2032. The antibody wherein the serine (S) at position 86 of 0405 is substituted with aspartic acid (D). Figure 7D As shown, it can be seen that the binding of L243 is maintained, but the binding of KG2032 is lost.

[0325] These results indicate that in order for KG2032 to bind, the amino acid at position 86 in region 3 must be an amino acid other than aspartic acid (serine, valine, alanine, etc.).

[0326] (Development of CAR-T cells from KG2032 non-reactive DR donors)

[0327] A chimeric antigen receptor (KG2032-CAR) containing the variable region of KG2032 was prepared. First, the cDNA of the variable region of KG2032 was obtained by 5'RACE method using SMARTerRACE 5' / 3' Kit (Takara), and the sequence was identified. Figure 8A As shown, the light chain (VL) and heavy chain (VH) were fused using overlapping PCR with the help of a linker sequence, and then fused with CD28 and CD3ζ or with CD8α, 4-1BB and CD3ζ using overlapping PCR to produce two KG2032-CARs (KG2032-CD28-CD3ζ-CAR and KG2032-BBz-CAR). It should be noted that the composition of these CARs is shown in Table 5 below.

[0328]

[0329] Then, KG2032 CAR was introduced into T lymphocytes from KG2032-negative HLA-DRB1 (0403 / 0802) donors using a retroviral vector to produce KG2032-CAR-T cells ( Figure 8B and 8C ).

[0330] like Figure 8D and 8E As shown, the CAR-T cells prepared in this way produced IFN-γ and IL-2 and exhibited cytotoxic activity when co-cultured with KG1a cells bound to KG2032. On the other hand, no cytokine production or cytotoxic activity was observed when co-cultured with THP-1 cells not bound to KG2032.

[0331] It should be noted that these results were observed when the costimulatory molecule was CD28 or 4-1BB, so in subsequent experiments, only KG2032-CAR (KG2032-BBz-CAR) with 4-1BB as the costimulatory molecule was evaluated.

[0332] Then, in order to prevent the exhaustion of CAR-T cells, attempts were made to add dasatinib, a tyrosine kinase inhibitor, to the production of CAR-T cells. Figure 8F As shown in Figures 1 to 3, treatment with 1 μM dasatinib promoted the proliferation of KG2032-BBz-CAR-T cells, while reducing the expression of exhaustion markers (PD-1, TIM-3, and LAG-3). Furthermore, IL-2 cytokine production was increased when co-cultured with KG1a.

[0333] Then, after transplanting luciferase-expressing KG1a cells into NOG mice, KG2032-BBz CAR-T cells were administered to evaluate their anti-leukemia effects. Figure 8I As shown in Figures 2 and 3, a significant anti-leukemic effect was observed.

[0334] (Development of CAR-NK cells from KG2032 non-reactive DR donors)

[0335] A vector for co-expressing a chimeric antigen receptor fused with CD28 and CD3ζ and IL-15 in the variable region of KG2032 was prepared. NK cells (CAR-NK cells) expressing the chimeric antigen receptor were then prepared and co-cultured with a cell line (KG1a cells) from human acute myeloid leukemia. As a result, although not shown in the figure, it was found that the above-mentioned CAR-NK cells also showed cell-killing activity. Furthermore, the result of administering the above-mentioned CAR-NK cells to mice transplanted with KG1a cells was that a significant anti-tumor effect was exerted.

[0336] When specifically described, the variable region, CD28, and CD3ζ of KG2032 are fused to produce a KG2032CAR construct for CAR-NK cells. Furthermore, in order to improve the proliferation and survival of CAR-NK cells, a retroviral vector that co-expresses IL-15 with KG2032 CAR was designed. T cells were removed from human cord blood (CB) cells with KG2032-non-reactive HLA-DRB1, and K562 cells (irradiated with radiation) expressing 4-1BB ligands and membrane-bound IL-15 were used to stimulate NK cells to proliferate. 14 days after the start of culture, NK cells from CB into which KG2032 CAR / IL-15 had been introduced by retrovirus were analyzed ( Figures 9A to 9C ).

[0337] When co-cultured with KG1a cells or primary AML cells from patients, CD107a degranulation was significantly increased in KG2032 CAR-NK cells compared with control (non-CAR-introduced) NK cells, but not in co-culture with HLA-DR-deficient KG1a cells ( Figure 9D ).

[0338] KG2032 CAR-NK cells showed significant cytotoxicity against KG1a cells and primary AML cells from patients, but not against HLA-DR-deficient KG1a cells ( Figure 9E ).

[0339] Furthermore, when KG2032 CAR-NK cells were administered to immunodeficient mice transplanted with KG1a AML cells, leukemia cells were significantly reduced and the survival of the mice was prolonged ( Figures 9F to 9H ).

[0340] (Development of modified KG2032 CAR-T cells)

[0341] Severe cytokine release syndrome (CRS) has the possibility of overexpressing HLA-DR in non-hematological tissues. Therefore, in order to maximize the safety of KG2032 CAR-T cells, severe CRS should be avoided. It is reported that by modifying the CAR construct, severe CRS can be prevented without losing the effectiveness of CAR-T cells (Ying, Z. et al. A safe and potent anti-CD19 CAR T cell therapy. Nat Med 25, 947-953 (2019). https: / / doi.org:10.1038 / s41591-019-0421-7). Therefore, in order to reduce the cytokine production caused by CAR-T cells when co-cultured with AML cells, the KG2032 CAR construct is modified by changing the order of the heavy chain (VH) and light chain (VL) in the antigen recognition domain and extending the length of the CD8α hinge / transmembrane domain. Furthermore, in order to weaken the activation signal of CAR, mutations were introduced into two of the three immunoreceptor tyrosine-based activation motif (ITAM) domains of the CD3ζ sequence (Feucht, J. et al. Calibration of CAR activation potential directs alternative T cell fates and therapeutic potency. Nat Med 25, 82-88 (2019)). It should be noted that the composition of the modified KG2032 CAR is shown in Table 5 above.

[0342] First, we analyzed IFN-γ secretion by either naive cells or modified KG2032 CAR-T cells after co-culture with KG1a AML cells. We confirmed that IFN-γ secretion by modified KG2032 CAR-T cells was lower than that by naive cells, indicating that the mutation attenuated the CAR activation signal.

[0343] The secretion of IFN-γ and IL-2 by the engineered KG2032 CAR-T cells was then analyzed after co-culture with normal intestinal epithelial cells or KG1a cells purified from normal small intestine resection specimens from colorectal cancer patients. The results showed that the engineered KG2032 CAR-T cells were not activated in co-culture with normal intestinal epithelial cells harboring KG2032-reactive HLA-DRB1. On the other hand, the engineered KG2032 CAR-T cells maintained cytotoxic activity against KG1a AML cells and primary AML cells derived from patients.

[0344] Furthermore, modified KG2032 CAR-T cells were administered to mice transplanted with KG1a AML cells. The results showed that administration of modified KG2032 CAR-T cells significantly reduced the number of KG1a AML cells colonizing the mice and prolonged their survival. It should be noted that no significant toxicity was observed in mice treated with modified KG2032 CAR-T cells.

[0345] Furthermore, the modified KG2032 CAR-T cells were administered to immunodeficient mice transplanted with patient-derived AML cells ( Figure 10A As a result, the engineered KG2032 CAR-T cells eradicated patient-derived AML cells transplanted into immunodeficient mice ( Figure 10B and 10C ). It should be noted that no obvious toxicity was observed in mice administered with modified KG2032 CAR-T cells.

[0346] Industrial applicability

[0347] As described above, according to the present invention, by targeting HLA-DR, a cell surface antigen specific for blood cancers such as acute myeloid leukemia, and using antibodies or functional fragments thereof that recognize this antigen, or chimeric antigen receptors that retain this antigen, these diseases can be treated.

[0348] In particular, the antibodies can exhibit allele specificity for HLA-DR. Therefore, in patients with hematological cancer who have relapsed after HLA-DR-mismatched allogeneic transplantation, if the recipient (hematological cancer patient) has HLA-DR that is positive for the antibodies of the present invention and the donor has HLA-DR that is not bound by the antibodies of the present invention, CAR-T cells derived from the antibodies of the present invention produced from cells derived from the donor can specifically attack the recipient's hematological cancer cells.

[0349] Furthermore, if the antibodies of the present invention bind only to a subset of normal blood cells, such as B cells, and do not bind to monocytes, etc., even if conventional autologous CAR-T cells from a patient with blood cancer that is HLA-DR positive and to which the antibodies of the present invention bind are used for treatment, the blood cancer cells are eliminated, and normal hematopoiesis is maintained by the negative cells to which the antibodies of the present invention do not bind, thereby enabling treatment.

[0350] Therefore, the present invention is useful in the development of therapeutic drugs for blood cancers and the like.

Claims

A composition for treating blood cancer, comprising an antibody or a functional fragment thereof that recognizes HLA-DR.

2. The composition according to claim 1, wherein Contains immune cells expressing a chimeric antigen receptor that retains the antibody or a functional fragment thereof.

3. The composition according to claim 1, wherein The invention contains a multispecific antibody that retains the antibody or its functional fragment and an antigen recognition site for immune cells.

4. The composition according to claim 1, wherein The antibody or functional fragment thereof does not bind to monocytes.

5. The composition according to claim 4, wherein Contains immune cells expressing a chimeric antigen receptor that retains the antibody or a functional fragment thereof.

6. The composition according to claim 4, wherein The invention contains a multispecific antibody that retains the antibody or its functional fragment and an antigen recognition site for immune cells.

7. The composition according to claim 1, wherein The antibody or a functional fragment thereof binds to an HLA-DRB1 allele in which the amino acid at position 86 is other than aspartic acid, and does not bind to an HLA-DRB1 allele in which the amino acid at position 86 is aspartic acid.

8. The composition according to claim 1, wherein The antibody or its functional fragment binds to a region of the HLA-DRB1 sequence comprising amino acids 74 to 89 in which the amino acid at position 86 is an amino acid other than aspartic acid, and does not bind to a region of the HLA-DRB1 sequence comprising amino acids 74 to 89 in which the amino acid at position 86 is aspartic acid.

9. An antibody or a functional fragment thereof that recognizes HLA-DR, having any one of the following characteristics (a) to (i): (a) having heavy chain variable regions comprising complementarity determining regions 1 to 3 comprising the amino acid sequences set forth in SEQ ID NOs: 1 to 3, respectively, and light chain variable regions comprising complementarity determining regions 1 to 3 comprising the amino acid sequences set forth in SEQ ID NOs: 5 to 7, respectively; (b) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 34 to 36, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 38 to 40, respectively; (c) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 42 to 44, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 46 to 48, respectively; (d) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 50 to 52, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 54 to 56, respectively; (e) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 58 to 60, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively; (f) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 66 to 68, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively; (g) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 70 to 72, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively; (h) a heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 74 to 76, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62 to 64, respectively; (i) A heavy chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 66 to 68, respectively, and a light chain variable region comprising complementarity determining regions 1 to 3 comprising the amino acid sequences of SEQ ID NOs: 62, 78, and 64, respectively. 10 . An immune cell expressing a chimeric antigen receptor retaining the antibody or functional fragment thereof according to claim 8 or 9 .

11. A pharmaceutical composition comprising the antibody or functional fragment thereof according to claim 8 or 9, or an immune cell expressing a chimeric antigen receptor comprising the antibody or functional fragment thereof.

12. A composition for administration to a blood cancer patient transplanted with hematopoietic stem cells, comprising an antibody recognizing HLA-DR or a functional fragment thereof. The donor of the hematopoietic stem cells has a different HLA-DR allele type from that of the patient, The antibody or functional fragment thereof binds to the patient's HLA-DR and does not bind to the donor's HLA-DR.

Images