Compositions, kits and methods for detecting viral sequences

Abstract

A composition for detecting the presence of monkey pox virus in a biological sample comprises a monkey pox nucleic acid forward primer; a monkey pox nucleic acid reverse primer; and monkey pox nucleic acid probes. The method includes a multiplex assay including a set of three channels, each channel having a single assay, including a monkey pox assay with a reporter factor and a quencher, a non-ceiling positive pox assay with a reporter factor and a quencher, and an RNase P assay with a reporter factor and a quencher. A kit for detecting monkey pox virus nucleic acid includes assay components including a forward primer and a reverse primer and a probe for each of the three assays in the multiplex assay.

Description

Technical Field

[0001] The present disclosure relates to compositions, methods, systems, and kits for the specific detection, diagnosis, and differentiation of monkeypox virus from other orthopoxviruses involved in infectious diseases. Differential detection of specific viral agents allows for accurate diagnosis, allowing for timely provision of appropriate treatment and infection control measures. Background Art

[0002] Monkeypox is a viral infection currently circulating in parts of Central Africa, with two identified clades, epidemic clade I and epidemic clade II. A global outbreak of clade II was first reported in London in May 2022, and by September 2022, over 60,000 cases had been confirmed in over 100 countries, with the number continuing to climb.

[0003] According to the World Health Organization (WHO), monkeypox is a viral zoonosis caused by the monkeypox virus (a member of the genus Orthopoxvirus in the family Poxviridae) and is transmitted through close contact with lesions, body fluids, respiratory droplets, and / or contaminated material from infected humans or animals. Monkeypox virus is the DNA virus most closely related to smallpox virus. The virus is transmitted to humans through close contact with infected animals, infected humans, or contaminated inanimate objects.

[0004] According to the U.S. Centers for Disease Control and Prevention (CDC), monkeypox symptoms typically begin within about three weeks of exposure and last about two to four weeks. Symptoms can include a rash on or near the genitals or other areas of the body that may look like pimples or blisters and may be painful or itchy. Other symptoms may include fever, chills, swollen lymph nodes, prostration, muscle aches, headache, and / or respiratory symptoms.

[0005] In view of the current and ongoing emergence of monkeypox virus worldwide, there is an urgent need to develop methods for rapid detection and characterization of the virus so that appropriate infection control measures and treatments can be appropriately formulated in a timely manner. The incubation period of monkeypox virus is long, and symptoms may take 4 to 21 days to develop after exposure. During this period, infected people may unknowingly spread monkeypox to others. In addition, since various symptoms can cause rashes, it may be difficult to distinguish monkeypox based on clinical manifestations. Epidemiological factors are considered together with clinical manifestations and final tests to confirm the disease. Laboratory confirmation of infection is completed using surface skin lesion samples, using nucleic acid amplification tests, such as real-time or conventional polymerase chain reaction (PCR), which may then be analyzed by gene sequencing. However, because currently available monkeypox tests require analysis of fluid from the skin lesions, these tests are essentially confirmatory rather than diagnostic.

[0006] While tests exist for detecting monkeypox virus infection, they suffer from challenges in detecting infection early, distinguishing monkeypox virus infection from related non-smallpox orthopoxvirus infections, and challenges associated with false-positive and false-negative results. These challenges can contribute to the spread of infection, hinder accurate tracking of the disease, lead to unnecessary treatment deliveries or withholdings, and potentially prevent appropriate and timely treatment.

[0007] Antigen and antibody detection methods are less reliable for detecting MPXV infection due to serological cross-reactivity with orthopoxviruses.

[0008] Therefore, there is an urgent need to develop tests that can overcome some or all of the aforementioned challenges and help meet the global demand for robust and effective laboratory tools for timely diagnosis and delivery of treatments.

[0009] In accordance with the present disclosure, compositions, methods, and kits address and overcome at least some of the aforementioned problems in the art. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to describe the manner in which the above-described and other advantages and features of the present disclosure can be obtained, a more particular description of the disclosure briefly described above will be presented by reference to specific embodiments thereof as shown in the accompanying drawings. It should be understood that these drawings depict only typical embodiments of the disclosure and, therefore, should not be considered to limit the scope of the disclosure. The disclosure will be described and illustrated with additional specificity and detail through the use of the accompanying drawings, in which:

[0011] FIG1A illustrates an amplification plot of a representative example of a monkeypox virus sequence according to the present disclosure.

[0012] Figure 1B PCR efficiency is illustrated for the amplification plot shown in FIG1A for a representative example of a monkeypox virus sequence.

[0013] FIG2A illustrates an amplification plot of a representative example of an orthopoxvirus sequence according to the present disclosure.

[0014] Figure 2B PCR efficiency is illustrated for the amplification plots shown in Figure 2A for representative examples of orthopoxvirus sequences. DETAILED DESCRIPTION

[0015] All disclosures and patent applications cited herein are incorporated by reference in their entirety to the same extent for all purposes, and their reference extent is as if each separate disclosure or patent application is specifically and individually designated to be incorporated by reference in this manner. Although specific examples with reference to specific target nucleic acids, preparations and method steps are provided, it should be understood that these examples can be modified by using any preparation, component and / or method step described elsewhere herein, including by using any primer and / or probe described herein. Further, although the present invention has been described in detail by way of illustration and example for the purpose of clarity and understanding, it is apparent that certain changes and modifications may be implemented within the scope of the spirit and substance of the present disclosure and the appended claims.

[0016] Overview of compositions, systems, and kits for detecting viral sequences

[0017] Given the current and ongoing spread of monkeypox virus, there is an urgent need to develop compositions, kits, methods, and the like for the accurate and rapid detection and characterization of monkeypox virus. For example, in the case of monkeypox virus, proper tracking can be performed so that treatment and infection control measures can be appropriately and promptly instituted. Each case of monkeypox virus infection that is detected late, misidentified, or misdiagnosed further confounds epidemiological data and hinders the implementation of appropriate, informed solutions that could help control the spread of the virus.

[0018] In some embodiments, the present disclosure relates to compositions, kits, and methods for detecting monkeypox virus. When exemplary "embodiments" or specific "assays" are described herein, it should be understood that the features of these embodiments can be applied to compositions (e.g., specific physical components of the assay, such as primers and / or probes, or primer-probe sets), kits (e.g., primers and / or probes and additional buffers, reagents, etc.), or methods (e.g., processes for detecting target nucleic acids), as appropriate. For simplicity, many embodiments are presented by describing an "assay," but it should be understood that related methods using these assays are also intended to form part of this disclosure.

[0019] In " multiplex " amplification embodiment, can track the formation of a plurality of independent and different amplification products or amplicon in time by measuring the signal in one or more detection channels.Signal can be emitted by detectable label (optionally fluorescent label), and this detection label is connected to primer and / or the probe with amplification product or amplicon selective hybridization.In some embodiments, each channel is calibrated to preferentially or selectively detect corresponding amplification product or amplicon, and the signal in each channel is used as the measuring of the concentration of corresponding amplification product or amplicon. For example, in some embodiments, an amplification product or amplicon of monkeypox DNA is detected in a first detection channel based on a first signal emitted by a first label, the first label being linked to a first primer and / or a first probe that selectively hybridizes to the amplification product or amplicon of monkeypox DNA or associated with a first primer and / or a first probe that selectively hybridizes to the amplification product or amplicon of monkeypox DNA; and an amplification product of RNase P is detected in a second detection channel based on a second signal emitted by a second label, the second label being linked to a second primer and / or a second probe that selectively hybridizes to the amplification product of RNase P DNA or associated with a second primer and / or a second probe that selectively hybridizes to the amplification product of RNase P DNA. Optionally, in a "triplex" embodiment, an amplification product or amplicon of non-smallpox orthopox DNA is detected in a third channel based on a third signal emitted by a third label, the third label being linked to a third primer and / or a third probe that selectively hybridizes to the amplification product or amplicon of non-smallpox orthopox DNA.

[0020] In some embodiments, the amplified product or amplicon of the positive control or reference sequence is detected in a fourth channel based on a fourth signal emitted by a fourth label, which is connected to a fourth primer and / or a fourth probe that selectively hybridizes to the amplified product or amplicon of the positive control or reference sequence.

[0021] In some embodiments, background noise is detected in the fifth channel based on the signal from the negative control. In another embodiment, for example, the negative control is water.

[0022] In some embodiments, the multiplex assay according to some embodiments comprises a triple assay. In some embodiments, the triple assay comprises a set of three channels, each assay being in a different channel. In some embodiments, the triple assay comprises an assay for monkeypox (MPX) virus, non-smallpox orthopox (OPX) virus, and ribonuclease P (RNase P). In some embodiments, the triple assay comprises a forward primer, a reverse primer, and / or a probe for each of the MPX assay, the OPX assay, and the RNase P assay. In some embodiments, the primers and probes are selected from the target sequences shown in Tables 1, 2, and 3 below.

[0023] There are currently several monkeypox virus panels on the market for polymerase chain reaction (PCR)-based monkeypox testing. For example, Biosearch Technologies (Hoddesdon, UK) offers a monkeypox virus panel, a non-smallpox orthopox panel, and a human RNase P extraction control panel. However, the panels offered by Biosearch Technologies only include individual primers and probes and are not provided in the form of a reaction mixture as described in the context of this disclosure. One skilled in the art will appreciate the complexity of preparing a reaction mixture, taking into account the interactions of the various components. RayBiotech, Inc. (Peachtree Corners, GA) offers a monkeypox virus real-time PCR kit. However, the kit offered by RayBiotech does not include an orthopoxvirus assay. GT Molecular (Fort Collins, CO) offers an all-in-one multiplex PCR test kit for human monkeypox virus.

[0024] As mentioned above, monkeypox virus may not be detected with the same efficacy or specificity using conventional diagnostic assays. This lack of resolution proves problematic when attempting to track the spread and progression of monkeypox, and / or requires more expensive and lengthy sequencing tests to specifically identify monkeypox virus.

[0025] Exemplary Assays and Related Components

[0026] Embodiments disclosed herein include primers and optional probes that can be used to detect monkeypox virus in a sample (e.g., a biological sample or an environmental sample) and / or for distinguishing from non-smallpox orthopoxviruses. Such primers, oligonucleotides, and probes can be used in nucleic acid assays (single or multiplex) to detect and identify one or more nucleic acid targets in a sample. The single and multiplex assays described herein exhibit high levels of sensitivity, specificity, and accuracy. In some embodiments, assays are designed to detect and distinguish monkeypox virus from other non-smallpox orthopoxviruses. For example, an assay can be configured to detect the presence of monkeypox virus nucleic acid and nucleic acid of other non-smallpox orthopoxviruses in a biological sample.

[0027] In some embodiments, the assay includes differentially labeled probes, wherein at least one probe is configured to associate with or hybridize to an amplicon of a monkeypox sequence, and at least one different probe is configured to hybridize to or associate with an amplicon of a non-smallpox orthopox sequence. An additional labeled probe configured to hybridize to RNase P may also be included in the assay.

[0028] In some embodiments, determination is configured to detect the amplified product of specific target area by detecting the signal from mark (that is, detectable label) or other signal generation process, wherein the formation of the signal indication amplified product.In some embodiments, mark is connected to the corresponding forward primer and / or reverse primer for producing amplified product or otherwise associates with the corresponding forward primer and / or reverse primer.Additionally or alternatively, mark is directly or indirectly connected to probe, is coupled to probe or otherwise associates with probe, and the probe is hybridized with the probe binding sequence in the target area or associates with the probe binding sequence in the target area.In some embodiments, target area is the area shown in Table 1.In some embodiments, mark is an optically detectable label.Alternatively, mark can be non-optically detectable, such as electronic, electrical or detectable by using nuclear magnetic resonance (NMR) spectrum, sound, radioactivity etc.

[0029] In some exemplary methods for detecting monkeypox virus, the target DNA is first amplified by polymerase chain reaction (PCR). The reaction mixture includes a probe designed to target a monkeypox virus (MPX) sequence, a probe designed to target a non-smallpox orthopoxvirus (OPX) sequence, and a probe designed to target an RNase P sequence. Each probe type is also associated with a different dye channel to achieve differential detection. In an exemplary embodiment, the MPX probe includes a FAM dye label, the OPX probe includes a VIC dye label, and the RNase P probe includes a JUN dye label. The probe can be configured as a TaqMan probe known in the art and described in more detail below. When the probe is able to hybridize with the target downstream of the primer, the exonuclease activity of the polymerase during subsequent primer extension separates the dye label from the quencher to increase the dye signal.

[0030] Disclosed herein are primers and probes that hybridize to monkeypox virus, as well as primers and probes that hybridize to non-smallpox orthopoxviruses and RNase P, which can be used in assays that can beneficially detect monkeypox virus.

[0031] In some embodiments, the assay is a multiplex assay that includes at least a first primer and probe set. In some embodiments, the first primer and probe set includes monkeypox primers and probes. In some embodiments, the monkeypox primers and probes include one or more sets of those shown in Table 1. Table 1 lists exemplary MPX forward primers (corresponding to SEQ ID NO: 16-SEQ ID NO: 70) and MPX reverse primers (corresponding to SEQ ID NO: 71-SEQ ID NO: 125), as well as MPX probes (corresponding to SEQ ID NO: 126-SEQ ID NO: 180) that can be used with the corresponding MPX forward and reverse primers. For example, in some embodiments, an assay can include forward and reverse primers from a particular "Set" row of Table 1 and probes from the same "Set" row of the table. In other embodiments, the assay may include one or more MPX forward primers selected from SEQ ID NO: 16-SEQ ID NO: 70, one or more reverse primers selected from SEQ ID NO: 71-SEQ ID NO: 125, and one or more probes selected from SEQ ID NO: 126-SEQ ID NO: 180.

[0032] Table 1: MPX primers and probes

[0033]

[0034] In some embodiments, the multiplex assay further comprises a second primer and probe set. In some embodiments, the second primer and probe set comprises non-smallpox orthopoxvirus (OPX) primers and probes. In some embodiments, the OPX primers and probes are known OPX primers and probes. In some embodiments, the OPX primers and probes comprise the sequences shown in Table 2, which were designed by the Centers for Disease Control and Prevention (CDC) Poxvirus and Rabies Branch (PRB) (Test Procedure: Non-Variola Orthopoxvirus Universal Real-Time PCR Test, Revised Edition 2, published June 6, 2022).

[0035] Table 2: OPX primers and probes

[0036] Episode 1 SEQ ID NO: sequence Forward primer 4 GAGTCGGAGCCATCTGGTTTAATAT Reverse primer 5 CCACCTTTCACTCAACACCTTCTTA probe 6 AACCACCGATAAATCTAG Episode 2 SEQ ID NO: sequence Forward primer 7 AGTTCCATTAGCCTTTCCACTTCTG Reverse primer 8 CCAATGATCATCGGTGAGCCTATTA probe 9 CTGGTAAAGAACCAATTTCT Episode 3 SEQ ID NO: sequence Forward primer 10 TCAACTGAAAAGGCCATCTATGA Reverse primer 11 GAGTATAGAGCACTATTTCTAAATCCCA probe 12 CCATGCAATATACGTACAAGATAGTAGCCAAC

[0037] In some embodiments, the multiplex assay further comprises a third primer and probe set. In some embodiments, the third primer and probe set comprises an RNase P primer and probe. In some embodiments, the RNase P primer and probe comprise the sequences shown in Table 3.

[0038] Table 3: RNase P primers and probes

[0039] SEQ ID NO: sequence Forward primer 13 AGATTTGGACCTGCGAGCG Reverse primer 14 GAGCGGCTGTCTCCACAAGT probe 15 TTCTGACCTGAAGGCTCTGCGCG

[0040] In some embodiments, multiple assays, each corresponding to a different organism, can be combined to create an assay panel designed to specifically detect monkeypox virus.

[0041] In an embodiment, each probe includes a detectable label (eg, a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of the reporter molecule. Typically, the detectable label and the quencher molecule are part of a single probe.

[0042] In one embodiment, the OPX probe is labeled with VIC, the monkeypox probe is labeled with FAM, and the RNase P probe is labeled with JUN. However, these labels can be interchanged, or other suitable labels as known in the art and / or as described elsewhere herein can be used in addition or alternatively for the reference probe or mutant / variant probe, including but not limited to ABY, AlexaFluor dye labels (e.g., AF647 and AF676), and the dyes discussed below.

[0043] In some embodiments, the multiplex assay further comprises a positive control. In one embodiment, the positive control comprises a template specific for the monkeypox virus, a non-smallpox orthopoxvirus target, and the human RNase P region targeted by the assay. In some embodiments, the positive control comprises the sequence shown in Table 4.

[0044] Table 4: Positive Control

[0045]

[0046] Sample collection

[0047] The disclosed compositions, kits and methods are configured to detect viral nucleic acids from samples. According to the present disclosure, the disclosed compositions, kits and methods are particularly configured for detecting monkeypox virus from a sample, the sample including material extracted from lesion material, in which DNA from the virus may be present. Thus, samples can be extracted from acceptable sample types, including but not limited to lesion fluid on a dry swab, lesion fluid swab in a viral transport medium, lesion fluid on a slide, lesion scab or lesion top. In some embodiments, the sample is a human sample. In some embodiments, the sample is a non-human sample. For example, the sample can be from a non-human species, such as a rodent (e.g., prairie dog, squirrel, chinchilla), a carnivore (e.g., dog, cat), an insectivore (e.g., hedgehog, hamster), a non-human primate (e.g., monkey, ape), etc. In most cases, monkeypox virus is detected by analyzing a swab or a liquid obtained from a swab (e.g., a lesion swab). In some alternative embodiments, it will be appreciated that monkeypox virus can also be detected by analyzing other swabs (e.g., throat swabs, nasal swabs, nasopharyngeal swabs, cheek swabs, saliva swabs, or other swabs), or urine samples, saliva samples, or other clinical samples. Such other samples can be collected using a collection device such as a tube, dish, bag, plate, or any other suitable container.

[0048] In a healthcare setting, samples can be collected by healthcare professionals, but in some cases, samples are collected by the patient themselves or by an individual who assists the patient in self-collection. For example, lesion swabs have been used as the standard for obtaining patient samples for clinical diagnosis of latent poxviruses. Such swabs are typically used in a healthcare setting by healthcare professionals. Other samples can similarly be obtained in a healthcare setting with the assistance or supervision of a healthcare professional. However, in some cases, self-collection of samples may be more efficient and can be performed outside of a healthcare setting.

[0049] In some embodiments, the sample is an original lesion sample collected by contacting a sterile swab with a patient's lesion - whether by self-collection or assisted / supervised collection. The lesion sample can be extracted from the swab into a viral transport medium (VTM) or universal transport medium (UTM), or tested directly from the swab. In some embodiments, the tip of the swab containing the lesion sample can be placed in a sealable container containing the VTM or UTM to extract a sufficient portion of the lesion sample from the swab before removing the swab and closing / sealing the container. In other embodiments, the swab containing the lesion sample can be collected directly into a sealable container before receiving the lesion sample in the container or as a result of closing / sealing the container, without any preservative solution or other fluid or substance in the container. The swab storage tube / device or the extracted sample collection tube / device can be a component of a self-collection kit with instructions for use (such as sample collection instructions, sample preparation or storage instructions and / or transportation instructions).

[0050] In other embodiments, the sample is collected in a sterile tube or specially designed collection device - whether by self-collection or assisted / supervised collection. The collection tube / device can be part of a self-collection kit with instructions for use (e.g., sample collection instructions, sample preparation or storage instructions, and / or shipping instructions). The sample can be collected directly into a sealable container without any preservative solution or other fluid or substance in the container, either prior to receiving the sample in the container or due to closing / sealing the container.

[0051] In some embodiments, the sample is pretreated before use. This can include, for example, heating the sample, such as by placing the original sample on a heating block / water bath set to a temperature of 95° C. for 30 minutes, and then combining the heat-treated sample with a buffer or lysis solution. The buffer or lysis solution can include, for example, any buffer suitable for nucleic acids, such as triboric acid-ethylenediaminetetraacetic acid (TBE), and can further include a detergent and / or an emulsifier, such as a polysorbate-type nonionic surfactant, Tween-20.

[0052] In some embodiments, the nucleic acid fraction of the sample (for example, obtained by swab) can be extracted and used for downstream analysis, such as qPCR. In some embodiments, the sample is the original lesion sample. As provided above, the original lesion sample can be collected by itself (for example, in a sterile swab collection device) or collected from the patient by any other individual near the subject. In some embodiments, before receiving the lesion sample or due to a closed / sealed container, the swab of the original lesion sample is directly collected into a sealable container, without any preservation solution or other fluid or substance in the container. The disclosed embodiment for detecting viral nucleic acid from the sample can be suitable for detecting viral nucleic acid directly from the lesion sample, or in an alternative embodiment, the sample can be subjected to specific DNA purification and / or extraction steps before it is used for detection determination (for example, qPCR). Therefore, it should be understood that in some embodiments, patient samples (for example, lesion swabs) can be directly used as sample input for subsequent downstream analysis, such as PCR, and in some embodiments, this can be completed before its use without nucleic acid purification and / or extraction steps. In some embodiments, the sample for subsequent downstream analysis is a heat-treated lesion sample as described herein.

[0053] In some embodiments, viral nucleic acids can be detected directly from the original sample or crude sample. For example, the original lesion sample can be collected from the patient and heat treated, such as by placing the original lesion sample on a heating block / water bath set to a temperature of about 95°C for 30 minutes. The heating step can provide many benefits, including, for example, denaturing nucleases (e.g., RNases) in the lesion sample, which may interfere with the accurate assessment of the presence of the virus. Heating the original sample can also make the sample easier to operate using laboratory equipment such as pipettes. High heat can also cause thermal destruction of any prokaryotic and eukaryotic cells present in the lesion sample, and can also destroy enveloped viruses and / or viral capsids present in the lesion sample, thereby increasing the accessibility to any viral nucleic acids.

[0054] Heat treated sample can also be mixed (for example, via sample vortex is continued for at least 10 seconds) before and / or after heat treated sample is balanced to room temperature. Lysis solution can then be prepared and combined with heat treated sample (for example, with a ratio of 1: 1) to produce a confirmatory template solution, for the presence of viral nucleic acid in the sample via nucleic acid amplification reaction (for example, PCR, qPCR etc.). Lysis solution can include a buffer solution suitable for nucleic acid combined with detergent and / or emulsifier such as Tween-20, polysorbate type nonionic surfactant (and / or suitable substitute known in the art), such as TBE (and / or suitable substitute known in the art). Detergent and / or emulsifier can promote reagent to mix better and can also be used to increase the accessibility (for example, by removing lipid envelope from virion) to any viral nucleic acid in the sample.

[0055] It should be understood that in some embodiments, the disclosed compositions can include a sample mixed with a buffer and a detergent / emulsifier. The sample can be added to the buffer / detergent mixture, or vice versa. In some embodiments, the sample is combined with the buffer and then the detergent is added to the sample / buffer mixture. In other embodiments, the sample is directly combined with the buffer / detergent mixture.

[0056] As non-limiting example, by adding the heat-treated sample of a certain volume of each patient in one (or more) hole in a multiwell plate, a group of patient samples can be prepared into a composition for downstream analysis and detection of viral sequences. Then a certain volume of buffer / detergent mixture (such as TBE+ Tween-20) can be added into each hole containing patient samples. Alternatively, a multiwell plate can be loaded with a certain volume of buffer / detergent mixture, wherein a certain volume of heat-treated sample is added. Once combined, this confirmatory template solution can be used immediately or stored for later analysis. This type of confirmatory template solution can also be combined with PCR reagents (such as, buffer, deoxynucleoside triphosphates (dNTP), master mix, etc.) before or after storage.

[0057] In some embodiments, sample is obtained from a variety of organisms (for example, a plurality of individuals or patients), and a plurality of samples are brought together to prepare a single sample for testing. In some embodiments, sample can be obtained from at least two different organisms or individuals, for bringing together to form a single sample for testing. In some embodiments, sample can be obtained from 2 to 10 different organisms or individuals, for bringing together to form a single sample for testing. In some embodiments, sample can be obtained from 2, 3, 4, 5, 6, 7, 8, 9 or 10 different organisms or individuals, for bringing together to form a single sample for testing. In some embodiments, sample can be obtained from up to and including six different organisms or individuals, for bringing together to form a single sample for testing. For example, according to the methods and compositions described herein, the sample for testing can include a plurality of samples obtained from different organisms or individuals (for example, 2, 3, 4, 5 or 6 different individuals), these samples are combined to form a single "convergence" sample for subsequently detecting pathogens (such as monkeypox virus).

[0058] Nucleic acid amplification and detection

[0059] Amplified products or amplification products ("amplicons") produced using one or more embodiments described herein can be produced, detected, and / or analyzed using any suitable method and on any suitable platform. In some embodiments, monkeypox virus or other target organisms are detected by analyzing a swab or a fluid obtained from a swab, such as lesion fluid on a dry swab, lesion fluid swab in a viral transport medium, lesion fluid on a slide, lesion scab, or lesion dome. Monkeypox virus or other target organisms can additionally or alternatively be detected by analyzing a saliva sample, a buccal sample, a nasal sample, a nasopharyngeal sample, a blood sample, a urine sample, a semen sample, or other biological sample.

[0060] In some embodiments, nucleic acid assays as described herein can be used to detect, identify, characterize, quantify or otherwise measure one or more nucleic acid targets in a sample. In some embodiments, the nucleic acid target can be single-stranded, double-stranded or any other nucleic acid molecule of any size or conformation. Optionally, nucleic acid assays as described herein may include polymerase chain reaction (PCR) assays (see, e.g., U.S. Patent No. 4,683,202), loop-mediated isothermal amplification ("LAMP") (see, e.g., U.S. Patent No. 6,410,278) and other methods, including methods discussed below for detecting nucleic acid targets in a sample. In some embodiments, PCR assays may be real-time PCR or quantitative (qPCR) assays. In some other embodiments, PCR assays may be endpoint PCR assays. Nucleic acid markers can be detected by any suitable means, including means comprising nucleic acid amplification (e.g., thermal cycling amplification methods including PCR, and other nucleic acid amplification methods; isothermal amplification methods (including LAMP, etc.) and any other methods that can be used to detect the presence of nucleic acid markers of pathogenic organisms in an indicator sample.

[0061] In some embodiments, the primers described herein are used in nucleic acid assays at a concentration ranging from about 100 nM to 1 nM (e.g., 300 nM, 400 nM, 500 nM, etc.), including all concentration amounts and ranges therebetween. In some embodiments, the probes described herein are used in nucleic acid assays at a concentration ranging from about 50 nM to 500 nM (e.g., 75 nM, 125 nM, 250 nM, etc.), including all concentration amounts and ranges therebetween.

[0062] Primers and / or probes described herein may also include fluorescent or other detectable labels. In some embodiments, primers and / or probes may also include a quencher, and in other embodiments, the probe may also include a minor groove binder (MGB) portion. Suitable fluorescent labels may include, but are not limited to, 6FAM, ABY, VIC, JUN, FAM. Suitable quenchers may include, but are not limited to, MGB, QSY (e.g., QSY7 and QSY21), BHQ (black hole quencher), and DFQ (dark fluorescence quencher).

[0063] In some embodiments, control sequence primers and / or probes (e.g., VIC-labeled probes), such as for amplification and / or detection of non-variola orthopoxvirus control sequences, are included in multiplex assays (and may also be included as singleplex assays) using the primer / probe sequences disclosed herein.

[0064] In some embodiments, control sequence primers and / or probes (e.g., JUN-labeled probes) such as for amplification and / or detection of bacteriophage MS2 or human RNase P control sequences are included in multiplex assays (and may also be included as singleplex assays) using the primer / probe sequences disclosed herein.

[0065] In some embodiments, the assays in array format can be run as single assays or as multiplex assays. In some embodiments, a set of different assays can be formatted onto an array or multiwell plate. In some embodiments, the set can include one or more assays containing at least one primer set and probe of Table 1 present in at least one well of the array or well of a multiwell plate. In some embodiments, the set includes assays for non-variola orthopoxviruses and RNase P. In some embodiments, the disclosed methods include using the set to summarize the microorganisms present in a sample taken from an organism (e.g., a human), and determining the profile of the microbial population present in the organism sample. Optionally, the disclosed methods can include diagnosing an infection present in the organism (e.g., a human) from which the sample was obtained.

[0066] In some embodiments, the set of qPCR assays can be used simultaneously to test a single patient sample or a single pooled sample comprising multiple patient samples, with each assay run in parallel in an array format ("array formatting"). Optionally, different qPCR assays specific for each of the following target assays can be layered in individual wells of a single array or multi-well plate, such as a TaqMan Array Card (see, e.g., Thermo Fisher Scientific, Waltham, MA; catalog numbers 4346800 and 4342265) or a MicroAmp multi-well (e.g., 96-well, 384-well) reaction plate (see, e.g., Thermo Fisher Scientific, Waltham, MA; catalog numbers 4346906, 4366932, 4306737, 4326659, and N8010560). Optionally, the different qPCR assays present in different wells of an array or plate can be dried or freeze-dried in situ, and the array or plate can be stored or shipped before use.

[0067] In some embodiments, the panel of qPCR assays includes at least one qPCR assay for detecting monkeypox virus. In some other embodiments, the panel of qPCR assays includes at least one qPCR assay for detecting monkeypox virus in addition to at least one qPCR assay for detecting a non-smallpox orthopoxvirus. Each qPCR assay can include a forward primer and a reverse primer for each target, as well as a probe.

[0068] In some embodiments, the multiplex assay includes at least a forward primer and a reverse primer that hybridize to a target gene sequence within the monkeypox genome, a forward primer and a reverse primer that hybridize to a target gene sequence within the non-smallpox orthopox genome, and a forward primer and a reverse primer that hybridize to a gene encoding an RNA subunit of RNase P.

[0069] In some other embodiments, the primers and / or probes provided in FIG. 1 can be used to amplify one or more specific target sequences present in monkeypox virus.

[0070] Primer and probe sequences as herein described do not need to have 100% homology / identity with their target just effective, but in some embodiments, homology is 100% or just 100% basically.In some embodiments, one or more primers and / or probe sequences in disclosed primer and / or probe sequence have at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9% or up to 100% homology basically or just 100%.Some combinations of primer and / or probe can comprise such primer and / or probe, and each such primer and / or probe has different homologies with their corresponding target, and homology can be in the scope of the endpoint defined by any two aforementioned values for example.

[0071] PCR and related methods are common methods for nucleic acid amplification. PCR is one, but not the only, example of a nucleic acid polymerase reaction method for amplifying nucleic acid test samples, comprising using known nucleic acids as primers and nucleic acid polymerases to amplify or produce specific target nucleic acids. Typically, PCR utilizes a primer pair consisting of a forward primer and a reverse primer, which are configured to amplify the target segment of a nucleic acid template. Typically, but not always, the forward primer hybridizes with the 5' end of the target sequence, and the reverse primer is identical to the sequence present at the 3' end of the target sequence. The reverse primer will typically hybridize with the complementary sequence of the target sequence, such as an extension product of the forward primer and / or vice versa. The PCR method is typically carried out at multiple different temperatures, resulting in repeated temperature changes ("thermal cycling") during the PCR reaction. Other amplification methods, such as those listed in Table 5, may require less or less extensive thermal cycling than PCR, or may not require thermal cycling. This type of isothermal amplification method is also contemplated for use in assay compositions, test kits, and methods as described herein.

[0072] Table 5: Alternative DNA amplification methods

[0073]

[0074] Methods for performing PCR are well known in the art; however, further discussion of PCR and other methods can be found, for example, in "Molecular Cloning: A Laboratory Manual by Green and Sambrook," Cold Spring Harbor Laboratory Press, 4th edition 2012, which is incorporated herein by reference in its entirety.

[0075] In some embodiments, different assay products (e.g., amplicons from different viruses) can be independently detected or at least distinguished from each other. For example, different assay products can be distinguished optically (e.g., using optically different markers for each qPCR assay), or some other suitable method can be used to distinguish them, including methods described in U.S. Patent Publication No. 2019 / 0002963 (which is incorporated herein by reference in its entirety). In some embodiments, a specific combination of markers is used to distinguish monkeypox virus from a positive control. For example, different markers can be used to distinguish monkeypox virus from general non-smallpox orthopoxviruses, such that the markers are detectable only in the presence and amplification of the relevant sequence.

[0076] In some embodiments, the amplification step may include performing qPCR, as defined herein. qPCR is a sensitive and specific method for detecting and optionally quantifying the amount of a starting nucleic acid template (e.g., monkeypox virus nucleic acid) in a sample. qPCR methods are well known in the art; a primary method involves using a specific hydrolysis probe that is combined with a primer pair. The hydrolysis probe may include an optical label (e.g., a fluorophore) at one end and a quencher that quenches the optical label at the other end. In some embodiments, the label is located at the 5' end of the probe, and when the nucleic acid polymerase extends the forward primer toward the probe binding site in the target sequence, cleavage of the 5' label occurs via 5' hydrolysis of the probe. The probe label is separated from the probe quencher by the cutting (or unfolding) of the probe, resulting in an enhancement of the optical signal, which can be detected and optionally quantified. The optical signal can be monitored over time and analyzed to determine the relative or absolute amount of the starting nucleic acid template present in the sample. Suitable labels are described herein.

[0077] The reaction vessel or volume may optionally include a tube, channel, hole, cavity, site or feature on the surface, or alternatively may be deposited onto the surface or deposited into a surface hole or cavity or suspended in a fluid flow (or partially restricted by the fluid flow) droplets (e.g., microdroplets or nanodroplets). In some embodiments, the reaction volume includes one or more droplets arranged on the surface or present in an emulsion. The reaction volume may optionally be formed by fusing multiple pre-reaction volumes containing different components of the amplification reaction. For example, a pre-reaction volume containing one or more primers may be fused with a pre-reaction volume containing a human nucleic acid sample and / or a polymerase, nucleotides, and a buffer. In some embodiments involving performing qPCR reactions in an array format, the surface comprises multiple grooves, channels, holes, cavities, sites or features that define a reaction volume containing one or more amplification reagents (e.g., primers, probes, buffers, polymerases, nucleotides, etc.). In some single-plex embodiments of the array format, the reaction volume within the selected tube, groove, channel, hole, cavity, site or feature contains only a single forward primer sequence and a single reverse primer sequence. Optionally, one or more probe sequences are also included in the single-plex reaction volume.

[0078] In some multiplexed embodiments of array formats, a reaction volume within a selected tube, recess, channel, well, cavity, site, or feature comprises a plurality (e.g., 2, 3, 4, 5, 6, etc.) of forward and reverse primer sequences and / or a plurality of probe sequences. For example, an exemplary method for polymerizing and / or amplifying and detecting nucleic acids suitable for use as described herein is commercially available as a TaqMan assay (see, e.g., U.S. Patent Nos. 4,889,818; 5,079,352; 5,210,015; 5,436,134; 5,487,972; 5,658,751; 5,210,015; 5,487,972; 5,538,848; 5,618,711; 5,677,152; 5,723,591; 5,773 ,258; 5,789,224; 5,801,155; 5,804,375; 5,876,930; 5,994,056; 6,030,787; 6,084,102; 6,127,155; 6,171,785; 6,214,979; 6,258,569; 6,814,934; 6,821,727; 7,141,377; and / or 7,445,900, all of which are hereby incorporated by reference in their entirety).

[0079] In some embodiments (e.g., in the well-known and widely used TaqMan TMIn a series of qPCR assays), detecting the amplified product includes detecting a signal emitted by a fluorescent label connected to the 5' end of a cleavable probe, which selectively hybridizes to the amplified product during amplification. The cleavable probe further includes a quencher that quenches the fluorescent label to a "baseline" fluorescence level. The 5' end of the cleavable probe is cleaved by a polymerase during the extension step, resulting in separation of the fluorescent label and the quencher, and a corresponding increase in fluorescence relative to the baseline. The TaqMan assay is typically performed by carrying out nucleic acid amplification of the target polynucleotide using a nucleic acid polymerase with 5' to 3' nuclease activity, a primer capable of hybridizing with the target polynucleotide, and an oligonucleotide probe capable of hybridizing 3' with the target polynucleotide relative to the primer. Therefore, the oligonucleotide probe includes a detectable label (e.g., a fluorescent reporter molecule) and a quencher molecule capable of quenching the fluorescence of the reporter molecule. Typically, the detectable label and the quencher molecule are part of a single probe. As amplification proceeds, the polymerase digests the probe to separate the detectable label from the quencher molecule, and a continuous increase in fluorescence relative to the baseline is measured in each cycle. The detectable label is monitored during the reaction, where detection of the label corresponds to the occurrence of nucleic acid amplification (eg, the higher the signal, the greater the amount of amplification). Variations of the TaqMa assay are known in the art and will be suitable for use in the methods described herein.

[0080] In some embodiments, a passive reference dye, such as ROX TM . Metrics "R n " is optionally used to follow the progress of an amplification reaction and to determine the amount of target sequence initially present in the reaction mixture before amplification. n It can be calculated as the fluorescence of the reporter dye divided by the fluorescence of the passive reference dye present in the reaction mixture; that is, R n is the reporter signal normalized to the fluorescent signal of the passive reference dye. n Plotted against the number of PCR cycles. In some embodiments, AR n (Calculated as R n In some embodiments, the amplification plot shows log(AR n ) changes with the number of PCR cycles. t (Threshold cycle) is the point of intersection between the amplification curve and the threshold line. t The lower the value, the earlier amplification can be detected and the higher the absolute amount and relative concentration of the corresponding target sequence initially present in the reaction mixture. t A cutoff value of is used to determine whether the target sequence is initially present in the reaction mixture prior to amplification. For example, in some embodiments, if C t If the value is less than or equal to 37, the target sequence is determined to be present.

[0081] In various embodiments, single or multiple qPCR can include a single TaqMan assay associated with a locus-specific sequence, or a plurality of TaqMan assays associated with a plurality of target sequences in a multiplex format, or a plurality of TaqMan assays associated with a plurality of loci in a multiplex format. As a non-limiting example, a triple reaction can include FAM (emission peak 517nm), VIC (emission peak 551nm) and JUN (emission peak 617nm) dyes. As a non-limiting example, a 4-fold reaction can include FAM (emission peak 517nm), VIC (emission peak 551nm), ABY (emission peak 580nm) and JUN (emission peak 617nm) dyes. In some embodiments, each dye is associated with one or more target sequences. In some embodiments, one or more dyes are quenched by MGB or QSY quenchers (e.g., QSY7 or QSY21). In some embodiments, each multiplex reaction allows real-time amplification and tracking of up to 12 targets in a single reaction vessel. In some embodiments, using any combination of detectable labels disclosed herein or known to those skilled in the art, up to 2, 4, 6, 8, 10 or 12 targets are amplified and tracked in real time in a single reaction vessel. These reporter dyes are optimized to work together with minimal spectral overlap, so as to improve performance. Any combination of dyes described herein can be combined with other dyes (e.g., Mustang Purple (emission peak -654nm) or one or more Alexa Fluors (e.g., AF647 and AF676)) for monitoring the fluorescence of the control or for non-emission spectral overlap 5-fold determination. In addition, QSY quencher is fully compatible with probes with minor groove binder (MGB) quencher.

[0082] When multiple detection channels are utilized, it is desirable to minimize crosstalk between fluorescent reporters and to select reporters that avoid excessive spectral overlap. An example of an assay comprising 5 detection channels incorporates the dyes FAM, ABY, VIC, and JUN, and, for example, Mustang Purple (emission peak 654 nm) or an appropriate Alexa Fluor. The dye can be combined with corresponding primers and / or with the probe of the assay, as described herein. Other embodiments may utilize other combinations of dyes to define different groups of detection channels (including in assays with more than 5 detection channels) according to specific preferences or application needs. Other examples of multiplex assays (including related dye compounds, compositions, methods, and kits) are described in International Publication No. WO 2022 / 020731 A2, entitled “Compositions, Systems and Methods for Biological Analysis InvolvingEnergy Transfer Dye Conjugates and Analytes Comprising the Same,” published on January 27, 2022, which is incorporated herein by reference in its entirety.

[0083] The detector probe can be associated with an alternative quencher, including but not limited to dark fluorescence quencher (DFQ), black hole quencher (BHQ), Iowa Black, QSY quencher, and Dabsyl and Dabcel sulfonate / carboxylate quenchers. The detector probe can also include two probes, wherein, for example, a fluorophore is associated with one probe, and a quencher is associated with a complementary probe, such that hybridization of the two probes on the target quenches the fluorescent signal, or hybridization on the target changes the signal characteristics by changes in fluorescence. The detector probe can also include sulfonate derivatives of fluorescein dyes that replace the carboxylate group with SO3, phosphoramidite forms of fluorescein, phosphoramidite forms of Cy5.

[0084] It will be understood that when more than one detectable label is used, particularly when used in a multiplex format, each detectable label is preferably different in its spectral properties from the other detectable labels used therewith, such that the labels can be distinguished from each other, or such that the detectable labels together emit a signal that is not emitted by any of the detectable labels alone. Exemplary detectable labels include, for example, fluorescent dyes or fluorophores (e.g., chemical groups that can be excited by light to emit fluorescence or phosphorescence), "acceptor dyes" that can quench the fluorescent signal from a fluorescent donor dye, and the like, as described above. Suitable detectable labels may include, for example, fluorescein (e.g., 5-carboxy-2,7-dichlorofluorescein; 5-carboxyfluorescein (5-FAM); 5-hydroxytryptamine (5-HAT); 6-JOE; 6-carboxyfluorescein (6-FAM); Mustang Purple, VIC, ABB, JUN; FITC; 6-carboxy-4',5'-dichloro-2',7'-dimethoxy-fluorescein (JOE)); 6-carboxy-1,4-dichloro-2',7'-dichloro-fluorescein (TET); 6-carboxy-1,4-dichloro-2',4',5',7'-tetra-chlorofluorescein (HEX); Alexa Fluor Fluor fluorophores (e.g., 350, 405, 430, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 635, 647, 660, 680, 700, 750); BODIPY fluorophores (e.g., 492 / 515, 493 / 503, 500 / 510, 505 / 515, 530 / 550, 542 / 563, 558 / 568, 564 / 570, 576 / 589, 581 / 591, 630 / 650-X, 650 / 665-X, 665 / 676, FL, FL ATP, Fl-ceramide, R6GSE, TMR, TMR-X conjugate, TMR-X, SE, TR, TR ATP, TR-X SE), Cascade Blue, Cascade Yellow; Cy TMdyes (e.g., 3, 3.18, 3.5, 5, 5.18, 5.5, 7), cyan GFP, cyclic AMP fluorosensor (FiCRhR), fluorescent proteins (e.g., green fluorescent proteins (e.g., GFP, EGFP), blue fluorescent proteins (e.g., BFP, EBFP, EBFP2, Azurite, mKalamal), cyan fluorescent proteins (e.g., ECFP, Light Blue, CyPet), yellow fluorescent proteins (e.g., YFP, Citrine, Venus, YPet), FRET donor / acceptor pairs (e.g., fluorescein / fluorescein, fluorescein / tetramethylrhodamine, lAEDANS / fluorescein, EDANS / dabcyl, BODIPY FL / BODIPY FL, fluorescein / QSY7, and QSY9), LysoTracker and LysoSensor (e.g., LysoTracker Blue DND-22, LysoTracker Blue-White DPX, LysoTracker Yellow HCK-123, LysoTracker Green DND-26, LysoTracker Red DND-99, LysoSensor Blue DND-167, LysoSensor Green DND-189, LysoSensor Green DND-153, LysoSensor Yellow / Blue DND-160, LysoSensor Yellow / Blue 10,000 MW dextran), Oregon Green (e.g., 488, 488-X, 500, 514); Rhodamine (e.g., 110, 123, B, B 200, BB, BG, B extra, 5-carboxytetramethylrhodamine (5-TAMRA), 5GLD, 6-carboxyrhodamine 6G, Lissamine, Lissamine Rhodamine B, Phallicidine, Phalloidine, Red, Rhod-2, ROX (6-carboxy-X-rhodamine), 5-ROX (carboxy-X-rhodamine), Sulforhodamine B can C, Sulforhodamine G Extra, TAMRA (6-carboxytetramethylrhodamine), Tetramethylrhodamine (TRITC), WT), Texas Red, Texas Red-X, and others known to those skilled in the art.

[0085] In addition to or as an alternative to the labeled probe, other detectable labels can be used. For example, primers can be labeled and used to generate an amplicon and detect the presence (or concentration) of the amplicon produced in the reaction, and such primers can be used as a supplement or alternative to the labeled probe described herein. As another example, primers can be labeled and utilized as described in Nazarenko et al. (Nucleic Acids Res. May 1, 2002; 30(9): e37), Hayashi et al. (Nucleic Acids Res. May 11, 1989; 17(9): 3605) and / or Neilan et al. (Nucleic Acids Res. Vol. 25, No. 14, July 1, 1997, pp. 2938-2939). Those skilled in the art will also understand and be able to utilize the PCR process (and related probe and primer design techniques) described by Zhu et al. (Biotechniques. 2020 Jul: 10.2144 / btn-2020-0057).

[0086] Any of these systems and detectable labels and many other systems and detectable labels can be used to detect the target nucleic acid of amplification. In some embodiments, insertion labels, such as ethidium bromide, SYBR green I, SYBR green ER and PicoGreen (Life Technologies Corp., Carlsbad, CA), are used to allow real-time visualization or visualization of the end point of the amplified product in the absence of a detector probe. In some embodiments, real-time visualization can include insertion of a detector probe and a detector probe based on sequence. In some embodiments, the detector probe is at least partially quenched when not hybridized to a complementary sequence in an amplified reaction, and is at least partially unquenched when hybridized to a complementary sequence in an amplified reaction. In some embodiments, the probe can further include various modifications, such as a minor groove binder, to further provide desired thermodynamic characteristics.

[0087] In some embodiments, the amplicon is labeled by hybridizing with a labeled primer or with a labeled primer. In some embodiments, the amplicon is labeled by hybridizing with a labeled probe. In some embodiments, the amplicon is labeled by combining a DNA binding dye. In some embodiments, the dye can be a single-stranded DNA binding dye. In other embodiments, the dye can be a double-stranded DNA binding dye. In other embodiments, the amplicon is labeled by polymerization or incorporation of labeled nucleotides in a template-dependent (or template-independent) polymerization reaction. This can be a part of an amplification step, or alternatively, labeled nucleotides can be added after amplification is complete. The labeled amplicon (or its labeled derivative) can be detected using any suitable method such as electrophoresis, hybridization-based detection (e.g., microarray, molecular beacons, etc.), chromatography, NMR, etc.

[0088] In an exemplary embodiment, capillary electrophoresis is used to detect the amplicon of labeling. In another embodiment, qPCR is used to detect the amplicon of labeling. In some embodiments, multiple different amplicons are formed via a single amplified reaction in a single reaction volume, and optionally labeled. For example, the multiplex reaction (for example, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold) carried out in a single pipe or reaction vessel (for example, " single pipe " or " 1 pipe " or " single container " reaction) can produce multiple labeled amplicons. In some embodiments, multiple amplicons can be differentially labeled. In some embodiments, each amplicon in a plurality of amplicons produced during amplification is labeled with different labels.

[0089] Optionally, in some embodiments, the kit includes an RNase P assay. Exemplary primers and probes for the RNase P assay can include the following sequences: a forward primer comprising SEQ ID NO: 13, a reverse primer comprising SEQ ID NO: 14, and a probe comprising SEQ ID NO: 15, but one skilled in the art will appreciate that other RNase P-specific primers and / or probes can be used.

[0090] In some embodiments, nucleic acid amplification assays as described herein are performed using a real-time PCR (qPCR) instrument, including, for example, a QuantStudio Real-Time PCR System, such as the QuantStudio 5 Real-Time PCR System (QS5), the QuantStudio 5DX Real-Time PCR System (QS5DX), or the QuantStudio 7Flex Real-Time PCR System (QS7Flex) from Thermo Fisher Scientific.

[0091] In some embodiments, the system, composition, method and device for nucleic acid amplification include a "point of service" (POS) system. In some embodiments, samples can be collected and / or analyzed at a "point of care" (POC) position. In some embodiments, the analysis at the POC position does not require specialized equipment usually and has a quick and easy-to-read visual result. In some embodiments, analysis can be performed on-site, in a home environment and / or by a layman who does not have professional skills. In certain embodiments, for example, the analysis of small-volume clinical samples can be completed using a POS system in a short period of time (e.g., in a few hours or minutes).

[0092] Optionally, a POS system is utilized at a certain location that can provide services (e.g., testing, monitoring, treatment, diagnosis, guidance, sample collection, identity verification (ID verification) and other services) at or near the site or location of the subject. The service can be a medical service or it can be a non-medical service. In some cases, the POS system provides services at a predetermined location (e.g., the subject's home, school, or workplace), or at a grocery store, pharmacy, community center, clinic, doctor's office, hospital, outdoor triage tent, temporary hospital, border checkpoint, etc. The POS system may include one or more point of service devices, such as a portable virus / pathogen detector. In some embodiments, the POS system is a point of care system. In some embodiments, the POS system is applicable to non-professional staff or personnel, such as nurses, police, civilian volunteers, or patients.

[0093] In certain embodiments, a POC system is utilized at a location where medical-related care (e.g., treatment, testing, monitoring, diagnosis, consultation, etc.) is provided. The POC can be, for example, at a subject's home, workplace, or school, or at a grocery store, community center, pharmacy, doctor's office, clinic, hospital, outdoor triage tent, temporary hospital, border checkpoint, etc. A POC system is a system that can assist or be used to provide such medical-related care and can be located at or near a site or location (e.g., a subject's home, workplace, or school, or at a grocery store, community center, pharmacy, doctor's office, clinic, hospital, etc.) of a subject or a subject's health care provider.

[0094] In embodiments, the POS system is configured to receive clinical samples obtained from a subject at a relevant POS position. In embodiments, the POS system is further configured to analyze clinical samples at the POS position. In embodiments, the clinical sample is a small volume clinical sample. In embodiments, the clinical sample is analyzed within a short period of time. In embodiments, a short period of time is determined relative to the time when the sample analysis begins. In embodiments, a short period of time is determined relative to the time when the sample is inserted into the device for analysis of the sample. In embodiments, a short period of time is determined relative to the time when the sample is obtained from the subject.

[0095] In some embodiments, POS systems or POC systems may include methods, compositions, and kits disclosed herein based on amplification, including any of the assays and / or assay groups. Such assays are envisioned for thermal cycling amplification workflows and protocols (e.g., in PCR) and isothermal amplification workflows and protocols (e.g., in LAMP).

[0096] In some embodiments, POS or POC systems include the voluntary collection of biological samples, such as lesion fluid on a dry swab, lesion fluid swabs in a viral transport medium, lesion fluid on a slide, lesion scabs or lesion tops. In some embodiments, voluntary collection can include the use of a voluntary collection kit and / or device, such as a swab or tube. In some embodiments, the voluntary collection kit includes instructions for use, including collection instructions, sample preparation or storage instructions and / or transportation instructions. For example, voluntary collection kit and / or device can be used by individuals (such as non-professionals) who do not have professional skills or medical expertise. In some embodiments, voluntary collection can be performed by the patient himself or by any other individual near the patient (such as, but not limited to, parents, caregivers, teachers, friends or other family members).

[0097] It is noteworthy that, in some embodiments, the nucleic acid amplification protocol can be configured for rapid processing (e.g., in less than about 45 minutes) and high throughput, thereby allowing minimally invasive methods to rapidly screen a large number of individuals in a scalable manner. This may be particularly useful for performing asymptomatic testing (e.g., high-frequency / widespread testing at schools, workplaces, conferences, sporting events, large social gatherings, etc.) or for epidemiological purposes. The disclosed embodiments can also beneficially provide a lower-cost sample collection system and method that can be collected by oneself using a low-cost collection device (reducing the need for healthcare professionals to staff). This eliminates the requirements for swabs, buffers, viral transmission media (or other dedicated transmission media), etc. The disclosed embodiments also allow for reduced requirements and costs for personal protective equipment (PPE). Because the reagents and methods are streamlined (e.g., there is no precursor nucleic acid purification and / or extraction step), there is reduced use of nucleic acid preparation plastics, which simultaneously brings about a reduction in reagent costs and inventory costs. It also advantageously reduces dependence on supply-limited projects, and the compatibility of these methods and kit components with existing equipment improves their flexibility and simplicity for public implementation. Overall, such embodiments allow for less expensive assays that can be completed more quickly from sample collection to result generation.

[0098] Some embodiments relate to kits containing one or more primers and / or probes disclosed in Table 1, Table 2, Table 3, and / or Table 4. In an exemplary embodiment, a triple monkeypox assay kit includes a monkeypox / orthopoxvirus multiplex assay set comprising a solution of approximately 300 nM MPX primer, approximately 250 nM MPX probe, approximately 600 nM OPX primer, approximately 250 nM OPX probe, approximately 300 nM RNase P primer, and approximately 250 nM RNase P probe. In an exemplary embodiment, the kit also includes a monkeypox / orthopoxvirus positive control comprising a solution of approximately 10,000 copies / μL.

[0099] Optionally, the kit may further comprise a master mix. In some embodiments, the master mix is a PCR master mix, such as TaqPath TM BactoPure TM Microbial Detection Master Mix (without ROX TM (Thermo Fisher Scientific, Waltham, MA, catalog number A52702). In some embodiments, the kit includes primers, probes, and a master mix sufficient to constitute a reaction mixture that supports amplification of at least one or more target regions from monkeypox virus and / or orthopoxvirus.

[0100] In an exemplary embodiment, samples were prepared using a KingFisher TMFlex purification system (Thermo Fisher Scientific, catalog number 5400610) and MagMAX TM Viral / Pathogen II Nucleic Acid Isolation Kit (Thermo Fisher Scientific, catalog number A48383) was used for the isolation.

[0101] In some array-based embodiments, two or more different qPCR assays (each containing a forward primer, a reverse primer, and an optional probe) are used in a single hole, cavity, site, or feature of the array, and the product of each assay can be detected independently. For example, different assay products can be distinguished by optical methods (e.g., using different markers present in the components of each assay) or using some other suitable method, including as described in U.S. Patent Publication No. 2019 / 0002963, which is incorporated herein by reference. In some embodiments, at least one primer of each assay comprises an optically detectable marker that can be distinguished from the optical marker of at least one other assay.

[0102] In some embodiments, by before amplification, master mixture is added in reaction volume and realizes optimal amplification and detectability of viral genome.Master mixture optionally comprises polymerase, nucleotide, buffer and salt.In some embodiments (particularly multiple determinations), this reaction volume comprises TaqPath BactoPure microbial detection master mixture (no ROX) (Thermo Fisher Scientific, Waltham, MA, catalog number (Cat. No.) A52702).

[0103] Example

[0104] The following examples may relate to specific target nucleic acids, compositions, formulations and / or method steps. However, it should be understood that these examples can be modified by using any components described elsewhere herein, including by using any primers and / or probes described herein.

[0105] Example 1: Screening of Candidate Monkeypox Assays

[0106] A. Comparison of Thermo Fisher MPX assay designs. Candidate monkeypox assays were tested using synthetic templates specific for the respective assays in PCR. PCR was performed from 10 copies / reaction to 10 7The synthetic template was titrated with 10 copies / reaction. In addition, cross-reactivity with orthopoxviruses was determined using genomic DNA from the indicated representative orthopoxviruses. Based on the low Cq values observed in the template titration and undetectable cross-reactivity with the three orthopoxviruses tested, MPX_70585, MPX_70587, MPX_70584, and MPX_70586 were suitable candidates for the MPX panel. Referring to Table 1 above, primers and probes were selected from those listed in the monkeypox probes. In these assays, the primer / probe sets employed included MPX primer / probe sets 26, 34, 40, and 49.

[0107] Figure 1A and Figure 1B Exemplary results of candidate monkeypox assays illustrating amplification plots and associated PCR efficiencies are provided in .

[0108] B. Comparison of Thermo Fisher OPX assay designs. Two candidate orthopoxvirus assays, OPX_70588 and OPX_70589, were screened using synthetic templates and genomic DNA from three representative orthopoxviruses as shown. 7 The synthetic templates were titrated with 10 copies / reaction. Both assays showed strong detection with all templates. OPX_70589 had slightly better performance at the same template concentration, with lower Cq values. However, both OPX_70588 and OPX_70589 are suitable candidates for the OPX panel.

[0109] Figure 2A and Figure 2B Exemplary results of candidate orthopox assays illustrating amplification plots and associated PCR efficiencies are provided in .

[0110] C. Comparison of OPX_70589 (Thermo Fisher) and a non-variola OPX assay (CDC). OPX_70589 was compared to a non-variola OPX assay in titration experiments using synthetic templates. While both assays demonstrated similar PCR efficiency, the non-variola OPX assay showed better performance at the same template concentration, with lower Cq values. Based on the screening data, OPX_70588, OPX_70589, and the non-variola OPX assay are suitable candidates for the OPX panel.

[0111] With reference to Table 2 above, primers and probes were selected from those OPX probes as listed. In these assays, the primer / probe sets employed included: OPX primer / probe sets 1, 2, and 3.

[0112] Figure 2B Exemplary results of candidate orthopoxvirus assays illustrating PCR efficiency are provided in .

[0113] Example 2: Monkeypox / Orthopoxvirus DNA Kit and Protocol

[0114] With respect to Examples 2 to 9 below, target oligonucleotides, primers, and probes were selected from corresponding Tables 1 to 4. In these specific assays as described in the following Examples, the primer / probe sets employed included: MPX primers / probes from Set 34 of Table 1, OPX primers / probes from Set 3 of Table 2, and RNase P primers / probes from Table 3.

[0115] An exemplary kit and protocol for detecting monkeypox virus from a biological sample via a multiplex assay employs a triplicate assay comprising a three-channel set, one assay per channel, an MPX assay with a FAM reporter and an MGB quencher, an OPX assay with a VIC reporter and a QSY7 quencher, and an RNase P assay with a JUN reporter and a QSY7 quencher.

[0116] Target and oligonucleotide primers and probes were selected from those listed in Tables 1 to 4 above.

[0117] The Monkeypox / Ottpoxvirus DNA Kit is a multiplex polymerase chain reaction (PCR) test designed to qualitatively detect nucleic acid from monkeypox virus and screen for orthopoxvirus in lesion swab samples in universal transport medium (UTM) or viral transport medium (VTM) from individuals whose healthcare providers suspect monkeypox infection. The result is the identification of monkeypox virus and non-smallpox orthopoxvirus DNA, which is typically detectable in lesion swab samples during the acute phase of infection.

[0118] The assay kit contains primer and probe sets for identifying monkeypox virus DNA and also for screening for varying concentrations of other non-smallpox orthopoxvirus DNA (including vaccinia virus, cowpox virus, monkeypox virus, and ectropox virus). RNase P (a reference human gene) was selected as an endogenous internal control to indicate successful and adequate sample collection. Detection of RNase P indicates the presence of human nucleic acids and suggests that human biological material was collected and successfully extracted and amplified.

[0119] A positive result indicates the presence of monkeypox or other orthopoxvirus DNA; clinical correlation with the patient's medical history and other diagnostic information is necessary to determine the patient's infection status.

[0120] The DNA kit is a multiplex real-time PCR assay solution that detects nucleic acids from monkeypox virus, non-variola orthopoxvirus targets, and human RNase P in multiple reaction wells.

[0121] Each kit includes the following components:

[0122] TaqPath TMMonkeypox / Ottopoxvirus Multiplex Assay - Multiplex real-time PCR assay containing primers / probes specific for monkeypox virus, non-smallpox orthopoxvirus targets, and human RNase P.

[0123] TaqPath TM Monkeypox / Ottpoxvirus DNA Positive Control - Positive DNA control containing template specific for monkeypox virus, a non-variola orthopoxvirus target, and the human RNase P region targeted by this assay.

[0124] The assay contains primer and probe sets specific for the following targets: Monkeypox virus; Orthopoxvirus; and RNase P (human sample collection control).

[0125] TaqPath TM Monkeypox / Ottpox virus DNA kit probe contains QSY TM and MGB quenchers, which are non-fluorescent. The dyes, quenchers, and targets are shown in Table 6.

[0126] Table 6: Dyes, Quenchers, and Targets

[0127]

[0128] Analyze the results using the following software:

[0129] Applied Biosystems TM Pathogen Interpretation Software v1.1

[0130] SAE Administrator Console Dx v1.0 or SAE Administrator Console Dx v1.2 (for security and auditing functions)

[0131] Pathogen Interpretation Software 1.0.0 DAT (SAE Profile)

[0132] For the appropriate measurement group for the instrument:

[0133] -MPXOPX-EUA_QS5-9601_1.0.0.zip

[0134] -MPXOPX-EUA_QS5Dx-9602_1.0.0.zip

[0135] -MPXOPX-EUA_QS7F-384_1.0.0.zip

[0136] In this process, probes anneal to specific target sequences between unique forward and reverse primers for the following targets: monkeypox virus, orthopoxvirus, and RNase P (human sample collection control).

[0137] During the extension phase of the PCR cycle, the 5' exonuclease activity of Taq polymerase degrades the probe, resulting in the separation of the reporter dye from the quencher dye, generating a fluorescent signal. With each cycle, additional reporter dye molecules are cleaved from their corresponding probes, increasing the fluorescence intensity. Fluorescence intensity is monitored during each PCR cycle using a real-time PCR instrument.

[0138] Other tools, equipment, and reagents for use with the assay kit include software that can be selected from the following: Applied Biosystems TM QuantStudio TM 5 Real-time PCR system, 96-well, 0.1 mL block; Applied Biosystems TM QuantStudio TM 5Dx Real-Time PCR System, 96-well, 0.2 mL Block, and Applied Biosystems TM QuantStudio TM 7Flex Real-Time PCR System, 384 wells; standard laboratory equipment, including freezer, centrifuge, mixer, pipette, etc.; nucleic acid extraction system; plates; nucleic acid isolation and microbial detection kits, PCR instrument and related plates and consumables.

[0139] Example 3: Exemplary Workflow Using Kits / Protocols

[0140] In an exemplary embodiment, a workflow for detecting monkeypox virus includes the following steps:

[0141] (1) Providing samples from patients suspected of monkeypox / orthopoxvirus infection;

[0142] (2) Perform automated DNA extraction, for example, using a KingFisher with a 96-deep-well head TM Flex Magnetic Particle Processor and MagMAX with 400 μL sample input volume TM Virus / Pathogen II Nucleic Acid Isolation Kit;

[0143] (3) Prepare a real-time PCR reaction including the components shown in Table 7, where the volumes assume that the extracted sample DNA was obtained using an original sample input volume of 400 μL. Table 8 shows the reaction plate volumes for each of the samples, positive controls, and negative controls.

[0144] Table 7: PCR components

[0145]

[0146] Table 8: Reaction Plate Volumes

[0147]

[0148] (4) Use a suitable real-time PCR instrument, such as QuantStudio TM 5 real-time PCR instruments with 96-well, 0.1 mL blocks for real-time PCR; and

[0149] (5) Use appropriate software to analyze the data.

[0150] Example 4: Quality Control and Validity of Results

[0151] At least one negative control and one positive control must be present in each run. All control wells must pass for the real-time PCR plate to be considered valid (Table 9).

[0152] For each extraction presented on the real-time PCR plate, a negative control well must be run. All control wells must pass for the real-time PCR plate to be considered valid.

[0153] As shown in Table 10, the results were automatically validated by the software based on the performance of the positive and negative controls.

[0154] Table 9: Control samples

[0155]

[0156] Table 10: Interpretation of results for viral targets in patient samples

[0157]

[0158] Example 5: Limit of Detection (LoD)

[0159] This study identified TaqPath TM LoDs for the Monkeypox / Othopoxvirus DNA Kit for two viral targets: Monkeypox virus and Orthopoxvirus.

[0160] The LoD for each viral target was determined using artificial samples, synthetic MPXV DNA, and genomic vaccinia virus DNA (selected to represent orthopoxviruses) spiked into pooled lesion samples in Universal Transport Medium (UTM) at various concentration levels. Individual lesion samples obtained from the vendor were confirmed negative for MPXV and OTPV prior to pooling. Synthetic MPXV DNA and genomic vaccinia virus DNA were quantified using droplet digital PCR (ddPCR) for this study. MagMAX TM Virus / Pathogen II Nucleic Acid Isolation Kit in KingFisher with 96 deep-well head TM Sample extraction was performed on a Flex magnetic particle processor, and each extraction replicate was tested on three PCR instruments: QuantStudio TM5 Real-time PCR instrument (96-well, 0.1 mL block), QuantStudio TM 5Dx Real-Time PCR Instrument (96-well, 0.2 mL block) and QuantStudio TM 7Flex real-time PCR instrument (384-well block).

[0161] The study was conducted in three phases. Phase I consisted of finding an approximate concentration range for the LoD. Phase II refined the concentration range tested based on the Phase I results. Phase III confirmed the LoD using 20 test replicates. The LoD data determined for each instrument are summarized in Table 11, where the LoD for each viral target is shown in bold.

[0162] Table 11: LoD: Phase III Summary

[0163]

[0164] Example 6: Reactivity (inclusiveness)

[0165] Computer analysis was performed to determine TaqPath TM Reactivity of the Monkeypox / Othopoxvirus DNA Kit primer / probe sequences with all known strains / isolates of Monkeypox virus (Clade I and Clade II) and non-smallpox orthopoxviruses (including vaccinia, cowpox, mousepox, and camelpox) (inclusive). Based on BLAST analysis, as of October 11, 2022, TaqPath TM The Monkeypox / Orthopoxvirus DNA Kit showed 100% homology to ≥99.6% of the monkeypox virus strains in the GISAID and GenBank databases. The impact of mismatched sequences was assessed and inferred to have minimal impact on the ability of the assay to detect monkeypox strains, as the positions of mutations in the assay primers and probes indicated that many observed mismatches should not significantly affect strain detection, and the assay's predicted T for mismatched targets was 100%. m The value is higher than the annealing temperature. The predictive inclusiveness of non-smallpox OPV strains (cowpox, camelpox, mousepox, and vaccinia) in the OPV assay was investigated. Because the primer or probe homology is well above 90%, it is predicted that mismatches in the OPV assay primers or probes will not affect the detection of the corresponding strains.

[0166] Predict TaqPath based on computer analysis TM The Monkeypox / Othopoxvirus DNA Kit provides high sensitivity with a low risk of failure in detecting monkeypox strains and non-smallpox orthopoxviruses (cowpox, camelpox, mousepox, and vaccinia strains / isolates).

[0167] Example 8: Clinical Evaluation

[0168] Using TaqPath TMThe Monkeypox / Ottpoxvirus DNA Kit was evaluated for clinical performance using 30 monkeypoxvirus artificial positive samples, 30 orthopoxvirus artificial positive samples, and 30 negative clinical lesion samples. The artificial samples targeted 2×, 3×, and 5× LoDs for monkeypoxvirus and orthopoxvirus. Each artificial positive sample was prepared using negative lesion samples in transport medium (15 samples in UTM and 15 samples in VTM) spiked with synthetic monkeypoxvirus DNA or genomic vaccinia virus DNA (selected to represent orthopoxvirus). The detection rate for all artificial monkeypoxvirus and orthopoxvirus positive samples was 100%. The detection rate for all negative lesion samples was 0%. The results obtained were identical to those of QuantStudio TM 5Real-time PCR instrument, QuantStudio TM 5Dx Real-Time PCR Instrument and QuantStudio TM The results were obtained using the 7Flex real-time PCR instrument and are summarized in Table 13.

[0169] Table 13: Summary of clinical results

[0170]

[0171] [1]NPA = Negative Percent Agreement; PPA = Positive Percent Agreement

[0172] Example 9: Determination of target C t Cutoff value

[0173] Each individual assay was also analyzed for C t The pathogen interpretation software uses the C values shown in Table 14 for the assay targets during result interpretation. t Cutoff value.

[0174] Table 14: C t Cutoff value

[0175]

[0176] Example 10: Exemplary Uses of Assay Kits and Procedures

[0177] In an exemplary embodiment, a monkeypox / orthopoxvirus detection kit is provided, and sample DNA is amplified by PCR using the TaqMan amplification method and the PCR settings shown in Tables 15 to 19.

[0178] Table 15: Components of the kit

[0179]

[0180] Table 16: Other components

[0181]

[0182] Table 17: Assay Target Quenchers and Reporter Factors

[0183] Determination Quencher Reporter Factor MPX MGB FAM Non-smallpox OPX QSY7 VIC RNase P QSY7 JUN

[0184] PCR amplification method using TaqMan amplification

[0185] Table 18: PCR settings

[0186] Components Sample volume Main mixture 10 μL Monkeypox / Othopoxvirus Multiplex Assay Panel 1 μL sample 9μL Total volume 20 μL

[0187] Table 19: Thermal Cycling Conditions

[0188]

[0189] Exemplary embodiments

[0190] A non-exhaustive list of numbered items enumerating certain preferred embodiments is provided below:

[0191] 1. A composition for detecting the presence of monkeypox virus in a biological sample, the composition comprising: a first nucleic acid forward primer, the first nucleic acid forward primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID NOs: 16-70; and a first nucleic acid reverse primer, the first nucleic acid reverse primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID NOs: 71-125, wherein the first nucleic acid forward primer and the first nucleic acid reverse primer are configured to hybridize to different ends of a first target nucleic acid sequence present in a target region of the genome of the monkeypox virus, to a DNA copy of the first target nucleic acid sequence, or to a complement of the first target nucleic acid sequence or a DNA copy of the complement.

[0192] 2. The composition of claim 1 , wherein the first nucleic acid forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41, 49, 55, and 64; and the first nucleic acid reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 96, 104, 110, and 119.

[0193] 3. The composition according to any one of items 1 or 2, wherein the first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 41.

[0194] 4. The composition according to any one of items 1 to 3, wherein the first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 96.

[0195] 5. The composition according to any one of items 1 or 2, wherein the first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 49.

[0196] 6. The composition according to any one of items 1, 2 or 5, wherein the first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 104.

[0197] 7. The composition according to any one of items 1 or 2, wherein the first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 55.

[0198] 8. The composition according to any one of items 1, 2 or 7, wherein the first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 110.

[0199] 9. The composition according to any one of items 1 or 2, wherein the first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 64.

[0200] 10. The composition according to any one of items 1, 2 or 9, wherein the first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 119.

[0201] 11. The composition according to any one of the preceding items, further comprising: a first nucleic acid probe, the first nucleic acid probe comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID NOs: 126-180, wherein the first nucleic acid probe is configured to hybridize to a first target nucleic acid subsequence that is complementary to or identical to the first target nucleic acid sequence, or to hybridize to a DNA copy of the first target nucleic acid subsequence.

[0202] 12. The composition according to item 11, wherein the first nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID NO: 151, 159, 165 and 174.

[0203] 13. The composition according to item 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 151.

[0204] 14. The composition according to item 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 159.

[0205] 15. The composition according to item 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 165.

[0206] 16. The composition according to item 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 174.

[0207] 17. The composition according to any one of items 1 to 16, wherein the first nucleic acid probe further comprises a detectable label.

[0208] 18. The composition according to item 17, wherein the detectable label is a fluorescent label, and the first nucleic acid probe further comprises a quencher that quenches the detectable label or the fluorescent label.

[0209] 19. The composition according to any one of items 17 or 18, wherein the first nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

[0210] 20. The composition according to any one of items 1 to 19, further comprising: a second nucleic acid forward primer, the second nucleic acid forward primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID Nos: 4, 7 and 10; and a second nucleic acid reverse primer, the second nucleic acid reverse primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID Nos: 5, 8 and 11, wherein the second nucleic acid forward primer and the second nucleic acid reverse primer are configured to hybridize with different ends of a second target nucleic acid sequence present in a target region of the genome of a non-variola orthopoxvirus, hybridize with a DNA copy of the second target nucleic acid sequence, or hybridize with a complementary sequence of the second target nucleic acid sequence or a DNA copy of the complementary sequence.

[0211] 21. The composition according to item 20, wherein the second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 4, and the second reverse primer is an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 5.

[0212] 22. The composition according to item 20, wherein the second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 7, and the second reverse primer is an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 8.

[0213] 23. The composition according to item 20, wherein the second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 10, and the second reverse primer is an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 11.

[0214] 24. The composition according to any one of items 1 to 23, further comprising: a second nucleic acid probe, the second nucleic acid probe comprising an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID No: 6, 9 and 12, wherein the second nucleic acid probe is configured to hybridize with a second target nucleic acid subsequence that is complementary or identical to the second target nucleic acid sequence, or to hybridize with a DNA copy of the second target nucleic acid subsequence.

[0215] 25. The composition according to item 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 6.

[0216] 26. The composition according to item 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 9.

[0217] 27. The composition according to item 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO: 12.

[0218] 28. The composition according to any one of items 24 to 27, wherein the second nucleic acid probe further comprises a detectable label.

[0219] 29. The composition according to item 28, wherein the detectable label is a fluorescent label, and the second nucleic acid probe further comprises a quencher that quenches the fluorescent label.

[0220] 30. The composition according to any one of items 28 or 29, wherein the second nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

[0221] 31. The composition according to any one of items 1 to 30, further comprising:

[0222] a third nucleic acid forward primer comprising an oligonucleotide comprising a nucleic acid sequence having SEQ ID NO: 13; and a third nucleic acid reverse primer comprising an oligonucleotide comprising a nucleic acid sequence having SEQ ID NO: 14, wherein the third nucleic acid forward primer and the third nucleic acid reverse primer are configured to hybridize with different ends of a third target nucleic acid sequence present in the target region of the genome of human ribonuclease P, hybridize with a DNA copy of the third target nucleic acid sequence, or hybridize with a complementary sequence of the third target nucleic acid sequence or a DNA copy of the complementary sequence.

[0223] 32. The composition according to item 31 further comprises: a third nucleic acid probe, comprising an oligonucleotide containing a nucleic acid sequence having SEQ ID NO: 15, wherein the third nucleic acid probe is configured to hybridize with a third target nucleic acid subsequence that is complementary to or identical to the third target nucleic acid sequence, or to hybridize with a DNA copy of the third target nucleic acid subsequence.

[0224] 33. The composition according to item 32, wherein the third nucleic acid probe further comprises a detectable label.

[0225] 34. The composition according to item 33, wherein the detectable label is a fluorescent label, and the third nucleic acid probe further comprises a quencher that quenches the fluorescent label.

[0226] 35. The composition according to any one of items 33 or 34, wherein the third nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

[0227] 36. The composition according to any one of items 1 to 35, further comprising: the biological sample, a polymerase, a buffer and dNTPs.

[0228] 37. The composition according to any one of items 1 to 36, wherein the biological sample is a nucleic acid sample, and the nucleic acid sample is a DNA sample.

[0229] 38. The composition of any one of items 1 to 37, wherein the biological sample is selected from the group consisting of: lesion fluid on a dry swab, lesion fluid swab in viral transport medium, lesion fluid on a slide, lesion scab, lesion top, saliva sample, buccal sample, nasal sample, nasopharyngeal sample, blood sample, urine sample and semen sample.

[0230] 39. The composition according to any one of items 1 to 38, wherein the biological sample is a human sample.

[0231] 40. The composition according to any one of items 1 to 38, wherein the biological sample is a non-human sample.

[0232] 41. A kit for detecting monkeypox virus nucleic acid in a biological sample, the kit comprising: one or more polymerase chain reaction (PCR) reagents, wherein the one or more PCR reagents comprise the composition according to any one of items 1 to 40.

[0233] 42. The kit according to item 41, further comprising: a PCR master mix.

[0234] 43. The kit according to item 41 or 42, wherein at least one component of the kit is dried or freeze-dried.

[0235] 44. A kit according to any one of items 41 to 43, further comprising: a PCR assay array, wherein each of the PCR assays is located in a different position of the array, and the different positions include holes, channels, grooves, cavities, sites or features formed on the surface of the array.

[0236] 45. A method for detecting monkeypox virus in a biological sample, the method comprising: providing a reaction mixture containing the biological sample and the composition according to any one of items 1 to 40; and prior to amplification, subjecting the reaction mixture to reaction conditions suitable for amplifying a target monkeypox virus nucleic acid sequence present in the biological sample, the target monkeypox virus nucleic acid sequence being the first target nucleic acid sequence; and detecting the amplified target monkeypox virus nucleic acid sequence.

[0237] 46. The method of item 45, wherein subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence comprises forming one or more amplicons via polymerase chain reaction (PCR).

[0238] 47. The method of any one of items 45 or 46, wherein the detection of the amplified target monkeypox virus nucleic acid comprises monitoring fluorescence generated during the PCR.

[0239] 48. The method according to any one of items 45 to 47, further comprising determining the amount of monkeypox virus nucleic acid present in the biological sample.

[0240] 49. The method according to any one of items 45 to 48, further comprising: analyzing a positive control and / or a negative control together with the biological sample.

[0241] 50. The method of item 49, wherein the positive control is a synthetic oligonucleotide comprising a monkeypox virus sequence, a non-variola orthopoxvirus sequence, and an endogenous DNA or RNA sequence.

[0242] 51. The method according to item 50, wherein the endogenous DNA or RNA sequence is a human RNase P sequence.

[0243] 52. The method according to any one of items 45 to 51, further comprising: identifying the monkeypox virus as a variant or a reference form.

[0244] 53. A method according to any one of items 45 to 52, wherein the detection of the amplified target monkeypox virus nucleic acid sequence is performed during and / or after subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence.

[0245] 54. The method according to any one of items 45 to 53, further comprising diagnosing monkeypox infection in the organism from which the biological sample was obtained.

[0246] 55. The method of item 54, wherein the organism is a human subject.

[0247] 56. The method of any one of items 45 to 55, wherein subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence comprises performing loop-mediated isothermal amplification (LAMP).

[0248] 57. The method according to any one of items 45 to 56, wherein the method does not comprise purification or extraction of the nucleic acid-containing fraction from the biological sample.

[0249] 58. The method according to any one of items 45 to 57, wherein the biological sample is an unpurified sample.

[0250] 59. The method according to any one of items 45 to 58, further comprising: heating the biological sample for a period of time sufficient to inactivate nucleases in the biological sample and / or disrupt eukaryotic cells, denature viral capsids and / or destroy the membrane portion of enveloped viral particles therein.

[0251] 60. The method according to any one of items 57 to 59, further comprising heating the unpurified sample to a temperature of about 80°C or above, preferably about 90°C or above, more preferably about 95°C or above.

[0252] 61. A method according to claim 60, wherein the unpurified sample is heated for at least 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes or 40 minutes, or for any time range formed by the upper and lower limits selected therefrom.

[0253] 62. The method according to any one of items 60 or 61, further comprising: combining the heat-treated sample with a lysis buffer.

[0254] 63. A method according to item 62, wherein the lysis buffer comprises a buffer suitable for nucleic acids and a detergent and / or an emulsifier.

[0255] 64. A method according to any one of items 62 to 63, wherein the lysis buffer comprises a combination of TBE buffer and a polysorbate-type non-ionic surfactant such as Tween-20.

[0256] 65. A method according to any one of items 45 to 64, wherein the biological sample comprises pooled subject samples.

[0257] 66. The method according to any one of items 45 to 64, wherein detecting monkeypox virus in the biological sample is performed in less than about 3 hours, preferably less than about 2 hours from the time of receiving the biological sample.

[0258] 67. A method according to any one of items 45 to 56 and 65 to 66, wherein the providing of the reaction mixture comprises heating the biological sample at 95°C for 15 to 45 minutes, preferably about 30 minutes; mixing the heated biological sample with a lysis solution to form a certain volume of confirmatory template; and generating a nucleic acid amplification reaction mixture comprising at least a portion of the volume of confirmatory template, a composition according to items 1 to 40 and a nucleic acid polymerase.

[0259] 68. The method according to any one of items 45 to 67, further comprising: receiving the biological sample.

[0260] 69. The method of claim 68, wherein receiving the biological sample comprises receiving a sample collection device or other container containing the biological sample.

[0261] 70. The method of item 69, wherein the sample collection device is a sealable tube.

[0262] 71. The method of any one of items 68 to 71, wherein the biological sample is received after the subject has self-collected the biological sample.

[0263] 72. A method according to any one of items 68 to 71, wherein said receiving of said biological sample comprises receiving a raw saliva sample.

[0264] 73. The method according to any one of items 67 to 71, further comprising equilibrating the heated biological sample to room temperature before mixing the heated biological sample with the lysis solution.

[0265] 74. A method according to any one of items 67 to 74, wherein a sample collection device is used to receive and heat the biological sample.

[0266] 75. A composition for multiplex detection of monkeypox virus nucleic acid and orthopoxvirus nucleic acid, the composition comprising: a first primer-probe set, the first primer-probe set comprising a first forward primer and a first reverse primer, the first forward primer and the first reverse primer each being configured to hybridize to a different end of a first target nucleic acid sequence present in a target region of monkeypox virus DNA, to hybridize to a DNA copy of the first target nucleic acid sequence, or to a complementary sequence of the first target nucleic acid sequence or a DNA copy of the complementary sequence, and a first probe, the first probe being configured to hybridize to a first target nucleic acid subsequence complementary to or identical to the first target nucleic acid sequence, or to hybridize to a DNA copy of the first target nucleic acid subsequence, wherein the first primer-probe set comprises a sequence selected from SEQ ID NO:16-180; a second primer-probe set, the second primer-probe set comprising a second forward primer and a second reverse primer, the second forward primer and the second reverse primer each being configured to hybridize with different ends of a second target sequence present in the target region of the orthopoxvirus DNA, hybridize with a DNA copy of the second target nucleic acid sequence, or hybridize with a complementary sequence of the second target nucleic acid sequence or a DNA copy of the complementary sequence, and a second probe, the second probe being configured to hybridize with a second target nucleic acid subsequence that is complementary or identical to the second target nucleic acid sequence, or hybridize with a DNA copy of the second target nucleic acid subsequence, wherein the second primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NO:4-12.

[0267] 76. The composition of item 75, wherein the first primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NO: 41, 49, 55, 64, 96, 104, 110, 119, 151, 159, 165 and 174.

[0268] 77. The composition according to any one of items 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO: 41.

[0269] 78. The composition according to any one of items 75 to 77, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 96.

[0270] 79. The composition according to any one of items 75 to 78, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 151.

[0271] 80. The composition according to any one of items 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO: 49.

[0272] 81. The composition of any one of items 75, 76 or 80, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 104.

[0273] 82. The composition of any one of items 75, 76, 80 or 81, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 159.

[0274] 83. The composition according to any one of items 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO: 55.

[0275] 84. The composition according to any one of items 75, 76 or 83, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 110.

[0276] 85. The composition of any one of items 75, 76, 83 or 84, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 165.

[0277] 86. The composition of any one of items 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO: 64.

[0278] 87. The composition according to any one of items 75, 76 or 86, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 119.

[0279] 88. The composition according to any one of items 75, 76, 86 or 87, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO: 174.

[0280] 89. The composition according to any one of items 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO: 4-6.

[0281] 90. The composition according to any one of items 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NOs: 7-9.

[0282] 91. The composition according to any one of items 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NOs: 10-12.

[0283] 92. A composition according to any one of items 75 to 91, further comprising: a third primer-probe set, the third primer-probe set comprising a third forward primer and a third reverse primer, each of the third forward primer and the third reverse primer being configured to hybridize with different ends of a third target nucleic acid sequence present in the target region of human ribonuclease P, and a third probe, the third probe being configured to hybridize with a third target nucleic acid subsequence that is complementary to or identical to the third target nucleic acid sequence, or to hybridize with a DNA copy of the third target nucleic acid subsequence, wherein the third primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NOs: 13-15.

[0284] 93. The composition of any one of items 75 to 92, wherein the first nucleic acid probe, the second nucleic acid probe, and the third nucleic acid probe each further comprise a different detectable label.

[0285] 94. A composition according to item 93, wherein the detectable label is a fluorescent label, and the first nucleic acid probe, the second nucleic acid probe and the third nucleic acid probe each further comprise a different quencher that quenches the corresponding detectable label or the corresponding fluorescent label.

[0286] 95. The composition of any one of items 93 or 94, wherein the first nucleic acid probe, the second nucleic acid probe, and the third nucleic acid probe are each labeled with the detectable label at the 5' end and with the quencher at the 3' end.

[0287] 96. The composition of any one of items 75 to 95, further comprising: the biological sample, a polymerase, a buffer, and dNTPs.

[0288] 97. The composition according to any one of items 75 to 96, wherein the biological sample is a nucleic acid sample, and the nucleic acid sample is a DNA sample.

[0289] 98. The composition of any one of items 75 to 96, wherein the biological sample is selected from the group consisting of: lesion fluid on a dry swab, lesion fluid swab in viral transport medium, lesion fluid on a slide, lesion scab, lesion top, saliva sample, buccal sample, nasal sample, nasopharyngeal sample, blood sample, urine sample and semen sample.

[0290] 99. The composition of any one of items 75 to 98, wherein the biological sample is a human sample.

[0291] 100. The composition of any one of items 75 to 98, wherein the biological sample is a non-human sample.

[0292] in conclusion

[0293] Without departing from its spirit or essential characteristics, the present disclosure may be implemented in other specific forms. The described embodiments should be considered in all respects to be merely illustrative and not restrictive. Therefore, the scope of the present invention is represented by the appended claims rather than by the above description. Although certain embodiments and details have been included in this article and the attached disclosure for the purpose of illustrating the embodiments of the present disclosure, it will be apparent to those skilled in the art that various changes can be made to the methods, products, devices and equipment disclosed herein without departing from the scope of the present disclosure or the invention. Therefore, although various aspects and embodiments have been disclosed herein, other aspects and embodiments are also considered. All changes that fall within the meaning and scope of the equivalents of the claims will be encompassed within the scope of the claims.

Claims

1. A composition for detecting the presence of monkeypox virus in a biological sample, the composition comprising: a first nucleic acid forward primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 16-70; and a first nucleic acid reverse primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 71-125, The first nucleic acid forward primer and the first nucleic acid reverse primer are configured to hybridize with different ends of the first target nucleic acid sequence present in the target region of the genome of the monkeypox virus, hybridize with a DNA copy of the first target nucleic acid sequence, or hybridize with a complementary sequence of the first target nucleic acid sequence or a DNA copy of the complementary sequence.

2. The composition according to claim 1, wherein The first nucleic acid forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 41, 49, 55, and 64; and The first nucleic acid reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence selected from SEQ ID NOs: 96, 104, 110 and 119.

3. The composition according to any one of claims 1 or 2, wherein The first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

41.

4. The composition according to any one of claims 1 to 3, wherein The first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

96.

5. The composition according to any one of claims 1 or 2, wherein The first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

49.

6. The composition according to any one of claims 1, 2 or 5, wherein The first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

104.

7. The composition according to any one of claims 1 or 2, wherein The first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

55.

8. The composition according to any one of claims 1, 2 or 7, wherein The first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

110.

9. The composition according to any one of claims 1 or 2, wherein The first forward primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

64.

10. The composition according to any one of claims 1, 2 or 9, wherein The first reverse primer comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

119.

11. The composition according to any one of the preceding claims, further comprising: a first nucleic acid probe comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 126-180, The first nucleic acid probe is configured to hybridize to a first target nucleic acid subsequence that is complementary to or identical to the first target nucleic acid sequence, or to hybridize to a DNA copy of the first target nucleic acid subsequence.

12. The composition of claim 11, wherein the first nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID NOs: 151, 159, 165, and 174.

13. The composition of claim 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

151.

14. The composition of claim 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

159.

15. The composition of claim 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

165.

16. The composition of claim 11 or 12, wherein the first probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

174.

17. The composition of any one of claims 1 to 16, wherein the first nucleic acid probe further comprises a detectable label.

18. The composition of claim 17, wherein the detectable label is a fluorescent label, and the first nucleic acid probe further comprises a quencher that quenches the detectable label or the fluorescent label.

19. The composition of any one of claims 17 or 18, wherein the first nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

20. The composition according to any one of claims 1 to 19, further comprising: a second nucleic acid forward primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID Nos: 4, 7, and 10; and a second nucleic acid reverse primer comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID Nos: 5, 8, and 11; The second nucleic acid forward primer and the second nucleic acid reverse primer are configured to hybridize with different ends of a second target nucleic acid sequence present in a target region of the genome of a non-smallpox orthopoxvirus, hybridize with a DNA copy of the second target nucleic acid sequence, or hybridize with a complementary sequence of the second target nucleic acid sequence or a DNA copy of the complementary sequence.

21. The composition according to claim 20, wherein The second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 4, and The second reverse primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO:

5.

22. The composition of claim 20, wherein The second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 7, and The second reverse primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO:

8.

23. The composition of claim 20, wherein The second forward primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO: 10, and The second reverse primer is an oligonucleotide comprising at least one nucleotide sequence having SEQ ID NO:

11.

24. The composition according to any one of claims 1 to 23, further comprising: a second nucleic acid probe comprising an oligonucleotide comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID Nos: 6, 9, and 12; The second nucleic acid probe is configured to hybridize to a second target nucleic acid subsequence that is complementary to or identical to the second target nucleic acid sequence, or to hybridize to a DNA copy of the second target nucleic acid subsequence.

25. The composition of claim 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

6.

26. The composition of claim 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

9.

27. The composition of claim 24, wherein the second nucleic acid probe comprises an oligonucleotide comprising at least one nucleic acid sequence having SEQ ID NO:

12.

28. The composition of any one of claims 24 to 27, wherein the second nucleic acid probe further comprises a detectable label.

29. The composition of claim 28, wherein the detectable label is a fluorescent label and the second nucleic acid probe further comprises a quencher that quenches the fluorescent label.

30. The composition of any one of claims 28 or 29, wherein the second nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

31. The composition of any one of claims 1 to 30, further comprising: a third nucleic acid forward primer comprising an oligonucleotide comprising a nucleic acid sequence having SEQ ID NO: 13; and a third nucleic acid reverse primer comprising an oligonucleotide comprising a nucleic acid sequence having SEQ ID NO: 14, The third nucleic acid forward primer and the third nucleic acid reverse primer are configured to hybridize with different ends of a third target nucleic acid sequence present in the target region of the genome of human ribonuclease P, hybridize with a DNA copy of the third target nucleic acid sequence, or hybridize with a complementary sequence of the third target nucleic acid sequence or a DNA copy of the complementary sequence.

32. The composition of claim 31 , further comprising: A third nucleic acid probe comprises an oligonucleotide comprising a nucleic acid sequence having SEQ ID NO: 15, wherein the third nucleic acid probe is configured to hybridize to a third target nucleic acid subsequence that is complementary to or identical to the third target nucleic acid sequence, or to a DNA copy of the third target nucleic acid subsequence.

33. The composition of claim 32, wherein the third nucleic acid probe further comprises a detectable label.

34. The composition of claim 33, wherein the detectable label is a fluorescent label and the third nucleic acid probe further comprises a quencher that quenches the fluorescent label.

35. The composition of any one of claims 33 or 34, wherein the third nucleic acid probe is labeled with the detectable label at the 5' end and with the quencher at the 3' end.

36. The composition of any one of claims 1 to 35, further comprising: The biological sample, polymerase, buffer and dNTP.

37. The composition of any one of claims 1 to 36, wherein the biological sample is a nucleic acid sample, and the nucleic acid sample is a DNA sample.

38. The composition of any one of claims 1 to 37, wherein the biological sample is selected from the group consisting of: lesion fluid on a dry swab, lesion fluid swab in viral transport medium, lesion fluid on a glass slide, lesion scab, lesion dome, saliva sample, buccal sample, nasal sample, nasopharyngeal sample, blood sample, urine sample, and semen sample.

39. The composition of any one of claims 1 to 38, wherein the biological sample is a human sample.

40. The composition of any one of claims 1 to 38, wherein the biological sample is a non-human sample.

41. A kit for detecting monkeypox virus nucleic acid in a biological sample, the kit comprising: One or more polymerase chain reaction (PCR) reagents, wherein the one or more PCR reagents comprise the composition of any one of claims 1 to 40.

42. The kit according to claim 41, further comprising: PCR master mix.

43. The kit of claim 41 or 42, wherein at least one component of the kit is dried or freeze-dried.

44. The kit according to any one of claims 41 to 43, further comprising: an array of PCR assays, wherein each of the PCR assays is located in a different position of the array, and The distinct locations include wells, channels, grooves, cavities, sites or features formed on the surface of the array.

45. A method for detecting monkeypox virus in a biological sample, the method comprising: providing a reaction mixture comprising the biological sample and the composition according to any one of claims 1 to 40; as well as Prior to amplification, subjecting the reaction mixture to reaction conditions suitable for amplifying a target monkeypox virus nucleic acid sequence present in the biological sample, the target monkeypox virus nucleic acid sequence being the first target nucleic acid sequence; and Detect the amplified target monkeypox virus nucleic acid sequence.

46. The method of claim 45, wherein subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence comprises forming one or more amplicons via polymerase chain reaction (PCR).

47. The method of any one of claims 45 or 46, wherein the detecting of the amplified target monkeypox virus nucleic acid comprises monitoring fluorescence generated during the PCR.

48. The method of any one of claims 45 to 47, further comprising determining the amount of monkeypox virus nucleic acid present in the biological sample.

49. The method according to any one of claims 45 to 48, further comprising: Positive controls and / or negative controls are analyzed along with the biological sample.

50. The method of claim 49, wherein the positive control is a synthetic oligonucleotide comprising a monkeypox virus sequence, a non-variola orthopoxvirus sequence, and an endogenous DNA or RNA sequence.

51. The method of claim 50, wherein the endogenous DNA or RNA sequence is a human RNase P sequence.

52. The method of any one of claims 45 to 51, further comprising: The monkeypox virus is identified as a variant or reference form.

53. The method of any one of claims 45 to 52, wherein the detection of the amplified target monkeypox virus nucleic acid sequence is performed during and / or after subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence.

54. The method of any one of claims 45 to 53, further comprising diagnosing monkeypox infection in the organism from which the biological sample was obtained.

55. The method of claim 54, wherein the organism is a human subject.

56. The method of any one of claims 45 to 55, wherein subjecting the reaction mixture to reaction conditions suitable for amplifying the target monkeypox virus nucleic acid sequence comprises performing loop-mediated isothermal amplification (LAMP).

57. The method of any one of claims 45 to 56, wherein the method does not comprise purifying or extracting the nucleic acid-containing portion from the biological sample.

58. The method of any one of claims 45 to 57, wherein the biological sample is an unpurified sample.

59. The method according to any one of claims 45 to 58, further comprising: The biological sample is heated for a period of time sufficient to inactivate nucleases in the biological sample and / or disrupt eukaryotic cells, denature viral capsids, and / or disrupt membrane portions of enveloped viral particles therein.

60. The method according to any one of claims 57 to 59, further comprising: The unpurified sample is heated to a temperature of about 80°C or higher, preferably about 90°C or higher, more preferably about 95°C or higher.

61. The method of claim 60, wherein the unpurified sample is heated for at least 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, or 40 minutes, or for any time range formed by the upper and lower limits selected therefrom.

62. The method according to any one of claims 60 or 61, further comprising: Combine heat-treated samples with lysis buffer.

63. The method of claim 62, wherein the lysis buffer comprises a buffer suitable for nucleic acids and a detergent and / or emulsifier.

64. The method of any one of claims 62 to 63, wherein the lysis buffer comprises a combination of TBE buffer and a polysorbate-type non-ionic surfactant such as Tween-20.

65. The method of any one of claims 45 to 64, wherein the biological sample comprises pooled subject samples.

66. The method of any one of claims 45 to 64, wherein detecting monkeypox virus in the biological sample is performed in less than about 3 hours, preferably less than about 2 hours, from the time of receiving the biological sample.

67. The method of any one of claims 45 to 56 and 65 to 66, wherein said providing of said reaction mixture comprises heating the biological sample at 95° C. for 15 to 45 minutes, preferably about 30 minutes; mixing the heated biological sample with a lysis solution to form a volume of a confirmatory template; A nucleic acid amplification reaction mixture is generated comprising at least a portion of the volume of confirmatory template, the composition of claims 1 to 40, and a nucleic acid polymerase.

68. The method of any one of claims 45 to 67, further comprising: The biological sample is received.

69. The method of claim 68, wherein receiving the biological sample comprises receiving a sample collection device or other container containing the biological sample.

70. The method of claim 69, wherein the sample collection device is a sealable tube.

71. The method of any one of claims 68 to 71, wherein the biological sample is received after self-collection by a subject.

72. The method of any one of claims 68 to 71, wherein said receiving of said biological sample comprises receiving a raw saliva sample.

73. The method of any one of claims 67 to 71, further comprising: Before mixing the heated biological sample with the lysis solution, the heated sample is equilibrated to room temperature.

74. The method of any one of claims 67 to 74, wherein a sample collection device is used to receive and heat the biological sample.

75. A composition for multiplex detection of monkeypox virus nucleic acid and orthopoxvirus nucleic acid, the composition comprising: A first primer-probe set comprising a first forward primer and a first reverse primer, each of the first forward primer and the first reverse primer being configured to hybridize to different ends of a first target nucleic acid sequence present in a target region of monkeypox virus DNA, to a DNA copy of the first target nucleic acid sequence, or to a complementary sequence of the first target nucleic acid sequence or a DNA copy of the complementary sequence, and a first probe configured to hybridize to a first target nucleic acid subsequence that is complementary to or identical to the first target nucleic acid sequence, or to a DNA copy of the first target nucleic acid subsequence, wherein the first primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NOs: 16-180; A second primer-probe set comprising a second forward primer and a second reverse primer, each of the second forward primer and the second reverse primer being configured to hybridize to a different end of a second target sequence present in the target region of the orthopoxvirus DNA, to a DNA copy of the second target nucleic acid sequence, or to a complementary sequence of the second target nucleic acid sequence or a DNA copy of the complementary sequence, and a second probe configured to hybridize to a second target nucleic acid subsequence that is complementary to or identical to the second target nucleic acid sequence, or to a DNA copy of the second target nucleic acid subsequence, The second primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NOs: 4-12.

76. The composition of claim 75, wherein The first primer-probe set includes at least one nucleic acid sequence selected from SEQ ID NO: 41, 49, 55, 64, 96, 104, 110, 119, 151, 159, 165 and 174.

77. The composition of any one of claims 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO:

41.

78. The composition of any one of claims 75 to 77, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

96.

79. The composition of any one of claims 75 to 78, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

151.

80. The composition of any one of claims 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO:

49.

81. The composition of any one of claims 75, 76, or 80, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

104.

82. The composition of any one of claims 75, 76, 80, or 81, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

159.

83. The composition of any one of claims 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO:

55.

84. The composition of any one of claims 75, 76 or 83, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

110.

85. The composition of any one of claims 75, 76, 83 or 84, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

165.

86. The composition of any one of claims 75 or 76, wherein the first primer-probe set comprises at least one nucleic acid sequence having SEQ ID NO:

64.

87. The composition of any one of claims 75, 76 or 86, wherein the first primer-probe set further comprises at least one nucleic acid sequence having SEQ ID NO:

119.

88. The composition of any one of claims 75, 76, 86 or 87, wherein The first primer-probe set also includes at least one nucleic acid sequence having SEQ ID NO:

174.

89. The composition of any one of claims 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NOs: 4-6.

90. The composition of any one of claims 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NOs: 7-9.

91. The composition of any one of claims 75 to 88, wherein the second primer-probe set comprises at least one nucleic acid sequence having SEQ ID NOs: 10-12.

92. The composition of any one of claims 75 to 91, further comprising: The third primer-probe set comprises a third forward primer and a third reverse primer, each of the third forward primer and the third reverse primer being configured to hybridize to a different end of a third target nucleic acid sequence present in the target region of human ribonuclease P, and a third probe configured to hybridize to a third target nucleic acid subsequence that is complementary to or identical to the third target nucleic acid sequence, or to a DNA copy of the third target nucleic acid subsequence, The third primer-probe set comprises at least one nucleic acid sequence selected from SEQ ID NOs: 13-15.

93. The composition of any one of claims 75 to 92, wherein the first nucleic acid probe, the second nucleic acid probe, and the third nucleic acid probe each further comprise a different detectable label.

94. The composition of claim 93, wherein The detectable label is a fluorescent label, and The first nucleic acid probe, the second nucleic acid probe, and the third nucleic acid probe each further comprise a different quencher that quenches the corresponding detectable label or the corresponding fluorescent label.

95. The composition of any one of claims 93 or 94, wherein the first nucleic acid probe, the second nucleic acid probe, and the third nucleic acid probe are each labeled with the detectable label at the 5' end and with the quencher at the 3' end.

96. The composition of any one of claims 75 to 95, further comprising: The biological sample, polymerase, buffer and dNTP.

97. The composition of any one of claims 75 to 96, wherein the biological sample is a nucleic acid sample, and the nucleic acid sample is a DNA sample.

98. The composition of any one of claims 75 to 96, wherein the biological sample is selected from the group consisting of: lesion fluid on a dry swab, lesion fluid swab in viral transport medium, lesion fluid on a glass slide, lesion scab, lesion dome, saliva sample, buccal sample, nasal sample, nasopharyngeal sample, blood sample, urine sample, and semen sample.

99. The composition of any one of claims 75 to 98, wherein the biological sample is a human sample.

100. The composition of any one of claims 75 to 98, wherein the biological sample is a non-human sample.

Images