Application of specific adenosine receptor inhibitor PSB-603 in preparation of medicine for treating gastric cancer

Abstract

The invention discloses application of a specific adenosine receptor inhibitor PSB-603 in preparation of a medicine for treating gastric cancer, and relates to the technical field of biological medicines. According to the invention, on the basis of a relatively hot immune checkpoint NT5E / CD73 which is researched in the field of solid tumors at present, the problem of related molecular mechanisms for intervening and relieving the progression of the low-differentiation gastric cancer by using the adenosine receptor A2b antagonist PSB-603 is solved, a specific action receptor and a downstream signal channel are defined, and a theoretical basis is provided for combined targeted therapy of gastric cancer immunotherapy.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to the application of the specific adenosine receptor inhibitor PSB-603 in the preparation of drugs for treating gastric cancer. Background Technology

[0002] The NT5E (ecto-5'-nucleotidase) gene encodes the CD73 protein, a multifunctional glycoprotein anchored to the cell membrane by glycosylphosphatidylinositol (GPI). With a relative molecular weight of 70 kDa, it catalyzes the conversion of extracellular AMP into membrane-permeable adenosine (Ado). CD73 mediates the production of extracellular Ado and is coupled with G protein-coupled receptors adenosine receptors A1 (ADORA1), ADORA2A, ADORA2B, and ADORA3. Each receptor has a unique binding affinity and signal transduction mechanism with adenosine. Under normal physiological conditions, Ado exists in tissues at low concentrations; during periods of heightened metabolic stress, Ado levels regulate immune and inflammatory responses through enhanced CD73 activity, a necessary response for tissue repair after injury. High concentrations of adenosine can promote tumor growth by inhibiting tumor immune responses and stimulating tumor angiogenesis. The CD73-ADO signaling pathway is utilized by cells in the tumor microenvironment, leading to the suppression of tumor-mediated immune regulation. In the immune system, extracellular adenosine mediates anti-inflammatory effects by acting on different immune cells. In various in vivo tumor models, extracellular adenosine, by binding to specific receptors, can enhance the function of suppressive immune cells such as myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs), while weakening the function of protective immune cells such as T cells and NK cells. Previous studies have shown that specific CD39 expression in macrophages and CD73 expression in hepatocellular carcinoma cells in PD-L1-resistant advanced liver cancer synergistically activate the eATP-adenosine pathway, impairing CD8+ T cell function and driving anti-PD1 resistance. However, the role of the CD73-ADO-ADOR axis in the gastric cancer microenvironment remains unclear. PSB-603 is an ADORA2B antagonist that exerts anti-inflammatory and anti-tumor effects by blocking the binding of adenosine to adenosine receptors on cells. However, there are no reports confirming whether PSB-603 delays the progression of advanced gastric cancer by acting on gastric cancer-associated immune cells.

[0003] Increased adenosine levels in the tumor microenvironment can suppress effector immune cells (such as NK cells and cytotoxic T lymphocytes), thereby inhibiting the host's immune defense mechanisms. This suggests that targeting immunosuppressive adenosine is a promising target for improving the clinical prognosis of cancer patients. Following adenosine stimulation, macrophages undergo M2 phenotypic polarization primarily through the activation of A2B receptors. C / EBPβ is a major transcription factor mediated by adenosine in macrophage activation. Furthermore, C / EBPβ in rat glomerular mesangial cells can enhance TGF-β1 promoter activity, increasing TGF-β1 levels in rat kidney tissue and thus inducing Thy-1 nephritis. In immunosuppressive breast tumor subpopulations, upregulated TGF-β signaling may lead to overactive deubiquitination of CD73 by the deubiquitinating enzyme OTUD4, thereby enhancing its stability and membrane abundance, promoting immune evasion, and maintaining a pro-tumor microenvironment. Our research group previously discovered that NT5E / CD73 is highly expressed in poorly differentiated gastric cancer. CIBERSORT immunoinfiltration analysis revealed high infiltration of M2 macrophages in gastric cancer tissues with high CD73 expression. Therefore, we hypothesize that in gastric cancer cells, PSB-603 upregulates TGF-β transcription and expression by inhibiting adenosine activation of macrophage A2B adenosine receptors, promoting C / EBPβ expression, and thus enhancing CD73 expression in gastric cancer cells, thereby promoting gastric cancer progression.

[0004] Currently, no research has focused on the role of NT5E / CD73 and its mediated ADO production in the gastric cancer microenvironment. This invention clarifies for the first time that the specific adenosine receptor A2B inhibitor PSB-603 inhibits the malignant phenotype of gastric cancer cells by blocking the effect of CD73-mediated adenosine production from gastric cancer cells on gastric cancer-associated macrophages, thereby reducing their polarization towards the pro-tumor M2 phenotype and decreasing the production of TGF-β secreted by macrophages. Summary of the Invention

[0005] This invention addresses the aforementioned problems by providing the application of the specific adenosine receptor inhibitor PSB-603 in the treatment of gastric cancer. NT5E / CD73 has been proven to be a key therapeutic target for tumors, and ADO, which it mediates, is an immunosuppressive metabolite that is continuously upregulated in the tumor microenvironment. However, the specific mechanisms by which CD73 and ADO exert immunosuppressive effects in the gastric cancer microenvironment have not been clearly studied. Therefore, researching the main receptors and related inhibitors that function in the major immune cells of gastric cancer can provide new insights for the prevention, treatment, and immunotherapy of gastric cancer. This invention solves the problem of the molecular mechanism by which the adenosine receptor A2b antagonist PSB-603 intervenes to alleviate the progression of poorly differentiated gastric cancer. Specifically, it inhibits the M2 pro-tumorigenic phenotype of macrophages by weakening the CD73 / ADO / ADORA2B signaling between gastric cancer cells and macrophages, thereby reducing the promoting effect of TGF-β secreted by tumor-associated macrophages on the migration and invasion of gastric cancer cells.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: This invention provides the application of a specific adenosine receptor inhibitor, PSB-603, in the preparation of drugs for treating gastric cancer.

[0007] The present invention also provides the application of NT5E / CD73 and its mediated adenosine metabolism in the preparation of drugs for treating gastric cancer.

[0008] The molecular mechanism proposed in this invention is described in [link to invention]. Figure 1 PSB-603 inhibits the malignant phenotype induced by CD73 in gastric cancer cells by blocking the effect of adenosine mediated by CD73 in gastric cancer cells on gastric cancer-associated macrophages, reducing their polarization toward the pro-tumor M2 phenotype, and decreasing the production of TGF-β secreted by macrophages.

[0009] Compared with the prior art, the beneficial effects of the present invention are as follows: Based on the currently popular immune checkpoint NT5E / CD73 in the field of solid tumors, this invention explores the role of adenosine mediated by NT5E / CD73 in the immune microenvironment of gastric cancer, and reveals the molecular mechanism by which the specific A2B adenosine receptor inhibitor PSB-603 weakens the polarization of gastric cancer-associated macrophages toward the pro-tumor M2 phenotype, providing a new target for the immunotherapy and molecular targeted therapy of gastric cancer. Attached Figure Description

[0010] Figure 1 This diagram illustrates the mechanism by which PSB-603 blocks the polarization of M2 gastric cancer-associated macrophages by CD73-mediated adenosine production from gastric cancer cells. Figure 2 Venn diagram of differentially expressed genes in gastric cancer and genes affecting survival in gastric cancer patients; Figure 3 The expression of NT5E in normal and gastric cancer tissues in the GEPIA database; Figure 4 The expression of CD73 in gastric cancer tissues at different differentiation levels is shown. A is a representative image of immunohistochemical staining of paraffin sections of adjacent and tumor tissues from gastric cancer patients using anti-CD73 antibody, and B is a statistical graph. Figure 5To detect CD73 protein in paired gastric cancer tissues using immunofluorescence staining, in the figure, A and B are CD73 (Cluster of Differentiation 73) protein (green) in normal tissue and tumor tissue, respectively; C and D are the fluorescent dye DAPI (blue) in normal tissue and tumor tissue, respectively; E and F are the merged images of normal tissue and tumor tissue, i.e., images after combining the color channels of CD73 (green) and DAPI (blue); Figure 6 Western blot was used to detect the protein expression level of CD73 in gastric cancer tissues and normal tissues. A is a Western blot bar graph for detecting the CD73 protein expression level in paired normal tissues and gastric cancer tissues; B is a statistical analysis graph of CD73 expression level in normal tissues and tumor tissues (n=12); C is a statistical graph of high, medium and low differentiation gastric cancer tissues. Figure 7 To conduct Kaplan-Meier analysis of overall survival of gastric cancer patients based on CD73 expression levels using the GEPIA database; Figure 8 Western blot was used to detect the expression level of CD73 in different gastric cancer cell lines. In the figure, GES-1 represents the normal gastric mucosal cell line, and NCI-N87, KATO-Ⅲ, HGC-27 and AGS represent four gastric cancer cell lines. Figure 9 To verify the overexpression efficiency of CD73 by RT-qPCR, in the figure, LV-NC (Lentivirus-NegativeControl) is the control group, and LV-NT5E (Lentivirus-ecto-5'-nucleotidase) is the experimental group transfected with NT5E and stably overexpressed by lentivirus. Figure 10 To verify the overexpression efficiency of CD73 using Western blot, LV-NC represents the control group, and LV-NT5E represents the experimental group with stable lentiviral overexpression and transfection with NT5E. Figure 11 To verify the efficiency of stable NT5E knockdown by RT-qPCR, in the figure, LV-shNC (Lentivirus-shNegative Control) is the control group, LV-sh1 (Lentivirus-sh1) is the experimental group 1 with stable NT5E knockdown by lentivirus, LV-sh2 (Lentivirus-sh2) is the experimental group 2 with stable NT5E knockdown by lentivirus, and LV-sh3 (Lentivirus-sh3) is the experimental group 3 with stable NT5E knockdown by lentivirus. sh1, sh2 and sh3 represent different NT53 genomic fragments knocked down by shRNA vectors. Figure 12 To verify the efficiency of stable NT5E knockdown using Western blot, LV-shNC is the control group, LV-sh1 is the experimental group 1 with stable NT5E knockdown by lentivirus, LV-sh2 is the experimental group 2 with stable NT5E knockdown by lentivirus, and LV-sh3 is the experimental group 3 with stable NT5E knockdown by lentivirus. sh1, sh2 and sh3 represent different NT53 genomic fragments knocked down by shRNA vectors. Figure 13 The migration ability of AGS cells overexpressing NT5E / CD73 was measured using a cell scratch assay. In the figure, Vector represents the control group, and OE (Overexpression) represents the experimental group overexpressing NT5E. Figure 14 To determine the migration ability of HGC-27 cells after knocking down NT5E / CD73 in the Transwell migration assay, shNC (shNegative Control) represents the control group, and sh1 and sh2 represent different NT53 genomic fragments knocked down by shRNA vectors. Figure 15 To determine the invasive ability of AGS cells overexpressing NT5E / CD73 in the invasion assay, Vector represents the control group and OE represents the experimental group overexpressing NT5E. Figure 16 The adenosine content secreted by HGC-27 and AGS cells after knockdown and overexpression of NT5E / CD73 were detected by ELISA. In the figure, LV-NC is the control group, LV-sh1 is the experimental group 1 with stable NT5E knockdown by lentivirus, LV-sh2 is the experimental group 2 with stable NT5E knockdown by lentivirus, and OE represents the experimental group with overexpression of NT5E. Figure 17 To assess the infiltration of immune cells in gastric cancer tissue based on CD73 expression levels using the CIBERSORT algorithm; Figure 18 To detect the effect of different concentrations of adenosine on macrophage activity using the MTT assay; Figure 19 To determine the chemotactic ability of macrophages and tumor cells after co-culturing supernatants in the Transwell assay, in the figure, shNC (shNegative Control) represents the control group, sh1 and sh2 represent different NT53 genomic fragment knockdown groups of shRNA vectors, and +ADO (Adenosine) represents exogenous addition of adenosine. Figure 20The figure shows a statistical graph of the chemotactic ability of macrophages and tumor cells after co-culturing in the supernatant of Transwell assay. In the figure, shNC represents the control group, sh1 and sh2 represent different NT53 genomic fragment knockdown groups by shRNA vectors, and +ADO represents exogenous addition of adenosine. Figure 21 To detect the expression levels of adenosine receptors ADOA1R, ADOA2AR, ADOA2BR, and ADOA3R on the surface of macrophages after co-culturing macrophage and tumor cell supernatants by RT-qPCR, in the figure, TCM (Tumor Conditional Medium) represents the conditioned medium of tumor cell supernatant, THP1+AGS TCM represents macrophages co-cultured with TCM, Vector represents the empty vector group, OE represents the experimental group of tumor cells overexpressing NT5E, and OE+ADO represents the experimental group of tumor cells overexpressing NT5E with exogenous addition of ADO. Figure 22 The secretion of TGF-β by macrophages and gastric cancer cells overexpressing NT5E was measured by ELISA after co-culturing with the supernatant and after adding PSB-603 (1μM). In the figure, THP1+AGS TCM represents macrophages co-cultured with TCM, M0+AGS NC represents the control group co-cultured with M0 macrophages and AGS cell supernatant, M0+AGS OE represents the group co-cultured with M0 macrophages and AGS cell supernatant overexpressing NT5E, and M0+AGS OE+A2bRi represents the group co-cultured with M0 macrophages and AGS cell supernatant overexpressing NT5E after adding a type 2b adenosine receptor inhibitor. Figure 23 To detect the expression of TGF-β in macrophages and gastric cancer cells overexpressing NT5E after co-culturing with the supernatant and with the addition of PSB-603 (1μM), the figures show that M0+AGS NC represents the control group (M0 macrophages co-cultured with AGS cell supernatant), M0+AGS OE represents the group (M0 macrophages co-cultured with AGS cell supernatant overexpressing NT5E), and M0+AGSOE+A2bRi represents the group (M0 macrophages co-cultured with AGS cell supernatant overexpressing NT5E after the addition of a 2b adenosine receptor inhibitor). Figure 24To detect the protein expression levels of macrophages and gastric cancer cells overexpressing NT5E after co-culturing with supernatant and after adding PSB-603 (1μM) TGF-β and CEBP-β, Western blot was used. In the figure, M0+AGS NC represents the control group of co-culturing M0 macrophages with supernatant of AGS cells, M0+AGS OE represents the co-culturing group of M0 macrophages with supernatant of AGS cells overexpressing NT5E, and M0+AGS OE+A2bRi represents the group of M0 macrophages co-culturing with supernatant of AGS cells overexpressing NT5E and then adding a 2b adenosine receptor inhibitor. Figure 25 To detect the expression of TGF-β in macrophages and NT5E-knockdown gastric cancer cell supernatants after co-culturing with exogenous adenosine (20 μM) by RT-qPCR, the figures show that M0+HGC-27 NC represents the control group (M0 macrophages co-cultured with HGC-27 cell supernatants), M0+HGC-27 sh1 and M0+HGC-27 sh2 represent the M0 macrophages co-cultured with NT5E-knockdown HGC-27 cell supernatants, respectively, and M0+HGC-27 sh1+ADO and M0+HGC-27 sh2+ADO represent the M0 macrophages co-cultured with NT5E-knockdown HGC-27 cell supernatants after the addition of exogenous adenosine. Figure 26 To detect the protein expression levels of TGF-β and CEBP-β in macrophages and NT5E-knockdown gastric cancer cell supernatants after co-culturing with exogenous adenosine (20 μM), Western blot was used. In the figure, M0+HGC-27 NC represents the control group of co-culturing M0 macrophages with HGC-27 cell supernatants, M0+HGC-27 sh1 and M0+HGC-27 sh2 represent the co-culturing groups of M0 macrophages and NT5E-knockdown HGC-27 cell supernatants, respectively, and M0+HGC-27 sh1+ADO and M0+HGC-27 sh2+ADO represent the groups of M0 macrophages and NT5E-knockdown HGC-27 cell supernatants after co-culturing with exogenous adenosine, respectively. Figure 27 To detect the changes in CD73 expression levels in HGC-27 cells after treatment with different concentrations of TGF-β using Western blot; Figure 28 To detect changes in CD73 expression levels in AGS cells after treatment with different concentrations of TGF-β using Western blot; Figure 29 To detect the expression level of CD73 at different time points after TGF-β (5 μg / ml) treatment of HGC-27 cells by Western blot; Figure 30 The expression level of CD73 in AGS cells was detected by Western blot at different time points after TGF-β (5 μg / ml) treatment.

[0011] Note: * represents p <0.05; ** represents p <0.01; *** represents p <0.001; ns represents no statistical difference. Detailed Implementation

[0012] To make the objectives and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the invention and are not intended to limit the invention.

[0013] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0014] Example 1: NT5E / CD73 was upregulated in poorly differentiated gastric cancer tissues and was associated with poor prognosis in gastric cancer patients. To identify novel targets closely related to the survival of gastric cancer patients, we first screened a database to find 4578 differentially expressed genes in gastric cancer. Then, we screened another 438 genes closely related to the survival of gastric cancer patients. Taking the intersection of these two screenings, we extracted 62 differentially expressed genes associated with the survival of gastric cancer patients. Based on this, we screened for NT5E (… Figure 2 Analysis using the GEPIA online database revealed that NT5E expression levels were higher in gastric cancer tissues compared to normal tissues. Figure 3). CD73, encoded by NT5E, is an extracellular 5' nucleotidase anchored to the outer surface of the cell membrane by glycosylphosphatidylinositol (GPI). To further observe the expression pattern of CD73 in gastric cancer tissue, we used paraffin-embedded gastric cancer specimens for immunohistochemical staining and immunofluorescence staining. Specifically: (1) Paraffin embedding: After fixation, dehydration, clearing, and paraffin embedding, the tissue was immersed in an equal volume mixture of xylene and paraffin for 15 min, and then immersed and fixed in pure paraffin for 30 min. This was repeated twice, followed by embedding. (2) Sectioning; (3) Baking; (4) Dewaxing; (5) Rehydration: 99.9% alcohol I for 10 min, 99.9% alcohol II 10 min, 99.9% alcohol for 5 min, 95% alcohol for 10 min, 95% alcohol for 5 min, 80% alcohol for 10 min, 70% alcohol for 5 min, and finally put the slide into PBS for two treatments, each for 2-5 min; (6) Antigen retrieval: place the slide rack in the antigen retrieval box (the box contains pH 9.0 Tris-EDTA buffer), perform high-temperature retrieval for 10 min, and allow it to cool naturally at room temperature; (7) Antigen blocking: add endogenous peroxidase blocking agent and react at room temperature for 10 min; (8) Blocking: add 200 μl of blocking goat serum / non-specific staining blocking agent and incubate at room temperature for 10 min. (9) Incubate with primary antibody at 4°C overnight; (10) Incubate with secondary antibody at room temperature for 30 min; (11) Develop color: Add 200 μl of DAB colorimetric solution and react for 2-5 min (exploration is needed); (12) Counterstain; (13) Dehydrate: Place the slide holder in 50% ethanol for 5 min, 75% ethanol for 5 min, 85% ethanol for 5 min, 95% ethanol for 5 min, and 100% ethanol for 5 min in sequence, and finally place it in two xylene solutions for 15 min each; (14) Mount: After the tissue sections have dried at room temperature, add a drop of neutral resin or fluorescent mounting solution to the tissue and mount it with a coverslip.

[0015] The results showed that CD73-positive cells were significantly more abundant in gastric cancer tissues compared to adjacent normal tissues, especially in poorly differentiated gastric cancer tissues. Figure 4-5 Western blot results also confirmed that CD73 expression was significantly higher in moderately to poorly differentiated gastric cancer tissues than in adjacent non-tumor tissues. Figure 6 To further clarify whether NT5E / CD73 expression is related to the clinical prognosis of gastric cancer patients, we used the GEPIA database to analyze the impact of high NT5E / CD73 expression on the survival rate of gastric cancer patients. The results showed that the higher the NT5E expression, the lower the survival rate of patients. Figure 7 ).

[0016] Example 2: CD73 can promote the migration and invasion of gastric cancer cells and the production of extracellular adenosine. To investigate the role of CD73 in gastric cancer cells, we first used Western blot to detect the expression levels of CD73 in the normal gastric mucosal cell line GES-1 and four gastric cancer cell lines (NCI-N87, KATO-Ⅲ, HGC-27, and AGS) (purchased from the RSBM cell bank). Specifically: 1. RT-qPCR (1) RNA extraction ① Take equal amounts of gastric cancer tissue and adjacent tissue or gastric cancer cells and place them in a 1.5 mL Ep tube without RNase. Add 1.2 mL of Trizol for every 0.1 g of the sample. Grind the sample thoroughly using a homogenizer, mix by inverting, and then place it on ice for 5 min to lyse.

[0017] ② Add 200 μL of chloroform to each 1 mL of Trizol, shake vigorously for 15 seconds, and let stand at room temperature for 3 minutes; centrifuge at 12000 rpm for 15 minutes at 4℃; ③ After centrifugation, the liquid is divided into a colorless aqueous phase in the upper layer, a white protein phase in the middle layer, and a red organic phase in the lower layer. The upper aqueous phase is transferred to another 1.5 mL Eppendorf tube without RNase. Isopropanol is added at a volume ratio of 1:1. After mixing, the mixture is placed at room temperature for 8-10 min. After centrifugation at 12000 rpm for 10 min at 4℃, the supernatant is discarded. ④ Add 1 mL of ice-cold 75% ethanol, use a pipette to lift the RNA clump at the bottom, centrifuge at 8000 rpm for 5 min at 4℃ and discard the supernatant. Repeat this step once (for a total of two times). ⑤ Place the Ep tube in a clean bench to air dry at room temperature. After drying, dissolve the RNA in 20 μL LEPC water (RNA-free water). ⑥ The concentration and purity of RNA were determined using Nanodrop, and then stored in a -80°C freezer for later use.

[0018] (2) RNA reverse transcription According to the reverse transcription reaction kit instructions, prepare a total reaction volume of 20 μL and place the prepared total volume into a PCR instrument for reverse transcription.

[0019] (3) Real-time PCR Primer preparation: Prepare 10 μM solutions according to the primer instructions. Following the qPCR kit instructions, prepare a 20 μL reaction mixture, add it to an eight-tube PCR instrument, and perform qPCR detection.

[0020] 2. Western blotting (1) Total protein extraction ① Add cold PBS to the gastric cancer tissue and adjacent tissue respectively, homogenize with a tissue homogenizer until there are no obvious solids visible to the naked eye, let stand on ice for 5 minutes, and then aspirate the supernatant into another pre-cooled 1.5mL Eppendorf tube.

[0021] ② Add tissue lysis buffer, place on ice for 30 minutes for lysis, and sonicate to fully lyse the protein.

[0022] ③ Centrifuge at 12000 rpm and 4℃ for 15 min, then transfer the supernatant to a new Ep tube.

[0023] ④ BCA quantification method for protein concentration determination: ⑤ Add 200 μL of 5× protein loading buffer, place the Ep tube in boiling water at 100℃ for 10 min, cool and store at -20℃ for later use.

[0024] (2) Preparation of SDS-PAGE adhesive (3) Sample loading and electrophoresis (4) Transfer: The transfer clamp is placed in the order of black electrode -- sea -- thin filter paper (2 layers) -- glue -- PVDM membrane (activated by methanol) -- thin filter paper -- sponge -- white electrode.

[0025] (5) Blocking: Add blocking solution (5% skim milk powder) and block on a shaker at room temperature for 1 hour.

[0026] (6) Incubate the primary antibody at 4°C overnight.

[0027] (7) Incubate the secondary antibody at room temperature for 1 hour and then develop color.

[0028] The results showed that CD73 expression was lowest in the AGS cell line and highest in the HGC-27 cell line. Figure 8 Therefore, we overexpressed NT5E in AGS cells, constructed a stable NT5E knockdown cell line using HGC-27, and used RT-qPCR and Western blot experiments to detect the overexpression and knockdown efficiencies (NT5E-RNAi(123281-1): GGAATCGTTGGATACACTTCC; NT5E-RNAi(123282-1): GGAGGACACTCCAACACATTT; NT5E-RNAi(123283-1): GGCACTGGGAAATCATGAATT, as shown in SEQ ID NO:1~SEQ ID NO:3). The results showed that NT5E / CD73 was significantly overexpressed in the AGS cell line and effectively knocked down in HGC-27 cells. Figure 9-12To investigate the effects of NT5E / CD73 on the migration and invasion of gastric cancer cells, we used scratch assays and Transwell assays to verify the changes in the metastatic ability of gastric cancer cells after overexpression or knockdown of NT5E. The results showed that NT5E overexpression promoted the migration and invasion of gastric cancer cells, while NT5E knockdown inhibited the migration of gastric cancer cells. Figure 13-15 CD73 can hydrolyze extracellular AMP into membrane-permeable adenosine. Therefore, we used ELISA to detect changes in adenosine content in the supernatant of gastric cancer cells after NT5E knockdown or overexpression. We found that the adenosine content in the supernatant of gastric cancer cells decreased after NT5E knockdown and increased after NT5E overexpression. Figure 16 The above results demonstrate that NT5E / CD73 can promote the migration and invasion of gastric cancer cells and the production of extracellular adenosine.

[0029] Example 3: Adenosine derived from gastric cancer cells can promote macrophage M2 polarization and TGF-β expression and secretion through the ADOA2BR / CEBPβ ​​pathway. 1. Adenosine derived from gastric cancer cells can promote macrophage M2 polarization via ADOA2BR. Previous studies have shown that adenosine plays an important role in mediating tumor immune escape in the tumor microenvironment. We used CIBERSORT to analyze the infiltration levels of 22 immune cell types in the gastric cancer microenvironment, and the results showed a high proportion of M2 macrophages (…). Figure 17 Therefore, we hypothesized that adenosine derived from gastric cancer cells could promote macrophage polarization towards the M2 phenotype. We first induced human monocytes (THP1) to differentiate into M0 macrophages using phorbol ester (PMA), and then treated the M0 macrophages with supernatants from gastric cancer cells overexpressing or knocking down NT5E. Subsequently, we treated the M0 macrophages with different concentrations of adenosine, and used an MTT assay to detect macrophage viability. The results showed that 10 μM adenosine significantly induced macrophage activation. Figure 18 Transwell assays also showed that, compared with gastric cancer cell supernatant, knockdown of NT5E in gastric cancer cell supernatant weakened the chemotactic activity of THP1, and exogenous adenosine supplementation significantly increased the chemotactic activity of THP1. Figures 19-20 To identify the receptors that adenosine plays a role in inducing M2 polarization in macrophages, we used RT-qPCR to detect the expression of four adenosine receptors. The results showed that ADOA2BR expression in macrophages was significantly upregulated after treatment with supernatant from gastric cancer cells overexpressing NT5E and after the addition of exogenous adenosine. Figure 21 ).

[0030] 2. The specific A2B adenosine receptor inhibitor PSB-603 can inhibit the expression and secretion of TGF-β in macrophages through the ADO2BR / CEBPβ ​​pathway. Based on the above co-culture, the expression levels of CEBPβ ​​and TGF-β on macrophages were detected by ELISA, RT-qPCR, and Western blot using the specific A2B adenosine receptor inhibitor PSB-603 (50 μM, MedChemExpress) to antagonize adenosine A2B receptors on macrophages, or by adding exogenous adenosine. ELISA results also confirmed that treatment of macrophages with supernatant from gastric cancer cells overexpressing NT5E significantly increased TGF-β secretion, while the addition of the adenosine receptor A2B inhibitor PSB-603 significantly decreased TGF-β secretion. Figure 22 The results of RT-qPCR and Western blot also showed the same trend as the ELISA results. Figure 23-26 This study confirmed that the specific A2B adenosine receptor inhibitor PSB-603 can inhibit the expression and secretion of TGF-β in macrophages through the ADOA2BR / CEBPβ ​​pathway.

[0031] Example 4: Gastric cancer-associated macrophages maintain CD73 expression in gastric cancer cells by activating the Smad2 / 3 / 4 signaling pathway via TGF-β. Previous studies have shown that cells in the tumor microenvironment can interact through the direct binding of various ligands and their receptors. These studies have demonstrated that high expression of CD73 in gastric cancer cells can increase the concentration of adenosine in the tumor microenvironment, promote macrophage polarization towards the M2 phenotype, and increase TGF-β secretion. Therefore, we hypothesize that TGF-β can promote CD73 expression in gastric cancer cells through positive feedback. Different concentrations of exogenous TGF-β (0, 1, 2, 5, 10, 20 ng / ml) were added to gastric cancer cells, and the effect of TGF-β on CD73 expression was detected by Western blot. The results showed that 5 ng / ml TGF-β significantly induced upregulation of CD73 expression in gastric cancer cells. Figure 27-28 Subsequent experiments all used 5 ng / ml TGF-β to treat gastric cancer cells. Western blot analysis showed that TGF-β could promote the expression of p-Smad2 / 3, Smad4, and SUMO1 in a time-dependent manner. Figures 29-30 This indicates that TGF-β maintains CD73 expression by activating the TGF-β / Smad2 / 3 / 4 signaling pathway.

[0032] In summary, adenosine derived from gastric cancer cells can act on the receptor ADOA2BR on gastric cancer-associated macrophages, stimulating the expression of the downstream transcription factor CEBPβ, promoting the transcription and protein expression of TGF-β to induce macrophage transformation to the M2 phenotype. Poorly differentiated gastric cancer tissues and cells highly express NT5E / CD73, upregulating adenosine levels in the tumor microenvironment outside gastric cancer cells.

[0033] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a specific adenosine receptor inhibitor PSB-603 in the preparation of a drug for treating gastric cancer, characterized in that: The PSB-603 blocks the effect of adenosine produced by NT5E / CD73-mediated gastric cancer cell production on gastric cancer-associated macrophages, thereby weakening their polarization toward the tumor-promoting M2 phenotype.

Images